Equipment for large-scale mammalian cell culture.

S. Ozturk

DOI: https://doi.org/10.1007/10_2013_259

Advances in Biochemical Engineering/Biotechnology

Abstract:

What problem does this paper attempt to address?

Female obesity and infertility: outcomes and regulatory guidance

Susanna Marinelli,Gabriele Napoletano,Marco Straccamore,Giuseppe Basile

DOI: https://doi.org/10.23750/abm.v93i4.13466

2022-08-31

Abstract:Obesity has been associated with reduced fertility, although the dynamics and mechanisms which link excess weight to reduced fertility are not yet fully clarified. Obese women, especially those with central obesity, are less likely to conceive per cycle. Obese women suffer from perturbations of the hypothalamus-pituitary-ovary axis, disturbances of the menstrual cycle and are up to three times more likely to suffer from oligo/anovulation. A delicate hormonal balance regulates follicular development and the maturation of oocytes and it has been observed that obesity can alter the hormonal environment: adipocytes, in fact, are responsible for the production of a hormone called leptin (present in high quantities in obese women) which has been associated with reduced fecundity. In addition to compromising ovulation, obesity negatively affects the development and implantation of the endometrium. The expression of polycystic ovary syndrome (PCOS) is regulated, in part, by weight, so obese women with PCOS often have a more severe phenotype and higher subfertility rates. Furthermore, obesity impairs women's response to medically assisted procreation (MAP) treatments. The authors have set out to delineate a broad-ranging overview of obesity's impact on female fertility, by drawing upon sources spanning the 1994-2022 period. Assisted reproductive technology (ART) procedures are also discussed as they relate to obese patients. In addition the dynamics by which maternal obesity reportedly affects fetal, neonatal and child development have also been briefly enunciated.
Obesity and its impact on female reproductive health: unraveling the connections

Lei Zheng,Lixian Yang,Ziru Guo,Nan Yao,Shiyu Zhang,Pengpeng Pu

DOI: https://doi.org/10.3389/fendo.2023.1326546

IF: 6.055

2024-01-10

Frontiers in Endocrinology

Abstract:In the modern era, the escalating global prevalence of obesity has profound implications on female reproductive health. Obesity, transcending mere lifestyle choices, has evolved into a complex disorder affecting physiological and metabolic functions. Concurrently, female infertility is rising as a significant global health issue. Obesity, with its extensive systemic effects, is pinpointed as a major disruptor. The convergence of these health challenges reveals a multifaceted scenario: on one hand, obesity directly impacts female reproductive health, particularly in the context of conditions like polycystic ovary syndrome (PCOS) and menstrual disturbances; on the other, the psychosocial consequences of infertility might intensify weight-gain patterns, forming a challenging cycle. Additionally, the economic implications of treating obesity-related infertility are considerable. This review delves into the myriad ways obesity affects female reproductive health, drawing insights from epidemiological, clinical, and molecular studies. It explores the epidemiological relationship between obesity and PCOS, the influence of obesity on menstrual disturbances, and the broader impact of obesity on female infertility. Weight loss, through pharmacological interventions, surgical methods, or lifestyle adjustments, emerges as a promising strategy. Lastly, the efficacy of assisted reproductive technologies, such as IVF, is influenced by obesity, underscoring the importance of an optimal body mass index. The review also highlights the molecular and physiological mechanisms underlying the impact of obesity on female reproductive health, including the disruption of the hypothalamic-pituitary-ovary axis, altered adipokine secretion, and the role of chronic inflammation and oxidative stress.

endocrinology & metabolism
Obesity and Reproduction

Wendy S. Vitek

DOI: https://doi.org/10.1055/s-0043-1777336

2024-01-12

Seminars in Reproductive Medicine

Abstract:Obesity, defined as a body mass index (BMI) greater than 30 kg/m 2 , is a highly prevalent chronic disease that increases health risks in nearly every body system, including the reproductive system. Obesity rates in the United States have tripled over the past 60 years and severe obesity has risen 10-fold. Similar trends in the prevalence of obesity are observed in counties that adopt a Western diet and lifestyle, fueled by industrialized foods, sedentary behaviors, inadequate sleep, and chronic stress due to structural inequality. While obesity is multifactorial, the rise in obesity coincides with the rise in ultra-processed foods, a likely culprit driving the global obesity epidemic. Ultra-processed foods are industrial foods composed of manufactured, calorically dense ingredients that are self-stable, convenient, low cost, and appealing to food cravings. Nearly 60% of the diet consumed by U.S. adults is composed of ultra-processed foods, possibly the highest consumption of any country. The Western diet and lifestyle have been linked to both female and male infertility and the negative impact of ultra-processed foods on fertility is starting to emerge in the literature. While the solution to combating obesity likely lies in food policy and public health initiatives, clinicians are increasingly faced with the challenge of treating women and men with obesity who experience infertility and recurrent pregnancy loss. This issue of Seminars in Reproductive Medicine provides a comprehensive update on how obesity impacts all aspects of reproduction and infertility treatment in women and men from the perspectives of academic clinicians in Reproductive Endocrinology and Infertility, Urology and Medical Endocrinology. First, Dr. Adam Evans provides a framework for recognizing and addressing weight stigma in women with obesity who seek reproductive health care. Next, Dr. Scott Gabrielsen, Dr. Carl Ceraolo, and Dr. Amanda Rubano walk us through a thought-provoking review of the literature that questions whether or not obesity truly impacts male fertility and the physiologic mechanisms by which obesity may alter male reproduction. The following three articles focus on obesity and female fertility. Dr. Christina Boots and Samantha McLean explore how excess weight and miscarriage are correlated and the limitations of the observational evidence. They provide a framework for providing compassionate and patient-centered approach to addressing obesity in women with miscarriage as weight loss does not clearly improve reproductive outcomes. Dr. Samantha Schon, Dr. Emily Ferrell, and Dr. Abira A. Choudhry provide a concise review of the impact of obesity on IVF outcomes and how to plan IVF care in women with obesity accordingly. Dr. Stephanie Estes and Dr. Ciara Marshall provide an in-depth review of the surgical challenges of providing safe ambulatory reproductive surgery and offer tips for avoiding musculoskeletal strain and injuries in the surgeon when operating of patients with larger bodies. Finally, Dr. Alyse Goldberg, Dr. Samin Dolatabadi, Dr. Heidi Dutton, and Dr. Jamie L. Behham explore the application and safety of anti-obesity medications in the preconception period in women with obesity and infertility, a timely review given the meteoric rise in the use of GLP-1 agonists among reproductive-age women. Given that obesity rates, and the severity of obesity, are projected to increase, clinicians in reproductive medicine must adapt to provide inclusive infertility care for women and men with obesity. Obesity is not the result of an individual patient's failure to regulate their diet and activity through willpower, but a failure to create an environment that supports optimal diet and lifestyle in the face of seismic societal and technological changes that have made an obesogenic lifestyle the norm. Blaming and shaming patients with obesity and infertility is not the answer. Nor is advising patients to try harder to lose weight through restrictive dieting and over-exercising as the data do not support the efficacy of these approaches to improve reproductive outcomes. The authors in this issue provide a roadmap to delivering respectful, safe, and effective infertility care for our patients with obesity - if we are willing to see them as more than a BMI number. Article published online: 10 January 2024 © 2023. Thieme. All rights reserved. Thieme Medical Publishers, Inc. 333 Seventh Avenue, 18th Floor, New York, NY 10001, USA

obstetrics & gynecology,reproductive biology
Female Obesity: A Probable Cause of Infertility

Nayana B Nair,Minnu Skaria,R. Sambath Kumar

DOI: https://doi.org/10.22270/jddt.v12i4.5585

2022-07-15

Journal of Drug Delivery and Therapeutics

Abstract:Obesity, a serious health problem, is a widespread affliction among women of reproductive age. Obesity and overweight refer to an abnormal and excessive fat deposition that has a negative impact on the body's health. Obesity causes a slew of issues, including social, psychological, demographic, and health issues. It has been associated to elevated health risks like diabetes, hypertension, coronary heart disease, and osteoarthritis, as well as numerous cancers like endometrial, breast, and colon cancers. Hyperandrogenemia is caused by insulin resistance and hyperinsulinemia in obese women. The levels of sex hormone-binding globulin (SHBG) are lower, but leptin levels are higher. Impaired ovulatory function and, as a result, reproductive health could be explained by these changes. Obese women have a reduced probability of giving birth to a healthy infant due to lower implantation and pregnancy rates, greater miscarriage rates, and increased maternal and fetal problems throughout pregnancy. In these people, losing weight has a positive impact on their reproductive outcomes. Keywords: Obesity, Hyperandrogenemia, Sex hormone-binding globulin (SHBG).
The impact of obesity on reproductive health and metabolism in reproductive-age females

Samantha B Schon,Hannah E Cabre,Leanne M Redman

DOI: https://doi.org/10.1016/j.fertnstert.2024.04.036

Abstract:Obesity is a highly prevalent chronic disease that impacts >40% of reproductive-aged females. The pathophysiology of obesity is complex and can be understood simply as a chronic energy imbalance whereby caloric intake exceeds caloric expenditure with an energy surplus stored in adipose tissue. Obesity may be categorized into degrees of severity as well as different phenotypes on the basis of metabolic health and underlying pathophysiology. Obesity and excess adiposity have a significant impact on fertility and reproductive health, with direct effects on the hypothalamic-pituitary-ovarian axis, the ovary and oocyte, and the endometrium. There are significant adverse pregnancy outcomes related to obesity, and excess weight gain before, during, and after pregnancy that can alter the lifelong risk for metabolically unhealthy obesity. Given the high prevalence and pervasive impact of obesity on reproductive health, there is a need for better and individualized care for reproductive-aged females that considers obesity phenotype, underlying pathophysiology, and effective and sustainable interventions to treat obesity and manage weight gain before, during, and after pregnancy.
A Starting Point for Female Infertility

Francesca Gonnella,Fani Konstantinidou,Marisa Donato,Daniela Maria Pia Gatta,Alessia Peserico,Barbara Barboni,Liborio Stuppia,Warren B. Nothnick,Valentina Gatta

DOI: https://doi.org/10.3390/ijms25136855

IF: 5.6

2024-06-23

International Journal of Molecular Sciences

Abstract:Female infertility constitutes a growing health problem in developing countries and could be associated with several possible causes including reproductive disorders, congenital malformations, infections and hormonal dysfunction. Nonetheless, a series of additional factors can also negatively impact female fertility and are represented by chronic exposure to environmental pollutants, stress, unhealthy lifestyle choices such as cigarette smoking and, among others, obesity. Excess weight is associated with several chronic diseases, and growing evidence demonstrates that it can compromise reproductive physiology due to its influence on endometrial gene expression and receptivity. Thus, the current review of the literature mainly focused on how obesity can impair uterine receptivity, mostly from a molecular point of view throughout the window of implantation (WOI) period at an endometrial level. It was also highlighted that an obesity-related increase in adipose tissue may lead to a modulation in the expression of multiple pathways, which could cause a hostile endometrial environment with a consequent negative impact on the uterine receptivity and the establishment of pregnancy. Thanks to the use of the endometrial receptivity assay (ERA), a specific microarray that studies the expression of a series of genes, it is now possible to evaluate the endometrial status of patients with infertility problems in a more detailed manner. Moreover, female fertility and endometrial receptivity could be affected by endometriosis, a chronic benign gynecological disease, whose cause-and-effect relationship to obesity is still uncertain. Therefore, further investigations would be required to better elucidate these mechanisms that govern embryo implantation and could be potentially useful for the generation of new strategies to overcome implantation failure and improve the pregnancy rates in obese women.

biochemistry & molecular biology,chemistry, multidisciplinary
Role of Obesity in Female Reproduction

Wei Yong,Jiajia Wang,Yan Leng,Lijie Li,Han Wang

DOI: https://doi.org/10.7150/ijms.80189

2023-01-01

International Journal of Medical Sciences

Abstract:Contemporary scientists need no "p value" and "relative risk" statistics to be exquisitely aware of the increasing prevalence of obesity and complications posed by obesity.It is now well recognized that obesity is strongly associated with type 2 diabetes, hypertension, vascular disease, tumors and reproductive disorders.Obese women show lower levels of gonadotropin hormones, reduced fecundity, higher miscarriage rates and poorer outcomes of in vitro fertilization, revealing that obesity affects female reproduction.In addition, adipose tissue contains special immune cells and obesity-induced inflammation is a chronic, low-grade inflammatory response.Herein, we mainly review detrimental influences of obesity in the complete process of female reproduction, including hypothalamic-pituitary-ovarian axis, oocyte maturation, embryo and fetal development.In the latter part, we view obesity-induced inflammation and discuss related epigenetic impact on female reproduction.
Obesity and female reproductive function

R Pettigrew,D Hamilton-Fairley

DOI: https://doi.org/10.1093/oxfordjournals.bmb.a011617

Abstract:Obesity has consistently been demonstrated to have a detrimental effect upon the female reproductive system. This review explores the common association of obesity with polycystic ovary syndrome (PCOS), the effect of obesity on the clinical and endocrinological parameters, and the role of insulin resistance in the expression of this disorder. An improvement in menstrual function, a decrease in the clinical androgenic profile, and significant increase in spontaneous pregnancy rates have been reported following weight loss. Obesity is associated with poor pregnancy outcome and miscarriage in both women with PCOS, and in those with normal ovarian morphology. The optimal weight gain during pregnancy remains controversial, but obesity is a risk factor for both maternal and fetal complications, and dietary advice should be offered on an individual basis according to the pre-pregnancy BMI. Weight gain at the time of menopause is common, and dietary advice is paramount as obesity is an independent risk factor for thrombosis, coronary heart disease (CHD), and breast and endometrial cancer. Effective nutritional counselling should be offered at all stages of the female reproductive lifecycle.
Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: Identification of 13 novel mutations

C. Kim,H. Hwang,S. Song,K. Paik,E. Kwon,Kwang Bin Moon,J. Yoon,C. Han,D. Jin

DOI: https://doi.org/10.1002/humu.9128

2003-04-01

Human Mutation

Abstract:Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is an X‐linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121‐123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T, 637A>T), and 3 missense mutations (353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII RFLPs, we found three gene deletions. When the 20 mutations were depicted in a 3‐dimensional model of IDS protein, most of the mutations were found to be at structurally critical points that could interfere with refolding of the protein, although they were located in peripheral areas. We hope that these findings will further the understanding of the underlying mechanisms associated with the disease. © 2003 Wiley‐Liss, Inc.
Potential Cardiovascular Risks of Proton Pump Inhibitors in the General Population.

Wengen Zhu,K. Hong

DOI: https://doi.org/10.1536/ihj.16-208

2017-03-17

International Heart Journal

Abstract:Proton pump inhibitors (PPIs) are the most effective gastric acid-suppressing agents and the mainstay medical therapy for a series of acid peptic diseases. In general, the safety profile of PPIs is excellent. However, with long-term drug administration, the safety and potency of PPIs has been questioned. In the cardiovascular field, drug-drug interactions related to PPIs have been identified with particular attention regarding the use of PPIs combined with clopidogrel in patients with acute coronary syndrome. Currently, cardiovascular risks from PPIs may extend from patients with coronary artery disease to the general population. This review summarizes the possible cardiovascular risks in PPI users with no history of cardiovascular diseases and discusses possible biological mechanisms.
Overweight and obesity negatively affect the outcomes of ovarian stimulation and invitro fertilisation: A cohort study of 2628 Chinese women

Dan Zhang,Yimin Zhu,Huijuan Gao,Biao Zhou,Runju Zhang,Tingting Wang,Guolian Ding,Fan Qu,Hefeng Huang,Xiue Lü

DOI: https://doi.org/10.3109/09513591003632100

2010-01-01

Gynecological Endocrinology

Abstract:Study design. A retrospective cohort study was carried out in 2222 normal weight (18.5 < BMI < 25), 379 overweight (25 < BMI < 30) and 27 obese (BMI >= 30) women who underwent their first IVF cycles between 2002 and 2008. Cycle characteristics and IVF outcomes were analysed. Results. Obese women required significantly higher dose of rFSH (3272 IU vs. 2587 IU, p < 0.001) and days of stimulation (11.89 +/- 4.57 vs. 10.42 +/- 2.03, p < 0.001), but exhibited less oocytes retrieved and significantly lower fertilisation rate (54.1% vs. 61.1%, p < 0.001) than normal weight women. Compared with normal weight women, overweight women displayed significantly less oocytes retrieved (12.98 +/- 6.91 vs. 14.49 +/- 7.96, p < 0.001), lower fertilisation rate (60.8 +/- 23.3 vs. 61.1 +/- 23.0, p < 0.001), less cleavaged embryos (7.55 +/- 4.86 vs. 8.67 +/- 5.90, p < 0.001), less high-grade embryos (4.65 +/- 3.96 vs. 5.59 +/- 4.81, p < 0.001) and cryopreserved embryos (4.44 +/- 4.55 vs. 5.49 +/- 5.55, p < 0.001). All parameters of pregnancy outcomes, including pregnancy rate, miscarriage rate and live birth rate, were comparable among three groups. Conclusions. Overweight and obesity are related with impared ovarian response, and negatively affect the outcomes of IVF.
The Impact of Obesity on Reproductive Health and Pregnancy Outcomes

Akshat Sahu,Sandhya Pajai

DOI: https://doi.org/10.7759/cureus.48882

2023-11-16

Cureus

Abstract:Women carry the majority of the burden of our obesogenic surroundings, with a larger prevalence of obesity than males, a greater impact on fertility and treatment success, and increased maternal and perinatal morbidity and death. Obesity and its associated morbidity are now among our most pressing global health concerns. Women are more susceptible to gaining weight, which has reproductive, coronary, and emotional consequences. The current data on the negative consequences of obesity before conception (fertility issues, assisted reproductive treatment, polycystic ovary disease, overweight and obesity preventative measures, and emotional well-being), pregnancy (preventing excess gestational body weight, gestational diabetes, and preeclampsia, as well as labor and newborn health), and following delivery (the lactation process and breastfeeding, postnatal weight retention, and depressive symptoms) health is summarized. in this review. Along with this, underlying factors, consequences, and solutions to the obesity pandemic are investigated, as well as the mechanisms of obesity's effect on women and men, the epigenetic consequences of masculine obesity, its significant effects on reproductive results, and the implications of the loss of weight preceding to pregnancy as well as during pregnancy. This review suggests study methodologies that might assist in guiding attempts to enhance reproductive health and neonatal health in obese or overweight women.
The impact of obesity on fertility and sexual function in women of child bearing age

Alparslan Deniz,Muhammed Okuyucu

DOI: https://doi.org/10.1080/01443615.2022.2106828

2022-08-09

Journal of Obstetrics and Gynaecology

Abstract:Obesity and infertility are health problems that are increasing in frequency. In this study, sexual dysfunction in obese infertile women was investigated. A total of 450 women who met the inclusion criteria were recruited for the study; 150 women who had obesity without infertility, 150 women who had obesity with infertility and 150 women with normal weight but without infertility, which was the control group. The mean age of the groups were 31.3 ± 3.9, 31.2 ± 3.8 and 31.1 ± 4.5, respectively. The participants were administered a sociodemographic data form, the Female Sexual Function Index (FSFI) and the Beck Depression Inventory following the measurement of body mass index (BMI). FSFI score below 26.55 was defined as sexual dysfunction. Our data were analysed using SPSS (Statistical Package for Social Sciences) 21.0 for Windows (SPSS Inc., Chicago, IL). FSFI scores were observed to be statistically significantly lower in the group of obese women with infertility than in the other two groups. In our study, sexual dysfunction was found to be statistically significantly higher in obese women with infertility compared to the control group. Therefore, healthcare professionals should evaluate infertility in obese women in terms of sexual dysfunction as well as infertility treatment. What is already known on this subject? Psychological problems such as depression and anxiety, changes in sex hormones, and adipokines were reported to have negative impacts on sexual functions (Plaisance et al. 2009 Plaisance EP , Grandjean PW , Judd RL , Jones KW , Taylor JK. 2009 . The influence of sex, body composition, and nonesterified fatty acids on serum adipokine concentrations . Metabolism 58: 1557 – 1563 . [Crossref], [PubMed] , [Google Scholar] ; Kendler et al. 2010 Kendler KS , Kessler RC , Walters EE , MacLean C , Neale MC , Heath AC , et al. 2010 . Stressful life events, genetic liability, and onset of an episode of major depression in women . Focus 8: 459 – 470 . [Crossref] , [Google Scholar] ; Yaylali et al. 2010 Yaylali G , Tekekoglu S , Akin F. 2010 . Sexual dysfunction in obese and overweight women . International Journal of Impotence Research 22: 220 – 226 . [Crossref], [PubMed], [Web of Science ®] , [Google Scholar] ). There are also various reports stating that female infertility has negative effects on sexual satisfaction and that fertility anxiety may affect sexual functions as an independent factor (Pakpour et al. 2012 Pakpour AH , Yekaninejad MS , Zeidi IM , Burri A. -Abstract Truncated-

obstetrics & gynecology
High-fat Diet-Induced Obesity Primes Fatty Acid Β-Oxidation Impairment and Consequent Ovarian Dysfunction During Early Pregnancy

Qingying Li,Sujuan Guo,Chengshun Yang,Xueqing Liu,Xuemei Chen,Junlin He,Chao Tong,Yubin Ding,Chuan Peng,Yanqing Geng,Xinyi Mu,Taihang Liu,Fangfang Li,Yingxiong Wang,Rufei Gao

DOI: https://doi.org/10.21037/atm-21-2027

IF: 3.616

2021-01-01

Annals of Translational Medicine

Abstract:BACKGROUND:Obesity is associated with many adverse effects on female fertility. Obese women have a higher likelihood of developing ovulatory dysfunction due to dysregulation of the hypothalamic-pituitary-ovarian axis. However, the effect of obesity on ovarian function during early pregnancy needs to be further assessed.METHODS:C57BL6/J mice were given a high-fat diet (HFD) for 12 weeks to induce obesity. An in vitro high-fat model was established by treating the human ovarian granulosa cell line KGN with oleic acid and palmitic acid. Ovarian morphology of obese mice in early pregnancy was assessed by hematoxylin and eosin staining and ovarian function was assessed by enzyme-linked immunosorbent assay, western blotting, and immunohistochemistry. Oil Red O staining and transmission electron microscopy were used to detect fatty acid accumulation. Specific markers relating to the ovarian functional mechanism were assessed by real-time PCR, western blotting, lactate detection, adenosine triphosphate (ATP) detection, biochemical analyses, and enzyme-linked immunosorbent assay.RESULTS:The results of this study showed that during early pregnancy, the number of corpus lutea, serum estradiol and progesterone levels, and the expression of the steroid biosynthesis-related protein CYP19A1 (aromatase), CYP11A1 (cholesterol side chain cleavage enzyme), and StAR (steroidogenic acute regulatory protein), were significantly increased in HFD mice. Mice fed an HFD also showed a significant increase in ovarian lipid accumulation on day 7 of pregnancy. Genes involved in fatty acid synthesis (Acsl4 and Elovl5), and fatty acid uptake and transport (Slc27a4), together with the β-oxidation rate-limiting enzyme Cpt1a, were significantly upregulated in HFD mice. Specifically, there was abnormal elevation of ATP and aberrant expression of tricarboxylic acid cycle (TCA)- and electron transport chain (ETC)-related genes in the ovaries of pregnant HFD mice. KGN cells treated with etomoxir targeting β-oxidation of fatty acid showed decreased TCA cycle and ETC related gene expression. The elevation of ATP and estradiol and progesterone levels was reversed.CONCLUSIONS:During early pregnancy, HFD-induced obesity increases fatty acid β-oxidation, which in turn increases TCA cycle and ETC related gene expression, leading to increased ATP production and ovarian dysfunction.
Analytical electron microscopy in the study of pneumoconiosis.

H. Hayashi

DOI: https://doi.org/10.1016/0013-9351(80)90075-4

IF: 8.3

1980-12-01

Environmental Research

Abstract:
Acute Effects of Insulin in the Control of VLDL Production in Humans: Implications for the insulin-resistant state

G. Lewis,G. Steiner

DOI: https://doi.org/10.2337/diacare.19.4.390

1996-04-01

Diabetes Care

Abstract:The role of hyperinsulinemia in the pathogenesis of triglyceride (TG) and VLDL over-production in insulin-resistant states remains controversial. While studies in humans and animals have generally suggested that chronic hyperinsulinemia facilitates VLDL production, particularly in the presence of an abundant supply of substrate for VLDL synthesis, the majority of in vitro studies using cultured hepatocytes and hepatoma cell lines have demonstrated an acute inhibitory effect of insulin. Using radiolabeled VLDL tracers we have examined the acute effect of hyperinsulinemia on VLDL production in humans. We found a rapid suppression of plasma free fatty acid (FFA) levels in response to insulin and a consistent 50-60% insulin-induced suppression of both VLDL TG and VLDL apolipoprotein (apo) B in lean insulin-sensitive individuals. Elevation of plasma FFA levels by infusing heparin and Intralipid without hyperinsulinemia resulted in a marked increase in VLDL TG and VLDL apoB production. When the insulin-induced suppression of plasma FFA levels was prevented during hyperinsulinemia, VLDL TG production was still inhibited, although to a lesser extent than with insulin alone. We concluded from these findings that insulin suppresses VLDL production in insulin-sensitive humans partly by suppressing plasma FFA levels and partly by a non-FFA-mediated (perhaps direct hepatic) mechanism. In addition, we found that chronically insulin-resistant hyperinsulinemic obese individuals were resistant to this suppressive effect of insulin on VLDL apoB production, in keeping with similar findings by others performing in vitro experiments using cultured hepatocytes isolated from insulin-resistant or hyperinsulinemic rats. The relevance of these findings to the mechanism of hypertriglyceridemia associated with chronic insulin-resistant states in humans remains a matter of speculation. One hypothesis is that resistance to the normal suppressive effect of insulin, in association with other metabolic abnormalities associated with insulin resistance, may contribute to postprandial and postabsorptive hypertriglyceridemia.
Impact of Obesity on female reproductive health: British Fertility Society, Policy and Practice Guidelines

Adam H. Balen,Richard A. Anderson,FOR THE POLICY & PRACTICE COMMITTEE OF THE BFS

DOI: https://doi.org/10.1080/14647270701731290

2007-01-01

Human Fertility

Abstract:Obesity has a significant adverse impact on reproductive outcome. It influences not only the chance of conception but also the response to fertility treatment, and increases the risk of miscarriage, congenital anomalies and pregnancy complications in addition to potential adverse effects on long term health of both mother and infant. Women should aim for a normal BMI before starting any form of fertility treatment. Treatment should be deferred until the BMI is less than 35 kg/m2, although in those with more time (e.g., less than 37 years; normal serum FSH concentration) a weight reduction to a BMI of less than 30 kg/m2 is preferable. Clinicians should consider deferring treatment to women outside these guidelines. Women should be provided with assistance to lose weight, including psychological support, dietary advice, exercise classes and where appropriate, weight reducing agents or bariatric surgery. Even a moderate weight loss of 5-10% of body weight can be sufficient to restore fertility and improve metabolic markers.

obstetrics & gynecology,reproductive biology
The Impact of the Endocrine and Immunological Function of Adipose Tissue on Reproduction in Women with Obesity

Katarzyna Mączka,Olga Stasiak,Paulina Przybysz,Monika Grymowicz,Roman Smolarczyk

DOI: https://doi.org/10.3390/ijms25179391

IF: 5.6

2024-08-31

International Journal of Molecular Sciences

Abstract:Obesity, which leads to metabolic dysregulation and body function impairment, emerges as one of the pressing health challenges worldwide. Excessive body fat deposits comprise a dynamic and biologically active organ possessing its own endocrine function. One of the mechanisms underlying the pathophysiology of obesity is low-grade systemic inflammation mediated by pro-inflammatory factors such as free fatty acids, lipopolysaccharides, adipokines (including leptin, resistin and visfatin) and cytokines (TNF-α, IL-1β, Il-6), which are secreted by adipose tissue. Together with obesity-induced insulin resistance and hyperandrogenism, the exacerbated immune response has a negative impact on the hypothalamic–pituitary–gonadal axis at all levels and directly affects reproduction. In women, it results in disrupted ovarian function, irregular menstrual cycles and anovulation, contributing to infertility. This review focuses on the abnormal intracellular communication, altered gene expression and signaling pathways activated in obesity, underscoring its multifactorial character and consequences at a molecular level. Extensive presentation of the complex interplay between adipokines, cytokines, immune cells and neurons may serve as a foundation for future studies in search of potential sites for more targeted treatment of reproductive disorders related to obesity.

biochemistry & molecular biology,chemistry, multidisciplinary
Genes Linked to Obesity-Related Infertility: Bridging the Knowledge Gap

Praveen Kumar Chandra Sekar,Ramakrishnan Veerabathiran

DOI: https://doi.org/10.1097/rd9.0000000000000096

2024-03-28

Reproductive and Developmental Medicine

Abstract:Genetic factors play a pivotal role in the complex relationship between obesity and infertility. This article delves into the genetics of obesity-related infertility, focusing on the essential genes and mechanisms in both sexes. We explored infertility factors in obese females, focusing on polycystic ovary syndrome (PCOS) and the influence of genes like insulin receptor ( INSR ), androgen receptor ( AR ), and follicle-stimulating hormone receptor ( FSHR ). Epigenetic changes are believed to contribute to PCOS-related infertility. The impact of adipokines and inflammation on obesity-related infertility has been discussed, with genes such as fat mass and obesity ( FTO ) and Melanocortin-4-receptor ( MC4R ) playing significant roles. Genetic factors affecting sperm quality and function, including nuclear receptor subfamily 3 group C member 1 ( NR3C1 ) and methylenetetrahydrofolate reductase ( MTHFR ), have been investigated in obesity-related infertility in males. Hormonal dysregulation influenced by genetic markers, such as leptin receptor ( LEPR ), tumor necrosis factor-alpha ( TNF-α ), and interleukin-6 ( IL-6 ), was also examined. Genetic factors play a vital role in obesity-related infertility in both sexes. Genes involved in metabolism, hormonal regulation, and inflammation contribute to the complex association between obesity and infertility. Epigenetic changes further complicate the relationship. Understanding these genetic mechanisms is essential to address obesity-related infertility and develop personalized interventions.

obstetrics & gynecology
Obesity may impair response to ovarian stimulation. A retrospective observational study on oocyte quality

Irene Iavarone,Daniela Mele,Francesca Caprio,Giada Andreoli,Maria Giovanna Vastarella,Pasquale de Franciscis,Carlo Ronsini

DOI: https://doi.org/10.3389/fcell.2024.1461132

IF: 5.5

2024-10-09

Frontiers in Cell and Developmental Biology

Abstract:Background: Ovulatory dysfunction is more common in women with obesity. Body fat distribution is also crucial because anovulatory women have a greater waist circumference and more abdominal fat than ovulatory women of similar BMI. The primary aim of the present study is to determine whether there is a relationship between BMI and reproductive characteristics, including hormonal values, antral follicle count (AFC), endometrial assessment at transvaginal ultrasound evaluation (TVUS) during controlled ovarian stimulation (COS), and oocyte retrieval after Ovum Pick-Up (OPU). Methods: Data from a cohort of 183 patients were analyzed and divided into three groups based on weight status: normal weight, overweight, and obesity. Evaluated reproductive characteristics included: age, basal values of follicle-stimulating hormone (FSH), luteinizing hormone (LH), 17-beta-estradiol (E2), thyroid stimulating hormone (TSH), anti-müllerian hormone (AMH), antral-follicle-count (AFC), duration of COS, E2, and progesterone at the last monitoring, TVUS endometrial thickness at the last monitoring before OPU, FOI after OPU. Additionally, the number of meiosis II oocytes retrieved (MII), the total dose of FSH administered, the ratio between MII and total FSH administered, and OSI were registered. Results: AMH levels were significantly lower in obese patients compared to normal weight and overweight women (1.05 IQR 1.20, 1.58 IQR 2.16, 1.32 IQR 1.38, respectively, p -value = 0.032). When looking at the MII/FSH ratio, the normal weight group showed a median value of 3.3 with an IQR of 4.0, the overweight group showed a median value of 2.3 with an IQR of 1.9, and the obese group had a median value of 2.6 with an IQR of 2.8. Those data were statistically significant ( p -value = 0.049). Conclusion: These results emphasize the importance of considering weight status in fertility assessment and treatment planning.

cell biology,developmental biology

Equipment for large-scale mammalian cell culture.

Female obesity and infertility: outcomes and regulatory guidance

Obesity and its impact on female reproductive health: unraveling the connections

Obesity and Reproduction

Female Obesity: A Probable Cause of Infertility

The impact of obesity on reproductive health and metabolism in reproductive-age females

A Starting Point for Female Infertility

Role of Obesity in Female Reproduction

Obesity and female reproductive function

Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: Identification of 13 novel mutations

Potential Cardiovascular Risks of Proton Pump Inhibitors in the General Population.

Overweight and obesity negatively affect the outcomes of ovarian stimulation and invitro fertilisation: A cohort study of 2628 Chinese women

The Impact of Obesity on Reproductive Health and Pregnancy Outcomes

The impact of obesity on fertility and sexual function in women of child bearing age

High-fat Diet-Induced Obesity Primes Fatty Acid Β-Oxidation Impairment and Consequent Ovarian Dysfunction During Early Pregnancy

Analytical electron microscopy in the study of pneumoconiosis.

Acute Effects of Insulin in the Control of VLDL Production in Humans: Implications for the insulin-resistant state

Impact of Obesity on female reproductive health: British Fertility Society, Policy and Practice Guidelines

The Impact of the Endocrine and Immunological Function of Adipose Tissue on Reproduction in Women with Obesity

Genes Linked to Obesity-Related Infertility: Bridging the Knowledge Gap

Obesity may impair response to ovarian stimulation. A retrospective observational study on oocyte quality