Abstract:Background Immune checkpoint inhibitors are an important therapy. However, their essence is nonspecific and efficiency of single usage is not satisfactory. The mutant neoantigen specific T (Nas-T) cell, as an adoptive cell treatment, is a specific immunotherapy for each individual. Our previous research has proved that the combined immunotherapy of mutant Nas-T cell and PD1 antibody is more effective than PD1 alone in prolonging PFS (World Conference on Lung Cancer 2018). We aim to evaluate the characteristics of the immune repertoire (IR) as a predictive biomarker for immunotherapy and to construct personalized and specific TCR-T. Methods 14 patients with advanced solid tumors who failed after multiline treatments were recruited. They were divided into durable clinical benefit (complete response, partial response or stable disease for more than 3 months) and non-durable clinical benefit (DCB and NCB) based on PFS. Peripheral blood was collected at baseline and each cycle. IR-seq of the CDR3 regions of human TCRβ chains was used to interrogate the TCRs frequency. We used single neoantigen to stimulate the infused T cells and performed RNAseq for the sorted CD137(+) cells to obtain the full-length TCR α and β chain. Lastly, we constructed TCR-T cells via transfecting the TCR α/β pair into the T cells of patients and co-cultured with neoantigen to analyze the functionality of TCRs. Results After neoantigen pulsing, the clonality of infused T cells pool significantly increased (P = 0.0001), suggesting some tumor-specific T-cells were expanded and enriched after neoantigen pulsing. Compared to baseline, T-cell repertoire of NCB and DCB after 1st cycle displayed significant changes: Shannon 1.19 vs 0.97 (P = 0.002); clonality 0.68 vs 1.19 (P = 0.001). Elevated clonality may indicate expanded tumor-specific T-cells which could recognize mutant neoantigen specifically. Besides, based on the in vitro TCR-T experiments, the constructed TCR-T cells can specifically recognize the mutant neoantigen and lyse the target cells expressing the corresponding neoantigen. Table . 1228P Neoantigen Sequence HLA-I typing TCR Vα TCR Vβ Gene name Sequence* All V Hits With Score# Clonal Sequence# All V Hits With Score# Clonal Sequence# MTAP/SPINK1 Fused Gene VLLPRHMKV A0201 TRAV35 (574.6) TGTGCTGGGTATGGCTCTAGCAA CACAGGCAAACTAATCTTT TRBV19 (646.8) TGTGCCAGTCGGACAGGGGGA TCACCCCTCCACTTT FER NYVSNVSKF A2301 TRAV29DV5 (667.6) TGTGCAGCTTCAACTGGGGCAAA CAACCTCTTCTTT TRBV7-2 (626.7) TGTGCCAGCACCTCTGCCCCC TCCTACGAGCAGTACTTC SPINK1 FLLSALALL B4403 TRAV20 (589.1) TGTGCTGTTCCCCTGGGAACAGG CTTTCAGAAACTTGTATTT (response to neoantigen) TRBV21-1 (557.8) TGTGCCAGCAGCAAAGACCCT AGCGGGAATCAAGAGACCCAGTACTTC CLCN6 ALIGAAASL B6701 TRAV19 (612.4) TGTGCTCTTCTGAATTATGGTGGTGC TACAAACAAGCTCATCTTT TRBV6-5 (675.4) TGTGCCAGCAGTGGGACAGCCAATGA GCAGTTCTTC (response to neoantigen) MTAP AESFMFRTW C0401 TRAV38-2DV8 (658.4) TGTGCTTATTGGGAGCTTGTCTCTGGGG CTGGGAGTTACCAACTCACTTTC TRBV5-1 (637.6) TGCGCCAGCAGCTTGACTAGCGGGGGG TTCTACGAGCAGTACTTC TAP1 RLSLFLALV C0702 TRAV16 (622.2) TGTGCTCCCTGGGCCCTAGGAGGAGG TGCTGACGGACTCACCTTT TRBV30 (403.4) TGTGCCTGGAGTGTAACAGGGGGC AAAGCAGATACGCAGTATTTT MAN2C1 FLQGRNFFL Conclusions The mutant Nas-T cell is a personalized immunotherapy. IR is a potential predictive biomarker. Legal entity responsible for the study Shunchang Jiao. Funding Has not received any funding. Disclosure All authors have declared no conflicts of interest.

Neoantigen-specific CD4+ tumor-infiltrating lymphocytes are potent effectors identified within adoptive cell therapy products for metastatic melanoma patients

Response to tumor-infiltrating lymphocyte adoptive therapy is associated with preexisting CD8 + T-myeloid cell networks in melanoma

Neoantigen-specific stem cell memory-like CD4+ T cells mediate CD8+ T cell-dependent immunotherapy of MHC class II-negative solid tumors

Neoantigen-specific stimulation of tumor-infiltrating lymphocytes enables effective TCR isolation and expansion while preserving stem-like memory phenotypes

Tumor-reactive T cell clonotype dynamics underlying clinical response to TIL therapy in melanoma

An Update on Adoptive T-Cell Therapy and Neoantigen Vaccines

Tumor infiltrating lymphocytes (TIL) therapy in metastatic melanoma: boosting of neoantigen-specific T cell reactivity and long-term follow-up

Tumor-infiltrating lymphocytes for adoptive cell therapy: recent advances, challenges, and future directions

Ex vivo modulation of intact tumor fragments with anti-PD-1 and anti-CTLA-4 influences the expansion and specificity of tumor-infiltrating lymphocytes

Adoptive transfer of personalized neoantigen-reactive TCR-transduced T cells in metastatic colorectal cancer: phase 2 trial interim results

Adoptive cell therapy with tumor-infiltrating lymphocytes supported by checkpoint inhibition across multiple solid cancer types

Abstract 13: Discovery and development of T cell receptors targeting MAGE family antigens for adoptive T cell therapy against solid tumors

Phenotypic signatures of circulating neoantigen-reactive CD8+ T cells in patients with metastatic cancers

Identifying and engineering TCR specificity against solid tumor neoantigens

Abstract 1: Biomarkers of response and acquired resistance to TIL-ACT in solid tumors

Combined IL-2, agonistic CD3 and 4-1BB stimulation preserve clonotype hierarchy in propagated non-small cell lung cancer tumor-infiltrating lymphocytes

The Mutant Neoantigen Specific T Cell is a Personalized Immunotherapy in Refractory Solid Tumour

An immunogenic personal neoantigen vaccine for patients with melanoma

Neoantigen Identification Strategies Enable Personalized Immunotherapy in Refractory Solid Tumors

A pilot study of lymphodepletion intensity for PBMC-derived, neoantigen-specific CD8+ T cells (Neo-Ts) therapy in patients with advanced solid tumors.

Abstract 4: Identifying novel patient-derived T cell receptors targeting TP53 public neoantigens