Encephalitis Lethargica und Hundestaupe

F. Lewy,R. Kantorowicz

DOI: https://doi.org/10.1007/BF01737140

1925-06-01

Klinische Wochenschrift

Abstract:

What problem does this paper attempt to address?

Analytical electron microscopy in the study of pneumoconiosis.

H. Hayashi

DOI: https://doi.org/10.1016/0013-9351(80)90075-4

IF: 8.3

1980-12-01

Environmental Research

Abstract:
Cost-effectiveness analysis for clinical procedures in oncology.

M. Weinstein

IF: 1.318

Bulletin du Cancer

Abstract:The provision of medical care consumes resources, and the resources available for the provision of medical care are limited. Decisions are being made at many levels of the Health Care System, including providers and fiscal intermediaries, to allocate these resources. Such decisions, however, are often inconsistent with the objective of deriving the maximum health benefits from the resources spent. Many cost-effectiveness and benefit-cost studies have been conducted in order to guide present and future resource allocation decisions. Many analyses have not been accepted by health care decision makers because a critical factor or issue has been omitted. In the attempt to be objective, the analyst may avoid uncertainties or subjective value judgments that often dominate the thinking of the decision maker. The role of the analyst in cost-effectiveness analysis, as in decision analysis for the individual patient, is to clarify and highlight such factors not to obfuscate them.
Obesity induces male mice infertility via oxidative stress, apoptosis, and glycolysis

Jianqiu Han,Chen Zhao,Huixia Guo,Tengfei Liu,Yongmei Li,Yalei Qi,Jan M Deussing,Yanjia Zhang,Juan Tan,Honghui Han,Xueyun Ma

DOI: https://doi.org/10.1530/REP-23-0097

2023-05-26

Reproduction

Abstract:In brief: The current declining trend in male fertility parallels the increasing prevalence of obesity worldwide. This paper revealed that the poor in vitro fertilization rates and decreased sperm motility in obese mice due to excessive oxidative stress enhanced apoptosis and impaired glucose metabolism in the testes. Abstract: Obesity is an urgent public health problem in recent decades, linked to reduced reproductive potential, and negatively affects the success of assisted reproduction technology. The aim of this study is to investigate the mechanisms underlying impaired male fertility caused by obesity. Male C57BL/6 mice fed a high-fat diet for 20 weeks served as mouse models with moderate (20% < body fat rate (BFR) < 30%) and severe obesity (BFR > 30%). Our results showed poor in vitro fertilization rates and decreased sperm motility in obese mice. Abnormal testicular structures were identified in male mice with moderate and severe obesity. The expression level of malondialdehyde increased with obesity severity. This finding indicates that oxidative stress plays a role in male infertility caused by obesity, which was further confirmed by the decreased expression of nuclear factor erythroid 2-related factor 2, superoxide dismutase, and glutathione peroxidases. Our study also found that the expression of cleaved caspase-3 and B-cell lymphoma-2 showed an obesity severity-dependent manner indicating that apoptosis is highly correlated with male infertility caused by obesity. Moreover, the expression of glycolysis-related proteins, including glucose transporter 8, lactate dehydrogenase A, monocarboxylate transporter 2 (MCT2), and MCT4, decreased significantly in the testes of obese male mice, suggesting energy supply for spermatogenesis is impaired by obesity. Taken together, our findings provide evidence that obesity impairs male fertility through oxidative stress, apoptosis, and blockage of energy supply in the testes and suggest that male obesity influences fertility through complex and multiple mechanisms.
Obesity and Male Infertility: True, True, and Unrelated?

Carl Ceraolo,Amanda Rubano,J. Scott Gabrielsen

DOI: https://doi.org/10.1055/s-0043-1777725

2024-01-12

Seminars in Reproductive Medicine

Abstract:While the prevalence of obesity has rapidly increased worldwide, there has also been a notable decline in semen parameters over the last several decades. While obesity can negatively impact reproductive hormones, many studies have sought a link between rising obesity and decreased male fertility potential. Nonetheless, few data support a direct link between the two. The focus on obesity as a causative factor in male infertility can potentially result in patient harm through delayed fertility treatment and missed diagnoses. This review investigates the associations between obesity and male infertility and why a potential direct link has been elusive and may not exist. Additionally, indirect mechanisms that may link the two will be reviewed and treatment options for obese infertile men presenting for evaluation will briefly be discussed. Article published online: 10 January 2024 © 2023. Thieme. All rights reserved. Thieme Medical Publishers, Inc. 333 Seventh Avenue, 18th Floor, New York, NY 10001, USA

obstetrics & gynecology,reproductive biology
A ripple effect? The impact of obesity on sperm quality and function

Maria Inês Alfaiate,Renata Santos Tavares,João Ramalho-Santos

DOI: https://doi.org/10.1071/rd23215

2024-04-12

Reproduction Fertility and Development

Abstract:Infertility affects approximately 15% of couples trying to conceive. Male-related causes account for roughly 50% of cases, with obesity emerging as a possible significant factor. Obesity, defined as a body mass index of 30.0 or higher, has become a widespread epidemic associated with numerous health issues, including a decrease of fertility. This review discusses the relationship between obesity and male infertility, particularly focusing on sperm quality and function. An overview of the literature suggests that obesity may influence the male reproductive system via disruptions in hormonal profiles, oxidative stress, and inflammation, leading to changes in sperm parameters. Several studies have discussed if obesity causes a decrease in sperm concentration, motility, and normal morphology, so far without a consensus being reached. However, available evidence suggests an impairment of sperm function in obese men, due to an increase in DNA damage and oxidative stress, impaired mitochondrial function and acrosome reaction in response to progesterone. Finally, the relationship between obesity and assisted reproductive technologies outcomes remains debatable, with conflicting evidence regarding the influence on fertilisation, pregnancy, and live birth rates. Therefore, the actual impact of obesity on human spermatozoa still needs to be clarified, due to the multiple factors potentially in play.

developmental biology,zoology,reproductive biology
Obesity and Reproduction

Wendy S. Vitek

DOI: https://doi.org/10.1055/s-0043-1777336

2024-01-12

Seminars in Reproductive Medicine

Abstract:Obesity, defined as a body mass index (BMI) greater than 30 kg/m 2 , is a highly prevalent chronic disease that increases health risks in nearly every body system, including the reproductive system. Obesity rates in the United States have tripled over the past 60 years and severe obesity has risen 10-fold. Similar trends in the prevalence of obesity are observed in counties that adopt a Western diet and lifestyle, fueled by industrialized foods, sedentary behaviors, inadequate sleep, and chronic stress due to structural inequality. While obesity is multifactorial, the rise in obesity coincides with the rise in ultra-processed foods, a likely culprit driving the global obesity epidemic. Ultra-processed foods are industrial foods composed of manufactured, calorically dense ingredients that are self-stable, convenient, low cost, and appealing to food cravings. Nearly 60% of the diet consumed by U.S. adults is composed of ultra-processed foods, possibly the highest consumption of any country. The Western diet and lifestyle have been linked to both female and male infertility and the negative impact of ultra-processed foods on fertility is starting to emerge in the literature. While the solution to combating obesity likely lies in food policy and public health initiatives, clinicians are increasingly faced with the challenge of treating women and men with obesity who experience infertility and recurrent pregnancy loss. This issue of Seminars in Reproductive Medicine provides a comprehensive update on how obesity impacts all aspects of reproduction and infertility treatment in women and men from the perspectives of academic clinicians in Reproductive Endocrinology and Infertility, Urology and Medical Endocrinology. First, Dr. Adam Evans provides a framework for recognizing and addressing weight stigma in women with obesity who seek reproductive health care. Next, Dr. Scott Gabrielsen, Dr. Carl Ceraolo, and Dr. Amanda Rubano walk us through a thought-provoking review of the literature that questions whether or not obesity truly impacts male fertility and the physiologic mechanisms by which obesity may alter male reproduction. The following three articles focus on obesity and female fertility. Dr. Christina Boots and Samantha McLean explore how excess weight and miscarriage are correlated and the limitations of the observational evidence. They provide a framework for providing compassionate and patient-centered approach to addressing obesity in women with miscarriage as weight loss does not clearly improve reproductive outcomes. Dr. Samantha Schon, Dr. Emily Ferrell, and Dr. Abira A. Choudhry provide a concise review of the impact of obesity on IVF outcomes and how to plan IVF care in women with obesity accordingly. Dr. Stephanie Estes and Dr. Ciara Marshall provide an in-depth review of the surgical challenges of providing safe ambulatory reproductive surgery and offer tips for avoiding musculoskeletal strain and injuries in the surgeon when operating of patients with larger bodies. Finally, Dr. Alyse Goldberg, Dr. Samin Dolatabadi, Dr. Heidi Dutton, and Dr. Jamie L. Behham explore the application and safety of anti-obesity medications in the preconception period in women with obesity and infertility, a timely review given the meteoric rise in the use of GLP-1 agonists among reproductive-age women. Given that obesity rates, and the severity of obesity, are projected to increase, clinicians in reproductive medicine must adapt to provide inclusive infertility care for women and men with obesity. Obesity is not the result of an individual patient's failure to regulate their diet and activity through willpower, but a failure to create an environment that supports optimal diet and lifestyle in the face of seismic societal and technological changes that have made an obesogenic lifestyle the norm. Blaming and shaming patients with obesity and infertility is not the answer. Nor is advising patients to try harder to lose weight through restrictive dieting and over-exercising as the data do not support the efficacy of these approaches to improve reproductive outcomes. The authors in this issue provide a roadmap to delivering respectful, safe, and effective infertility care for our patients with obesity - if we are willing to see them as more than a BMI number. Article published online: 10 January 2024 © 2023. Thieme. All rights reserved. Thieme Medical Publishers, Inc. 333 Seventh Avenue, 18th Floor, New York, NY 10001, USA

obstetrics & gynecology,reproductive biology
Mapping the Landscape of Obesity Effects on Male Reproductive Function: A Bibliometric Study

Yanhong Wei,Meihua Liao,Yiming Lu,Xiaocan Lei,Junli Wang,Linlin Hu,Xiaoqiong Luo

DOI: https://doi.org/10.2174/0118715303271117231220072051

2024-01-30

Abstract:Background:: Due to changes in lifestyle and dietary habits, the global population with obesity is increasing gradually, resulting in a significant rise in the number of individuals having obesity. Obesity is caused by an imbalance between energy intake and consumption, leading to excessive fat accumulation, which interferes with normal human metabolism. It is also associated with cardiovascular disease, metabolic syndrome, male reproductive endocrine regulation disorders, systemic and local inflammatory reactions, excessive oxidative stress, and apoptosis. All these factors can damage the internal environment for sperm generation and maturation, resulting in male sexual dysfunction, a decline in sperm quality, and lower fertility. This study analyzes the trends and priorities of the effects of obesity on male reproductive disorders from a bibliometric perspective. Methods:: This study uses the Web of Science as the statistical source, covering all time spans. Tools like Web of Science, VOSviewer, and CiteSpace are used to analyze countries, institutions, authors, journals, and keywords in the field. Total publications, total citations, and average number of citations are selected for statistics. Results:: The results show that the research on the impact of obesity on male reproductive function can be roughly divided into three stages: the initial stage, the slow development stage, and the rapid development stage. Our statistical scope includes 463 highly relevant articles that we have screened. We found that the journal with the most publications in this field is Andrologia, and the institution with the highest total citations is the University of Utah. The most influential countries, institutions, and authors in this field are the United States, the University of Utah, and Carrell, Douglas. Currently, research related to the impact of obesity on male reproduction focuses mainly on three aspects: biochemistry, molecular biology, and reproductive biology. The keyword explosion results indicate that sperm, obesity, and male reproduction are at the forefront and trends of future research in this field. There has been a shift from basic biochemical and molecular research to research on molecular mechanisms relying on omics technologies. However, we have observed that the number of papers published in 2022 is lower than in 2021, indicating a growth interruption during this period. Considering that this deviation may be due to the impact of the COVID-19 pandemic, it may hinder the progress of certain experiments in 2022. In recent years, China has rapidly developed research in this field. However, the average citation rate is relatively low, indicating the need for Chinese scholars to improve the quality of their articles further. Based on our research and in the context of global obesity, men are at risk of increased infertility. Addressing this issue relies on our continued research into the mechanisms of obesity-related male reproductive disorders. Over the past forty-three years, with the contributions of scientists worldwide, research in this field has flourished. Conclusion:: The impact of obesity on male reproductive disorders has been extensively studied. Currently, research in this field primarily focuses on male sperm function, sperm quality, and the effects or mechanisms of cells on male reproduction. Future trends in this field should concentrate on the relationship between male fertility and energy metabolism, as well as the endocrine function of adipose tissue. This study comprehensively analyzes the current research status and global trends in obesity and male reproductive disorders. We also discuss the future developments in this field, making it easier for researchers to understand its developmental history, current status, and trends, providing valuable reference for effective exploration in this area.

pharmacology & pharmacy,immunology,endocrinology & metabolism
Does an increase in adipose tissue 'weight' affect male fertility? A systematic review and meta-analysis based on semen analysis performed using the WHO 2010 criteria

Daniele Santi,Francesco Lotti,Clotilde Sparano,Giulia Rastrelli,Andrea M Isidori,Rosario Pivonello,Arcangelo Barbonetti,Andrea Salonia,Suks Minhas,Csilla Krausz,Linda Vignozzi,Mario Maggi,Giovanni Corona

DOI: https://doi.org/10.1111/andr.13460

Andrology

Abstract:Introduction: Obesity negatively impact on the metabolism of sex hormones, leading to reduced testosterone serum levels. However, how the obesity could negatively impact on the overall gonadal function, particularly on male fertility, remained unclear so far. Objective: To systematically review evidences regarding the influence of body weight excess on the sperm production. Methods: A meta-analysis was conducted, searching all prospective and retrospective observational studies reporting male subjects older than 18 years old, with body weight excess from overweight to severe obesity were considered. Only studies using the V edition of the World Health Organization (WHO) manual for semen analysis interpretation were considered. No specific interventions were considered. Search was focused on studies comparing overweight/obese to normal weight subjects. Results: Twenty-eight studies were considered. Total sperm count and sperm progressive motility were significantly lower in overweight compared to normal weight subjects. Meta-regression analyses demonstrated that patients' age impacted on sperm parameters. Similarly, obese men showed lower sperm concentration, total sperm number, progressive and total motilities, and normal morphology lower than normal weight subjects. Reduced sperm concentration in obese men was influenced by age, smoking habit, varicocele, and total testosterone serum levels at meta-regression analyses. Conclusions: The male potential fertility is reduced in subjects with increased body weight, compared to normal weight men. The higher was the increased body weight, the worst was the sperm quantity/quality. This result comprehensively included obesity among non-communicable risk factor for male infertility, shedding new lights on the negative impact of increased body weight on overall gonadal function.
Underestimated Aspects in Male Infertility: Epigenetics is A New Approach in Men with Obesity or Diabetes: A Review

Maryam Jazayeri,Alireza Alizadeh,Mohammadali Sadighi,Poopak Eftekhari-Yazdi,Mohsen Sharafi,Abdolhossein Shahverdi

DOI: https://doi.org/10.22074/ijfs.2021.534003.1158

2022-08-21

Abstract:Infertility is a complex multifactorial problem that affects about 7% of men and 15% of couples worldwide. Many molecular mechanisms involved in male infertility. Destructive effects of infertility on the next generations are not well understood. Approximately 60-75% of male infertility cases have idiopathic causes, and there is a need for additional investigations other than routine examinations. Molecular factors that surround DNA, which are mitotically stable and independently regulate genome activity of DNA sequences, are known as epigenetics. The known epigenetic mechanisms are DNA methylation, histone modifications and non-coding RNAs. Prevalence of metabolic diseases has been increased dramatically because of changes in lifestyle and the current levels of inactivity. Metabolic disorders, such<br />as obesity and diabetes, are prevalent reasons for male infertility; despite the association between metabolic diseases and male infertility, few studies have been conducted on the effects of epigenetic alterations associated with these diseases and sperm abnormalities. Diabetes can affect the reproductive system and testicular function at multiple levels;<br />however, there are very few molecular and epigenetic studies related to sperm from males with diabetes. On the other hand, obesity has similar conditions, while male obesity is linked to notable alterations in the sperm molecular architecture affecting both function and embryo quality. Therefore, in this review article, we presented new and developed technologies to study different patterns of epigenetic changes, and explained the exact mechanisms of epigenetic changes linked to metabolic diseases and their relationship with male infertility.
Obesity and its impact on female reproductive health: unraveling the connections

Lei Zheng,Lixian Yang,Ziru Guo,Nan Yao,Shiyu Zhang,Pengpeng Pu

DOI: https://doi.org/10.3389/fendo.2023.1326546

IF: 6.055

2024-01-10

Frontiers in Endocrinology

Abstract:In the modern era, the escalating global prevalence of obesity has profound implications on female reproductive health. Obesity, transcending mere lifestyle choices, has evolved into a complex disorder affecting physiological and metabolic functions. Concurrently, female infertility is rising as a significant global health issue. Obesity, with its extensive systemic effects, is pinpointed as a major disruptor. The convergence of these health challenges reveals a multifaceted scenario: on one hand, obesity directly impacts female reproductive health, particularly in the context of conditions like polycystic ovary syndrome (PCOS) and menstrual disturbances; on the other, the psychosocial consequences of infertility might intensify weight-gain patterns, forming a challenging cycle. Additionally, the economic implications of treating obesity-related infertility are considerable. This review delves into the myriad ways obesity affects female reproductive health, drawing insights from epidemiological, clinical, and molecular studies. It explores the epidemiological relationship between obesity and PCOS, the influence of obesity on menstrual disturbances, and the broader impact of obesity on female infertility. Weight loss, through pharmacological interventions, surgical methods, or lifestyle adjustments, emerges as a promising strategy. Lastly, the efficacy of assisted reproductive technologies, such as IVF, is influenced by obesity, underscoring the importance of an optimal body mass index. The review also highlights the molecular and physiological mechanisms underlying the impact of obesity on female reproductive health, including the disruption of the hypothalamic-pituitary-ovary axis, altered adipokine secretion, and the role of chronic inflammation and oxidative stress.

endocrinology & metabolism
Metabolic Syndrome and Male Fertility

Ana Dias Martins,Ahmad Majzoub,Ashok Agawal

DOI: https://doi.org/10.5534/wjmh.180055

2019-01-01

Abstract:Metabolic syndrome (MetS) represents a cluster of conditions that have a negative impact on human health overall. Its prevalence has been rapidly increasing worldwide and has coincided with a global decrease in birth rates and fertility potential. This review aims to address this observation through studying the relationship between MetS and male reproductive health. The effects of obesity, dyslipidemia, hypertension, and insulin resistance on male fertility were examined and supporting evidence explaining the pathophysiology of sperm dysfunction with each MetS component were described. Adopting a healthy lifestyle appears to be the single most important intervention to prevent the unwanted effects of MetS on men's health and fertility. Further studies addressing the components of MetS and their impact on male reproduction are required to enhance our understanding of the underlying pathophysiology and to propose new methods for therapeutic intervention.
Equipment for large-scale mammalian cell culture.

S. Ozturk

DOI: https://doi.org/10.1007/10_2013_259

Advances in Biochemical Engineering/Biotechnology

Abstract:
Obesity‐induced oxidative stress and mitochondrial dysfunction negatively affect sperm quality

Jia Jing,Yuanhong Peng,Weimin Fan,Siyang Han,Qihua Peng,Chunran Xue,Xinran Qin,Yue Liu,Zhide Ding

DOI: https://doi.org/10.1002/2211-5463.13589

2023-03-05

FEBS Open Bio

Abstract:Obesity is a systemic metabolic disease that can induce male infertility or subfertility through oxidative stress. The aim of this study was to determine how obesity impairs sperm mitochondrial structural integrity and function, and reduces sperm quality in both overweight/obese men and mice on a high‐fat diet (HFD). Mice fed the HFD demonstrated higher body weight and increased abdominal fat content than those fed the control diet. Such effects accompanied declines in antioxidant enzymes, such as glutathione peroxidase (GPX) and catalase and superoxide dismutase (SOD) in testicular and epidydimal tissues. Moreover, malondialdehyde (MDA) content significantly increased in sera. Mature sperm in HFD mice demonstrated higher oxidative stress, including increased mitochondrial reactive oxygen species (ROS) levels and decreased protein expression of GPX1, which may impair mitochondrial structural integrity and reduce mitochondrial membrane potential (MMP) and ATP production. Moreover, cyclic AMPK phosphorylation status increased, whereas sperm motility declined in the HFD mice. Clinical studies demonstrated that being overweight/obese reduced SOD enzyme activity in the seminal plasma and increased ROS in sperm, accompanied with lower MMP and low‐quality sperm. Furthermore, ATP content in the sperm was negatively correlated with increases in the BMI of all clinical subjects. In conclusion, our results suggest that excessive fat intake had similar disruptive effects on sperm mitochondrial structure and function as well as oxidative stress levels in humans and mice, which in turn induced lower sperm motility. This agreement strengthens the notion that fat‐induced increases in ROS and impaired mitochondrial function contribute to male subfertility.

biochemistry & molecular biology
Obesity significantly alters the human sperm proteome, with potential implications for fertility

T. Pini,J. Parks,J. Russ,M. Dzieciatkowska,K. C. Hansen,W. B. Schoolcraft,M. Katz-Jaffe

DOI: https://doi.org/10.1007/s10815-020-01707-8

2020-02-05

Journal of Assisted Reproduction and Genetics

Abstract:In men, obesity may lead to poor semen parameters and reduced fertility. However, the causative links between obesity and male infertility are not totally clear, particularly on a molecular level. As such, we investigated how obesity modifies the human sperm proteome, to elucidate any important implications for fertility.

genetics & heredity,obstetrics & gynecology,reproductive biology
Where do obesity and male infertility collide?

Melika Jahangir,Majid Nazari,Emad Babakhanzadeh,Saeed Dehghan Manshadi

DOI: https://doi.org/10.1186/s12920-024-01897-5

2024-05-12

BMC Medical Genomics

Abstract:The parallel rise in obesity and male infertility in modern societies necessitates the identification of susceptibility genes underlying these interconnected health issues. In our study, we conducted a comprehensive search in the OMIM database to identify genes commonly associated with male infertility and obesity. Subsequently, we performed an insilico analysis using the REVEL algorithm to detect pathogenic single nucleotide polymorphisms (SNPs) in the coding region of these candidate genes. To validate our findings in vivo, we conducted a comprehensive analysis of SNPs and gene expression of candidate genes in 200 obese infertile subjects and 240 obese fertile individuals using ARMS-PCR. Additionally, we analyzed 20 fertile and 22 infertile obese individuals using Realtime-qPCR. By removing duplicated queries, we obtained 197 obesity-related genes and 102 male infertility-related genes from the OMIM database. Interestingly, the APOB gene was found in common between the two datasets. REVEL identified the rs13306194 variant as potentially pathogenic with a calculated score of 0.524. The study identified a significant association between the AA (P value = 0.001) genotype and A allele (P value = 0.003) of the APOB rs13306194 variant and infertility in obese men. APOB expression levels were significantly lower in obese infertile men compared to obese fertile controls ( p < 0.01). Moreover, the AA genotype of rs13306194 APOB was associated with a significant decrease in APOB gene expression in obese infertile men ( p = 0.05). There is a significant association between the Waist-to-Hip Ratio (WHR) and LH with infertility in the obese infertile group. These results are likely to contribute to a better understanding of the causes of male infertility and its association with obesity.

genetics & heredity
Obesity and Male Reproduction; Placing the Western Diet in Context

Taylor Pini,David Raubenheimer,Stephen J Simpson,Angela J Crean,Stephen J. Simpson,Angela J. Crean

DOI: https://doi.org/10.3389/fendo.2021.622292

IF: 6.055

2021-03-11

Frontiers in Endocrinology

Abstract:There is mounting evidence that obesity has negative repercussions for reproductive physiology in males. Much of this evidence has accumulated from rodent studies employing diets high in fat and sugar (“high fat” or “western” diets). While excessive fats and carbohydrates have long been considered major determinants of diet induced obesity, a growing body of research suggests that the relationships between diet composition and obesity are more complex than originally thought, involving interactions between dietary macronutrients. However, rodent dietary models have yet to evolve to capture this, instead relying heavily on elevated levels of a single macronutrient. While this approach has highlighted important effects of obesity on male reproduction, it does not allow for interpretation of the complex, interacting effects of dietary protein, carbohydrate and fat. Further, the single nutrient approach limits the ability to draw conclusions about which diets best support reproductive function. Nutritional Geometry offers an alternative approach, assessing outcomes of interest over an extended range of dietary macronutrient compositions. This review explores the practical application of Nutritional Geometry to study the effects of dietary macronutrient balance on male reproduction, including experimental considerations specific to studies of diet and reproductive physiology. Finally, this review discusses the promising use of Nutritional Geometry in the development of evidence-based pre-conception nutritional guidance for men.

endocrinology & metabolism
Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: Identification of 13 novel mutations

C. Kim,H. Hwang,S. Song,K. Paik,E. Kwon,Kwang Bin Moon,J. Yoon,C. Han,D. Jin

DOI: https://doi.org/10.1002/humu.9128

2003-04-01

Human Mutation

Abstract:Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is an X‐linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121‐123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T, 637A>T), and 3 missense mutations (353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII RFLPs, we found three gene deletions. When the 20 mutations were depicted in a 3‐dimensional model of IDS protein, most of the mutations were found to be at structurally critical points that could interfere with refolding of the protein, although they were located in peripheral areas. We hope that these findings will further the understanding of the underlying mechanisms associated with the disease. © 2003 Wiley‐Liss, Inc.
The Impact of Obesity on Reproductive Health and Pregnancy Outcomes

Akshat Sahu,Sandhya Pajai

DOI: https://doi.org/10.7759/cureus.48882

2023-11-16

Cureus

Abstract:Women carry the majority of the burden of our obesogenic surroundings, with a larger prevalence of obesity than males, a greater impact on fertility and treatment success, and increased maternal and perinatal morbidity and death. Obesity and its associated morbidity are now among our most pressing global health concerns. Women are more susceptible to gaining weight, which has reproductive, coronary, and emotional consequences. The current data on the negative consequences of obesity before conception (fertility issues, assisted reproductive treatment, polycystic ovary disease, overweight and obesity preventative measures, and emotional well-being), pregnancy (preventing excess gestational body weight, gestational diabetes, and preeclampsia, as well as labor and newborn health), and following delivery (the lactation process and breastfeeding, postnatal weight retention, and depressive symptoms) health is summarized. in this review. Along with this, underlying factors, consequences, and solutions to the obesity pandemic are investigated, as well as the mechanisms of obesity's effect on women and men, the epigenetic consequences of masculine obesity, its significant effects on reproductive results, and the implications of the loss of weight preceding to pregnancy as well as during pregnancy. This review suggests study methodologies that might assist in guiding attempts to enhance reproductive health and neonatal health in obese or overweight women.
Male-specific consequences of obesity - functional hypogonadism and fertility disorders

Michał Rabijewski

DOI: https://doi.org/10.5603/ep.95626

Abstract:Obesity is currently one of the most serious public health problems which affects up to 30-40% of the population, and its prevalence is higher in men than in women. Complications of obesity include atherosclerosis, cardiovascular diseases, and type 2 diabetes mellitus, but it also has a negative impact on the hormonal system and fertility. The hormonal consequences of excess body fat in men are functional hypogonadism, which not only causes clinical symptoms of testosterone deficiency, but is also a risk factor for obesity (a vicious circle mechanism). Reduced fertility in obese men may be a consequence of functional hypogonadotropic hypogonadism (decreased gonadotropins and testosterone secretion, reduced libido, and erectile dysfunction), but other mechanisms associated with excess adipose tissue, like hyperinsulinaemia, hyperleptinaemia, chronic inflammation, and oxidative stress also play an important role. Therefore, in obese men deterioration of semen parameters (sperm concentration, motility, and morphology) and reduced fertility are observed, also concerning the effectiveness of assisted reproductive techniques. Reducing the mass of adipose tissue causes an increase in testosterone concentrations and has a beneficial effect on semen parameters. Functional hypogonadism in obese men should be diagnosed only after exclusion of organic causes of hypogonadism. Lifestyle changes, including physical exercise and low-caloric diet, and optimization of comorbidities, are still first line of treatment. In some patients, if such treatment is ineffective, pharmacotherapy or bariatric surgery may be considered. Testosterone replacement therapy is contraindicated in obese men with functional hypogonadism, especially in those who desire fertility. Selective oestrogen receptor modulators and aromatase inhibitors improve sperm quality but are not recommended for the treatment of hypogonadism in obese men. GLP-1 analogues appear to be effective and safe in the treatment of low testosterone and infertility in obese men and may be the main method of pharmacotherapy in the future.
How does obesity affect fertility in men - and what are the treatment options?

Victoria J. Stokes,Richard A. Anderson,Jyothis T. George

DOI: https://doi.org/10.1111/cen.12591

2014-09-16

Clinical Endocrinology

Abstract:Adiposity is associated with reduced fertility in men. The aetiology is multifactorial, with obese men at greater risk of suffering from impaired spermatogenesis, reduced circulating testosterone levels, erectile dysfunction and poor libido. The diagnosis and treatment of reduced fertility observed in obese men therefore requires insight into the underlying pathology, which has hormonal, mechanical and psychosocial aspects. This article summarises the current epidemiological, experimental and clinical trial evidence from the perspective of a practicing clinician. The following conclusions and recommendations can be drawn: Obesity is associated with low serum testosterone concentrations, but treatment with exogenous testosterone is likely to adversely impact on fertility. It is important to discuss this with men prior to initiation of testosterone therapy. Obesity adversely affects sperm concentration and may affect sperm quality. However, whether or not weight loss will correct these factors remain to be established. Oestrogen receptor modulators (and aromatase inhibitors) are unlicensed in the treatment for male hypogonadism and/or infertility. These treatments should hence be considered experimental approach until ongoing clinical trials report their outcomes.

endocrinology & metabolism

Encephalitis Lethargica und Hundestaupe

Analytical electron microscopy in the study of pneumoconiosis.

Cost-effectiveness analysis for clinical procedures in oncology.

Obesity induces male mice infertility via oxidative stress, apoptosis, and glycolysis

Obesity and Male Infertility: True, True, and Unrelated?

A ripple effect? The impact of obesity on sperm quality and function

Obesity and Reproduction

Mapping the Landscape of Obesity Effects on Male Reproductive Function: A Bibliometric Study

Does an increase in adipose tissue 'weight' affect male fertility? A systematic review and meta-analysis based on semen analysis performed using the WHO 2010 criteria

Underestimated Aspects in Male Infertility: Epigenetics is A New Approach in Men with Obesity or Diabetes: A Review

Obesity and its impact on female reproductive health: unraveling the connections

Metabolic Syndrome and Male Fertility

Equipment for large-scale mammalian cell culture.

Obesity‐induced oxidative stress and mitochondrial dysfunction negatively affect sperm quality

Obesity significantly alters the human sperm proteome, with potential implications for fertility

Where do obesity and male infertility collide?

Obesity and Male Reproduction; Placing the Western Diet in Context

Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: Identification of 13 novel mutations

The Impact of Obesity on Reproductive Health and Pregnancy Outcomes

Male-specific consequences of obesity - functional hypogonadism and fertility disorders

How does obesity affect fertility in men - and what are the treatment options?