Distribution of elastic fibres in the developing rabbit craniomandibular joint.

N. Nagy,J. Daniel

DOI: https://doi.org/10.1016/0003-9969(91)90049-Z

IF: 2.64

Archives of Oral Biology

Abstract:

What problem does this paper attempt to address?

Neoantigen-specific CD4+ tumor-infiltrating lymphocytes are potent effectors identified within adoptive cell therapy products for metastatic melanoma patients

MacLean S Hall,Jamie K Teer,Xiaoqing Yu,Holly Branthoover,Sebastian Snedal,Madeline Rodriguez-Valentin,Luz Nagle,Ellen Scott,Ben Schachner,Patrick Innamarato,Amy M Hall,Jamie Blauvelt,Carolyn J Rich,Allison D Richards,Jake Ceccarelli,T J Langer,Sean J Yoder,Matthew S Beatty,Cheryl A Cox,Jane L Messina,Daniel Abate-Daga,James J Mule,John E Mullinax,Amod A Sarnaik,Shari Pilon-Thomas

DOI: https://doi.org/10.1136/jitc-2023-007288

Abstract:Background: Adoptive cell therapy (ACT) with tumor-infiltrating lymphocytes (TILs) is a promising immunotherapeutic approach for patients with advanced solid tumors. While numerous advances have been made, the contribution of neoantigen-specific CD4+T cells within TIL infusion products remains underexplored and therefore offers a significant opportunity for progress. Methods: We analyzed infused TIL products from metastatic melanoma patients previously treated with ACT for the presence of neoantigen-specific T cells. TILs were enriched on reactivity to neoantigen peptides derived and prioritized from patient sample-directed mutanome analysis. Enriched TILs were further investigated to establish the clonal neoantigen response with respect to function, transcriptomics, and persistence following ACT. Results: We discovered that neoantigen-specific TIL clones were predominantly CD4+ T cells and were present in both therapeutic responders and non-responders. CD4+ TIL demonstrated an effector T cell response with cytotoxicity toward autologous tumor in a major histocompatibility complex class II-dependent manner. These results were validated by paired TCR and single cell RNA sequencing, which elucidated transcriptomic profiles distinct to neoantigen-specific CD4+ TIL. Conclusions: Despite methods which often focus on CD8+T cells, our study supports the importance of prospective identification of neoantigen-specific CD4+ T cells within TIL products as they are a potent source of tumor-specific effectors. We further advocate for the inclusion of neoantigen-specific CD4+ TIL in future ACT protocols as a strategy to improve antitumor immunity.
Identifying and engineering TCR specificity against solid tumor neoantigens

Martin Souren Naradikian,Leslie Montero,Samantha Hall,Rukman Thota,Angela Frentzen,Milad Bahmanof,Luise Sternberg,Jerome Lane,Zeynep Kosaloglu-Yalcin,Manasa Lanka,Aaron Miller,Bjoern Peters,Ezra Cohen,Stephen Schoenberger

DOI: https://doi.org/10.4049/jimmunol.202.supp.134.1

2019-05-01

The Journal of Immunology

Abstract:Abstract Neoantigens (NeoAg) offer attractive therapeutic targets for directing a patient’s immune response to the immunogenic subset of mutations expressed exclusively by their cancer cells. Despite the specificity with which NeoAg enable tumor recognition, the majority of approaches for their identification rely on purely predictive methods such as calculating the ability of mutated peptides to bind to a patient’s set of HLA molecules. These methods have met with limited success in revealing natural targets present on tumor cells. We have developed a novel HLA-agnostic functional approach to NeoAg identification which combines genomic sequencing with bioinformatic analysis to nominate mutations for subsequent functional analysis using patient’s own T cells in an effort to identify natural responses generated under physiologic conditions. Using this, we identified a missense mutation (V205I) in the ribosomal protein RPS2 that is recognized by CD8+ T cells from tumor-infiltrating lymphocytes (TIL) of a metastatic HPV16+ Head and Neck Squamous Cell Carcinoma lesion. We then performed adoptive cellular therapy (ACT) using either unseparated TIL or those enriched for RPS2 V205I-specific CD8+ T cells and found the latter to be superior in controlling outgrowth of tumor of a PDX cell line generated from this lesion in NSG mice. Finally, we used single-cell transcriptomics to isolate the genes encoding the RPS2-specific TCR and show that it recognizes the mutated peptide bound to HLA-B*07:02. These results demonstrate that high-affinity NeoAg-specific T cell responses can be identified in cancer patients, that ACT of these cells can control tumor growth, and that the relevant TCR can be isolated for use in TCR engineering-based immunotherapy.

immunology
Abstract LB073: Adoptive transfer of one CD4TCR and one CD8TCR targeting autochthonous neoantigens are essential and sufficient for eradication of naturally heterogeneous solid tumors

Steven Wolf,Vasiliki Anastasopoulou,Kimberley Drousch,Markus Diehl,Boris Engels,Poh Yin Yew,Kazuma Kiyotani,Yusuke Nakamura,Karin Schreiber,Hans Schreiber,Matthias Leisegang

DOI: https://doi.org/10.1158/1538-7445.am2024-lb073

IF: 11.2

2024-04-07

Cancer Research

Abstract:Despite advances in checkpoint blockade therapy or adoptive transfer of tumor-infiltrating lymphocytes (TILs), achieving cure remains challenging, but success of immunotherapy seems to depend on recognition of tumor-specific antigens (neoantigens). We aimed to determine how many neoantigens need to be recognized by how many different TCRs for eradication of solid tumors. Unmanipulated, naturally expressed (autochthonous) neoantigens were targeted with adoptively transferred TCR-engineered autologous T cells (TCR-therapy). Investigated were effects of TCR-engineered CD8+ T cells, TCR-engineered CD4+ T cells or a combination of both. The targeted tumors were established for at least three weeks and derived from primary autochthonous cancer cell cultures, resembling natural solid tumors and their heterogeneity as found in humans. CD8TCR-therapy was only effective against homogenous tumors and relapse was common in heterogeneous tumors, even when targeting multiple different autochthonous neoantigens. By contrast, a combination of CD8TCR-therapy with CD4TCR-therapy, each targeting an independent neoantigen, eradicated large and established solid tumors of natural heterogeneity. CD4TCR-therapy targeted a mutant neoantigen on tumor stroma while direct cancer cell recognition by CD8TCR-therapy was essential for cure. Thus, two cancer-specific TCRs can be essential and sufficient to eradicate heterogeneous solid tumors expressing unmanipulated, autochthonous neoantigens. Citation Format: Steven Wolf, Vasiliki Anastasopoulou, Kimberley Drousch, Markus Diehl, Boris Engels, Poh Yin Yew, Kazuma Kiyotani, Yusuke Nakamura, Karin Schreiber, Hans Schreiber, Matthias Leisegang. Adoptive transfer of one CD4TCR and one CD8TCR targeting autochthonous neoantigens are essential and sufficient for eradication of naturally heterogeneous solid tumors [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 2 (Late-Breaking, Clinical Trial, and Invited s); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(7_Suppl) nr LB073.

oncology
Neoantigen-specific cytotoxic Tr1 CD4 T cells suppress cancer immunotherapy

Hussein Sultan,Yoshiko Takeuchi,Jeffrey P. Ward,Naveen Sharma,Tian-Tian Liu,Vladimir Sukhov,Maria Firulyova,Yuang Song,Samuel Ameh,Simone Brioschi,Darya Khantakova,Cora D. Arthur,J. Michael White,Heather Kohlmiller,Andres M. Salazar,Robert Burns,Helio A. Costa,Kelly D. Moynihan,Yik Andy Yeung,Ivana Djuretic,Ton N. Schumacher,Kathleen C. F. Sheehan,Marco Colonna,James P. Allison,Kenneth M. Murphy,Maxim N. Artyomov,Robert D. Schreiber

DOI: https://doi.org/10.1038/s41586-024-07752-y

IF: 64.8

2024-07-25

Nature

Abstract:CD4 + T cells can either enhance or inhibit tumour immunity. Although regulatory T cells have long been known to impede antitumour responses 1,2,3,4,5 , other CD4 + T cells have recently been implicated in inhibiting this response 6,7 . Yet, the nature and function of the latter remain unclear. Here, using vaccines containing MHC class I (MHC-I) neoantigens (neoAgs) and different doses of tumour-derived MHC-II neoAgs, we discovered that whereas the inclusion of vaccines with low doses of MHC-II-restricted peptides (LDVax) promoted tumour rejection, vaccines containing high doses of the same MHC-II neoAgs (HDVax) inhibited rejection. Characterization of the inhibitory cells induced by HDVax identified them as type 1 regulatory T (Tr1) cells expressing IL-10, granzyme B, perforin, CCL5 and LILRB4. Tumour-specific Tr1 cells suppressed tumour rejection induced by anti-PD1, LDVax or adoptively transferred tumour-specific effector T cells. Mechanistically, HDVax-induced Tr1 cells selectively killed MHC-II tumour antigen-presenting type 1 conventional dendritic cells (cDC1s), leading to low numbers of cDC1s in tumours. We then documented modalities to overcome this inhibition, specifically via anti-LILRB4 blockade, using a CD8-directed IL-2 mutein, or targeted loss of cDC2/monocytes. Collectively, these data show that cytotoxic Tr1 cells, which maintain peripheral tolerance, also inhibit antitumour responses and thereby function to impede immune control of cancer.

multidisciplinary sciences
Abstract A030: CD4 neoantigen mRNA vaccine enhances endogenous CD8 responses and tumor control

Camille-Charlotte Balanca,Aude-Hélène Capietto,Catherine Carbone,Alan Gutierrez,Yajun Chestnut,Ellen Duong,Aditya Anand,Anthony Antonelli,Jeanne Cheung,Shiuh Luoh,Ariane Nissembaum,Keiko Hokeness,Sara Wichner,Emily Freund,Vincent Javinal,Romain Bouziat,Joshua Gober,Adel ElSohly,Jon Linehan,Ugur Sahin,Lélia Delamarre,Ira Mellman

DOI: https://doi.org/10.1158/2326-6074.tumimm24-a030

IF: 10.1

2024-10-19

Cancer Immunology Research

Abstract:CD4 T cells have long been known to be critical for priming CD8 T cells, a process referred to as CD4 T cell help. Recent data have suggested that CD4 help may be delivered at the surface of conventional type 1 dendritic cells (cDC1s), which can efficiently present antigens (Ag) on both MHC class I and class II molecules. However, the actual mechanisms underlying CD4 T cell help remain poorly characterized. We sought to understand how anti-tumor T cell responses are generated in the context of mRNA vaccines, which have been shown to elicit protective CD4 and/or CD8 T cells. For this purpose, we compared two mRNA-Lipoplex (mRNA-LPX) vaccines that express a single MHC-II-restricted Ag either tumor-specific (neoAg) or tumor-irrelevant. mRNA-LPX is injected intravenously and taken up predominantly by cDCs in the spleen.As expected, both vaccines elicited systemic CD4 T cell responses. However, only the anti-tumor CD4 T cell response elicited the accumulation of tumor-infiltrating CD8 lymphocytes (CD8 TILs) that led to tumor regression in a CD8-dependant manner. Single cell RNA-sequencing revealed higher expression of effector molecules and genes associated with stem-like progenitor T cell states in CD8 TILs following neoAg vaccine. In contrast, inhibitory molecules were down-regulated in CD8 TILs from neoAg-vaccinated mice.We next characterized the role of cDCs in the response to the vaccines. We found that both mRNA-LPX vaccines induced better maturation of cDC1s than cDC2s in the spleen. Surprisingly, priming of CD4 T cells was dependent on cDC1s, rather than cDC2s. cDC1s were also required for neoAg CD4 vaccine-induced CD8 TIL accumulation and for vaccine efficacy. We investigated whether neoAg-specific CD4 T cells were i) sufficient to enhance anti-tumor CD8 responses and ii) needed to maintain effector CD8 TIL activity in situ. Using adoptive cell transfer (ACT) into the tumor, we found that the transfer of neoAg-specific CD4 T cells alone significantly delayed tumor growth, suggesting an increased CD8 TIL activity. Interestingly, while the transfer of CD8 TILs alone was insufficient to control tumors; ACT of both CD4 and CD8 T cells was required for efficient tumor rejection. cDC1s were required for the efficacy of both, the ACT of CD4 T cells alone and the CD4 and CD8 ACT combination. Taken together, our data suggest a novel mechanism whereby immunizing with exogenous CD4 T cell epitopes can produce tumor immunity by generating endogenous CD8 responses. These results emphasize the importance of cDC1s for both, eliciting tumor-specific CD4 T cells in the setting of mRNA-LPX vaccine expressing a single MHC-II-restricted Ag and improving in situ anti-tumor CD8 responses and tumor control. We are currently investigating the mechanisms and location of the MHC-II-restricted neoAg dependent-cDC1 help using both in vivo and cell culture approaches.This model provides fundamental insight for the development of cancer vaccines and highlights the need of tumor-specific CD4 T cells and mature tumor-Ag loaded cDC1s. Citation Format: Camille-Charlotte Balanca, Aude-Hélène Capietto, Catherine Carbone, Alan Gutierrez, Yajun Chestnut, Ellen Duong, Aditya Anand, Anthony Antonelli, Jeanne Cheung, Shiuh Luoh, Ariane Nissembaum, Keiko Hokeness, Sara Wichner, Emily Freund, Vincent Javinal, Romain Bouziat, Joshua Gober, Adel ElSohly, Jon Linehan, Ugur Sahin, Lélia Delamarre, Ira Mellman. CD4 neoantigen mRNA vaccine enhances endogenous CD8 responses and tumor control [abstract]. In: Proceedings of the AACR Special Conference in Cancer Research: Tumor Immunology and Immunotherapy; 2024 Oct 18-21; Boston, MA. Philadelphia (PA): AACR; Cancer Immunol Res 2024;12(10 Suppl) nr A030.

oncology,immunology
Neoantigen-specific stimulation of tumor-infiltrating lymphocytes enables effective TCR isolation and expansion while preserving stem-like memory phenotypes

Noam Levin,Sanghyun P Kim,Charles A Marquardt,Nolan R Vale,Zhiya Yu,Sivasish Sindiri,Jared J Gartner,Maria Parkhurst,Sri Krishna,Frank J Lowery,Nikolaos Zacharakis,Lior Levy,Todd D Prickett,Tiffany Benzine,Satyajit Ray,Robert V Masi,Billel Gasmi,Yong Li,Rafiqul Islam,Alakesh Bera,Stephanie L Goff,Paul F Robbins,Steven A Rosenberg

DOI: https://doi.org/10.1136/jitc-2023-008645

IF: 12.469

2024-05-01

Journal for ImmunoTherapy of Cancer

Abstract:Background Tumor-infiltrating lymphocytes (TILs) targeting neoantigens can effectively treat a selected set of metastatic solid cancers. However, harnessing TILs for cancer treatments remains challenging because neoantigen-reactive T cells are often rare and exhausted, and ex vivo expansion can further reduce their frequencies. This complicates the identification of neoantigen-reactive T-cell receptors (TCRs) and the development of TIL products with high reactivity for patient treatment. Methods We tested whether TILs could be in vitro stimulated against neoantigens to achieve selective expansion of neoantigen-reactive TILs. Given their prevalence, mutant p53 or RAS were studied as models of human neoantigens. An in vitro stimulation method, termed “NeoExpand”, was developed to provide neoantigen-specific stimulation to TILs. 25 consecutive patient TILs from tumors harboring p53 or RAS mutations were subjected to NeoExpand. Results We show that neoantigenic stimulation achieved selective expansion of neoantigen-reactive TILs and broadened the neoantigen-reactive CD4 + and CD8 + TIL clonal repertoire. This allowed the effective isolation of novel neoantigen-reactive TCRs. Out of the 25 consecutive TIL samples, neoantigenic stimulation enabled the identification of 16 unique reactivities and 42 TCRs, while conventional TIL expansion identified 9 reactivities and 14 TCRs. Single-cell transcriptome analysis revealed that neoantigenic stimulation increased neoantigen-reactive TILs with stem-like memory phenotypes expressing IL-7R, CD62L, and KLF2. Furthermore, neoantigenic stimulation improved the in vivo antitumor efficacy of TILs relative to the conventional OKT3-induced rapid TIL expansion in p53-mutated or KRAS-mutated xenograft mouse models. Conclusions Taken together, neoantigenic stimulation of TILs selectively expands neoantigen-reactive TILs by frequencies and by their clonal repertoire. NeoExpand led to improved phenotypes and functions of neoantigen-reactive TILs. Our data warrant its clinical evaluation. Trial registration number NCT00068003 , NCT01174121 , and NCT03412877 .

oncology,immunology
CD4 + T cells with convergent TCR recombination reprogram stroma and halt tumor progression in adoptive therapy

Steven P. Wolf,Matthias Leisegang,Madeline Steiner,Veronika Wallace,Kazuma Kiyotani,Yifei Hu,Leonie Rosenberger,Jun Huang,Karin Schreiber,Yusuke Nakamura,Andrea Schietinger,Hans Schreiber

DOI: https://doi.org/10.1126/sciimmunol.adp6529

IF: 30.63

2024-09-14

Science Immunology

Abstract:Cancers eventually kill hosts even when infiltrated by cancer-specific T cells. We examined whether cancer-specific T cell receptors of CD4 + T cells (CD4TCRs) from tumor-bearing hosts can be exploited for adoptive TCR therapy. We focused on CD4TCRs targeting an autochthonous mutant neoantigen that is only presented by stroma surrounding the MHC class II–negative cancer cells. The 11 most common tetramer-sorted CD4TCRs were tested using TCR-engineered CD4 + T cells. Three TCRs were characterized by convergent recombination for which multiple T cell clonotypes differed in their nucleotide sequences but encoded identical TCR α and β chains. These preferentially selected TCRs destroyed tumors equally well and halted progression through reprogramming of the tumor stroma. TCRs represented by single T cell clonotypes were similarly effective only if they shared CDR elements with preferentially selected TCRs in both α and β chains. Selecting candidate TCRs on the basis of these characteristics can help identify TCRs that are potentially therapeutically effective.

immunology
Neoantigen Cancer Vaccines and Different Immune Checkpoint Therapies Each Utilize Both Converging and Distinct Mechanisms that in Combination Enable Synergistic Therapeutic Efficacy

Sunita Keshari,Alexander S. Shavkunov,Qi Miao,Akata Saha,Charmelle D. Williams,Anna M. Highsmith,Josué E. Pineda,Elise Alspach,Kenneth H. Hu,Kristen E. Pauken,Ken Chen,Matthew M. Gubin

DOI: https://doi.org/10.1101/2023.12.20.570816

2024-01-26

Abstract:The goal of therapeutic cancer vaccines and immune checkpoint therapy (ICT) is to eliminate cancer by expanding and/or sustaining T cells with anti-tumor capabilities. However, whether cancer vaccines and ICT enhance anti-tumor immunity by distinct or overlapping mechanisms remains unclear. Here, we compared effective therapeutic tumor-specific mutant neoantigen (NeoAg) cancer vaccines with anti-CTLA-4 and/or anti-PD-1 ICT in preclinical models. Both NeoAg vaccines and ICT induce expansion of intratumoral NeoAg-specific CD8 T cells, though the degree of expansion and acquisition of effector activity was much more substantial following NeoAg vaccination. Further, we found that NeoAg vaccines are particularly adept at inducing proliferating and stem-like NeoAg-specific CD8 T cells. Single cell T cell receptor (TCR) sequencing revealed that TCR clonotype expansion and diversity of NeoAg-specific CD8 T cells relates to their phenotype and functional state associated with specific immunotherapies employed. Effective NeoAg vaccines and ICT required both CD8 and CD4 T cells. While NeoAg vaccines and anti-PD-1 affected the CD4 T cell compartment, it was to less of an extent than observed with anti-CTLA-4, which notably induced ICOS Bhlhe40 Th1-like CD4 T cells and, when combined with anti-PD-1, a small subset of Th2-like CD4 T cells. Although effective NeoAg vaccines or ICT expanded intratumoral M1-like iNOS macrophages, NeoAg vaccines expanded rather than suppressed (as observed with ICT) M2-like CX3CR1 CD206 macrophages, associated with the vaccine adjuvant. Further, combining NeoAg vaccination with ICT induced superior efficacy compared to either therapy in isolation, highlighting the utility of combining these modalities to eliminate cancer.

Immunology
Neoantigen-targeted CD8+ T cell responses with PD-1 blockade therapy

Cristina Puig-Saus,Barbara Sennino,Songming Peng,Clifford L Wang,Zheng Pan,Benjamin Yuen,Bhamini Purandare,Duo An,Boi B Quach,Diana Nguyen,Huiming Xia,Sameeha Jilani,Kevin Shao,Claire McHugh,John Greer,Phillip Peabody,Saparya Nayak,Jonathan Hoover,Sara Said,Kyle Jacoby,Olivier Dalmas,Susan P Foy,Andrew Conroy,Michael C Yi,Christine Shieh,William Lu,Katharine Heeringa,Yan Ma,Shahab Chizari,Melissa J Pilling,Marc Ting,Ramya Tunuguntla,Salemiz Sandoval,Robert Moot,Theresa Hunter,Sidi Zhao,Justin D Saco,Ivan Perez-Garcilazo,Egmidio Medina,Agustin Vega-Crespo,Ignacio Baselga-Carretero,Gabriel Abril-Rodriguez,Grace Cherry,Deborah J Wong,Jasreet Hundal,Bartosz Chmielowski,Daniel E Speiser,Michael T Bethune,Xiaoyan R Bao,Alena Gros,Obi L Griffith,Malachi Griffith,James R Heath,Alex Franzusoff,Stefanie J Mandl,Antoni Ribas

DOI: https://doi.org/10.1038/s41586-023-05787-1

IF: 64.8

Nature

Abstract:Neoantigens are peptides derived from non-synonymous mutations presented by human leukocyte antigens (HLAs), which are recognized by antitumour T cells1-14. The large HLA allele diversity and limiting clinical samples have restricted the study of the landscape of neoantigen-targeted T cell responses in patients over their treatment course. Here we applied recently developed technologies15-17 to capture neoantigen-specific T cells from blood and tumours from patients with metastatic melanoma with or without response to anti-programmed death receptor 1 (PD-1) immunotherapy. We generated personalized libraries of neoantigen-HLA capture reagents to single-cell isolate the T cells and clone their T cell receptors (neoTCRs). Multiple T cells with different neoTCR sequences (T cell clonotypes) recognized a limited number of mutations in samples from seven patients with long-lasting clinical responses. These neoTCR clonotypes were recurrently detected over time in the blood and tumour. Samples from four patients with no response to anti-PD-1 also demonstrated neoantigen-specific T cell responses in the blood and tumour to a restricted number of mutations with lower TCR polyclonality and were not recurrently detected in sequential samples. Reconstitution of the neoTCRs in donor T cells using non-viral CRISPR-Cas9 gene editing demonstrated specific recognition and cytotoxicity to patient-matched melanoma cell lines. Thus, effective anti-PD-1 immunotherapy is associated with the presence of polyclonal CD8+ T cells in the tumour and blood specific for a limited number of immunodominant mutations, which are recurrently recognized over time.
Abstract 895: Coexpression of MHC class I-restricted neoTCRs and ectopic CD8 receptors in precision genome engineered CD4 T cells significantly potentiates antigen-specific effector functions

Barbara Sennino,Andrew Conroy,Bhamini Purandare,Kyle Jacoby,Olivier Dalmas,Songming Peng,Alex Franzusoff,Stefanie Mandl

DOI: https://doi.org/10.1158/1538-7445.am2020-895

2020-08-13

Immunology

Abstract:Abstract Neoepitopes (NeoE) from tumor-exclusive mutations represent compelling targets for personalized neoE-specific autologous TCR-T cell therapies for patients with solid tumors. The imPACT Isolation Technology® is an ultra-sensitive and high-throughput process for capturing neoE-specific CD8 T cells from the blood of patients with solid cancers. Leveraging this technology, neoepitope-specific MHC class I-restricted TCRs (MHC-I neoTCRs) are cloned from individually captured CD8 T cells. Using DNA -mediated (non-viral) gene editing, fresh CD8 and CD4 T cells from the same patient with cancer are engineered to express the MHC-I neoTCR (concomitant with elimination of the endogenous TCR). While naturally occurring MHC-I TCRs are presumed to require concurrent CD8 co-receptor help to stabilize peptide-MHC binding, higher affinity TCRs drive CD8-independent target binding and T cell activation. CD4 T cells, when engineered with high affinity neoTCRs, are thus able to recognize peptide-MHC-I targets and trigger effector T cell functions. However, lower affinity TCRs are dependent on CD8 co-receptors to trigger T cell activation. By precision genome engineering CD8 co-receptor genes together with the neoTCR into CD4 T cells, MHC-I neoTCRs are now competent to trigger antigen-specific effector T cell function. In this study, MHC-I neoTCRs were cloned from neoE-specific T cells captured from the blood of a patient with colorectal cancer. Healthy donor CD8 and CD4 T cells were precision genome engineered to express the cloned MHC-I neoTCRs alone or to include engineering of ectopic CD8 co-receptors in the gene-edited T cells. Flow cytometric analysis was used to evaluate surface expression of neoTCRs and ectopic CD8 co-receptors, respectively. Rescue of neoTCR binding among CD4 T cells for lower affinity, CD8-dependent neoTCRs was observed. Importantly, in response to stimulation with cognate antigen, CD107a and intracellular IFNγ staining revealed 10-100-fold increases in the sensitivity of MHC-I neoTCR-induced effector functions by CD4 T cells, with no effect on specificity. No change in functionality or sensitivity was seen on CD8 T cells by the expression of additional CD8 co-receptor. These results demonstrate that simultaneous precision genome engineering of the CD8 co-receptor together with CD8-dependent MHC-I neoTCRs into CD4 T cells significantly increases their sensitivity to neoE-HLA target recognition as well as triggering pro-inflammatory and cytotoxic function, yet without compromising antigen-specificity. Citation Format: Barbara Sennino, Andrew Conroy, Bhamini Purandare, Kyle Jacoby, Olivier Dalmas, Songming Peng, Alex Franzusoff, Stefanie Mandl. Coexpression of MHC class I-restricted neoTCRs and ectopic CD8 receptors in precision genome engineered CD4 T cells significantly potentiates antigen-specific effector functions [abstract]. In: Proceedings of the Annual Meeting of the American Association for Cancer Research 2020; 2020 Apr 27-28 and Jun 22-24. Philadelphia (PA): AACR; Cancer Res 2020;80(16 Suppl):Abstract nr 895.

immunology
One CD4+TCR and one CD8+TCR targeting autochthonous neoantigens are essential and sufficient for tumor eradication

Steven P. Wolf,Vasiliki Anastasopoulou,Kimberley Drousch,Markus I. Diehl,Boris Engels,Poh Yin Yew,Kazuma Kiyotani,Yusuke Nakamura,Karin Schreiber,Hans Schreiber,Matthias Leisegang

DOI: https://doi.org/10.1158/1078-0432.ccr-23-2905

IF: 13.801

2024-01-09

Clinical Cancer Research

Abstract:Purpose: To achieve eradication of solid tumors, we examined how many neoantigens need to be targeted with how many TCRs by which type of T cells. Experimental Design: Unmanipulated, naturally expressed (autochthonous) neoantigens were targeted with adoptively transferred TCR-engineered autologous T cells (TCR-therapy). TCR-therapy used CD8+ T cell subsets engineered with TCRs isolated from CD8+ T cells (CD8+TCR-therapy), CD4+ T cell subsets engineered with TCRs isolated from CD4+ T cells (CD4+TCR-therapy) or combinations of both. The targeted tumors were established for at least 3 weeks and derived from primary autochthonous cancer cell cultures, resembling natural solid tumors and their heterogeneity as found in humans. Results: Relapse was common with CD8+TCR-therapy even when targeting multiple different autochthonous neoantigens on heterogeneous solid tumors. CD8+TCR-therapy was only effective against homogenous tumors artificially derived from a cancer cell clone. By contrast, a combination of CD8+TCR-therapy with CD4+TCR-therapy, each targeting one neoantigen, eradicated large and established solid tumors of natural heterogeneity. CD4+TCR-therapy targeted a mutant neoantigen on tumor stroma while direct cancer cell recognition by CD8+TCR-therapy was essential for cure. In vitro data were consistent with elimination of cancer cells requiring a four-cell cluster composed of TCR-engineered CD4+ and CD8+ T cells together with antigen-presenting cells (APCs) and cancer cells. Conclusion: Two cancer-specific TCRs can be essential and sufficient to eradicate heterogeneous solid tumors expressing unmanipulated, autochthonous targets. We demonstrate that simplifications to adoptive TCR-therapy are possible without compromising efficacy.

oncology
A pilot study of lymphodepletion intensity for PBMC-derived, neoantigen-specific CD8+ T cells (Neo-Ts) therapy in patients with advanced solid tumors.

Dandan Li,Chao Chen,Jingjing Li,Jianhui Yue,Ya Ding,Hailun Wang,Zhaoduan Liang,Le Zhang,Si Qiu,Geng Liu,Yan Gao,Ying Huang,Dongli Li,Wei Liu,Xizhi Wen,Bo Li,Xiaoshi Zhang,Xi Zhang,Rui-Hua Xu

DOI: https://doi.org/10.1200/jco.2023.41.16_suppl.2545

IF: 45.3

2023-06-01

Journal of Clinical Oncology

Abstract:2545 Background: Adoptive T cell therapy (ACT) using neoantigen-specific CD8+ T cells (Neo-Ts) derived from patient PBMC was recently developed aiming to target individual patient’s unique tumor mutations and increase treatment efficacy. But the optimal lymphodepletion intensity for Neo-T therapy has yet to be determined. Methods: In this phase I clinical trial (NCT02959905), we generated Neo-Ts from patients with locally advanced or metastatic melanoma or colon cancers that were refractory to standard therapies, and evaluated the effects of lymphodepletion at various dosages (high: 2x500 mg/m 2 cyclophosphamide and 2x25 mg/ m 2 fludarabine; low: 1x500 mg/m 2 cyclophosphamide and 2x25 mg/ m 2 fludarabine; and no lymphodepletion) during Neo-T therapy. The primary end point was safety and the secondary end point was objective response rate (ORR). Results: We showed that Neo-T therapy was safe with lymphodepletion at dosages from no lymphodepletion to high intensity. The median PFS was 7.1 months (95% CI:3.7-9.8), and median overall survival (OS) was 16.8 months (95% CI: 11.9-31.7). The ORR was 33.3% (3/9) among all groups. Three patients achieved PR, two of them were in the group without lymphodepletion. One of the PR patients refractory to prior anti-PD-1 therapy also responded to Neo-T therapy. Neoantigen specific TCRs were examined in two responding patients and showed expansion and persistence after treatment. Conclusions: Neo-T therapy with low intensity lymphodepletion or no lymphodepletion could be a safe and promising regimen for advanced solid tumors. Clinical trial information: NCT02959905 .

oncology
Neoantigen-driven B cell and CD4 T follicular helper cell collaboration promotes anti-tumor CD8 T cell responses

Can Cui,Jiawei Wang,Eric Fagerberg,Ping-Min Chen,Martina Damo,Tianyang Mao,Shuting Chen,Brittany Fitzgerald,Hongyu Zhao,Joseph Craft,Kelli A. Connolly,Julie F. Cheung,Adnan S. Askari,Gena G. Foster,Stephanie C. Eisenbarth,Nikhil S. Joshi

DOI: https://doi.org/10.1016/j.cell.2021.11.007

IF: 64.5

2021-12-01

Cell

Abstract:CD4 T follicular helper (TFH) cells support B cells, which are critical for germinal center (GC) formation, but the importance of TFH-B cell interactions in cancer is unclear. We found enrichment of TFH cell transcriptional signature correlates with GC B cell signature and with prolonged survival in individuals with lung adenocarcinoma (LUAD). We further developed a murine LUAD model in which tumor cells express B cell- and T cell-recognized neoantigens. Interactions between tumor-specific TFH and GC B cells, as well as interleukin (IL)-21 primarily produced by TFH cells, are necessary for tumor control and effector CD8 T cell function. Development of TFH cells requires B cells and B cell-recognized neoantigens. Thus, tumor neoantigens can regulate the fate of tumor-specific CD4 T cells by facilitating their interactions with tumor-specific B cells, which in turn promote anti-tumor immunity by enhancing CD8 T cell effector functions.

cell biology,biochemistry & molecular biology
Abstract 6738: Overlapping and distinct mechanisms of effective neoantigen cancer vaccines and immune checkpoint therapy

Sunita Keshari,Alexander S. Shavkunov,Qi Miao,Akata Saha,Charmelle D. Williams,Josué E. Pineda,Kenneth Hu,Kristen E. Pauken,Ken Chen,Matthew M. Gubin

DOI: https://doi.org/10.1158/1538-7445.am2024-6738

IF: 11.2

2024-03-28

Cancer Research

Abstract:The goal of cancer vaccines and immune checkpoint therapy (ICT) is to expand and sustain T cells with enhanced anti-tumor capabilities. Here, we asked whether these distinct immunotherapies utilize similar cellular and functional mechanisms. We used multiple approaches to compare effective therapeutic mutant neoantigen (NeoAg) cancer vaccines with αPD-1, αCTLA-4, or αPD-1 and αCTLA-4 ICT in preclinical BrafV600EPten−/−Cdkn2a−/− melanoma models. Synthetic long peptide (SLP) MHC-I NeoAg vaccines induced a more than 3-fold expansion of proliferating intratumoral NeoAg-specific CD8 T cells that were functional despite high expression of PD-1 and TIM-3. NeoAg vaccines required not only CD8, but also CD4 T cells for efficacy. αCTLA-4 and/or αPD-1 ICT also increased the frequency and effector capabilities of CD8 T cells but to much less of an extent than NeoAg vaccines. These included NeoAg-specific CD8 T cells that displayed reduced expression of PD-1 and TIM-3. αCTLA-4 treated tumors displayed robust induction of ICOS+ Th1-like CD4 T cells expressing Bhlhe40 that resembled Th1-like CD4 T cells described in αCTLA-4-treated patients and when αCTLA-4 was combined with αPD-1, a small subset of Th2-like CD4 T cells was observed. Remarkably, we noted divergent effects on certain subsets of intratumoral macrophage populations induced by NeoAg vaccines as compared to ICT. Although effective NeoAg vaccines expanded M1-like iNOS+ macrophages with ICT also following this same pattern, NeoAg vaccines expanded rather than suppressed (as observed with ICT) distinct subpopulations of M2-like CX3CR1+ CD206+ macrophages. CODEX spatial imaging using a 46-marker panel revealed tumors from mice treated with NeoAg vaccines displayed concentrations of CD8 T cells expressing functional markers and the proliferation marker Ki67, with mice treated with αCTLA-4 or αPD-1 displaying both Ki67+ conventional CD4 and CD8 T cells within interior regions of tumor. Interestingly, these regions contained prominent blood vessels, along with MHC-II+ dendritic cells and iNOS+ macrophages. Our work shows that NeoAg vaccines lead to distinct, as well as overlapping alterations when compared to ICT. These distinct alterations provided a rationale for combination therapies that we validated in both our melanoma model, as well as the MC38 tumor model, where delayed treatment with NeoAg vaccines combined with αCTLA-4 or αPD-1 yielded anti-tumor immunity that was superior to combination αPD-1 and αCTLA-4. These findings suggest that NeoAg vaccines combined with single-agent ICT may be an effective therapy with potentially less toxicity than αPD-1/αCTLA-4 combination ICT. Further, we hypothesize that immunotherapies that deplete CX3CR1+ CD206+ macrophages may synergize with NeoAg cancer vaccines, which we are currently assessing. Citation Format: Sunita Keshari, Alexander S. Shavkunov, Qi Miao, Akata Saha, Charmelle D. Williams, Josué E. Pineda, Kenneth Hu, Kristen E. Pauken, Ken Chen, Matthew M. Gubin. Overlapping and distinct mechanisms of effective neoantigen cancer vaccines and immune checkpoint therapy [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular s); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl) nr 6738.

oncology
The Mutant Neoantigen Specific T Cell is a Personalized Immunotherapy in Refractory Solid Tumour

Q. Song,T. Zhang,J. Li,W. Sheng,J. Wang,Q. Gan,L. Han,Q. Sun,N. Zhou,X. Zhou,Y. Zhou,L. Wu,L. Chang,Z. Zhou,Y. Song,L. Zhang,S. Jiao

DOI: https://doi.org/10.1093/annonc/mdz253.054

IF: 51.769

2019-01-01

Annals of Oncology

Abstract:Background Immune checkpoint inhibitors are an important therapy. However, their essence is nonspecific and efficiency of single usage is not satisfactory. The mutant neoantigen specific T (Nas-T) cell, as an adoptive cell treatment, is a specific immunotherapy for each individual. Our previous research has proved that the combined immunotherapy of mutant Nas-T cell and PD1 antibody is more effective than PD1 alone in prolonging PFS (World Conference on Lung Cancer 2018). We aim to evaluate the characteristics of the immune repertoire (IR) as a predictive biomarker for immunotherapy and to construct personalized and specific TCR-T. Methods 14 patients with advanced solid tumors who failed after multiline treatments were recruited. They were divided into durable clinical benefit (complete response, partial response or stable disease for more than 3 months) and non-durable clinical benefit (DCB and NCB) based on PFS. Peripheral blood was collected at baseline and each cycle. IR-seq of the CDR3 regions of human TCRβ chains was used to interrogate the TCRs frequency. We used single neoantigen to stimulate the infused T cells and performed RNAseq for the sorted CD137(+) cells to obtain the full-length TCR α and β chain. Lastly, we constructed TCR-T cells via transfecting the TCR α/β pair into the T cells of patients and co-cultured with neoantigen to analyze the functionality of TCRs. Results After neoantigen pulsing, the clonality of infused T cells pool significantly increased (P = 0.0001), suggesting some tumor-specific T-cells were expanded and enriched after neoantigen pulsing. Compared to baseline, T-cell repertoire of NCB and DCB after 1st cycle displayed significant changes: Shannon 1.19 vs 0.97 (P = 0.002); clonality 0.68 vs 1.19 (P = 0.001). Elevated clonality may indicate expanded tumor-specific T-cells which could recognize mutant neoantigen specifically. Besides, based on the in vitro TCR-T experiments, the constructed TCR-T cells can specifically recognize the mutant neoantigen and lyse the target cells expressing the corresponding neoantigen. Table . 1228P Neoantigen Sequence HLA-I typing TCR Vα TCR Vβ Gene name Sequence* All V Hits With Score# Clonal Sequence# All V Hits With Score# Clonal Sequence# MTAP/SPINK1 Fused Gene VLLPRHMKV A0201 TRAV35 (574.6) TGTGCTGGGTATGGCTCTAGCAA CACAGGCAAACTAATCTTT TRBV19 (646.8) TGTGCCAGTCGGACAGGGGGA TCACCCCTCCACTTT FER NYVSNVSKF A2301 TRAV29DV5 (667.6) TGTGCAGCTTCAACTGGGGCAAA CAACCTCTTCTTT TRBV7-2 (626.7) TGTGCCAGCACCTCTGCCCCC TCCTACGAGCAGTACTTC SPINK1 FLLSALALL B4403 TRAV20 (589.1) TGTGCTGTTCCCCTGGGAACAGG CTTTCAGAAACTTGTATTT (response to neoantigen) TRBV21-1 (557.8) TGTGCCAGCAGCAAAGACCCT AGCGGGAATCAAGAGACCCAGTACTTC CLCN6 ALIGAAASL B6701 TRAV19 (612.4) TGTGCTCTTCTGAATTATGGTGGTGC TACAAACAAGCTCATCTTT TRBV6-5 (675.4) TGTGCCAGCAGTGGGACAGCCAATGA GCAGTTCTTC (response to neoantigen) MTAP AESFMFRTW C0401 TRAV38-2DV8 (658.4) TGTGCTTATTGGGAGCTTGTCTCTGGGG CTGGGAGTTACCAACTCACTTTC TRBV5-1 (637.6) TGCGCCAGCAGCTTGACTAGCGGGGGG TTCTACGAGCAGTACTTC TAP1 RLSLFLALV C0702 TRAV16 (622.2) TGTGCTCCCTGGGCCCTAGGAGGAGG TGCTGACGGACTCACCTTT TRBV30 (403.4) TGTGCCTGGAGTGTAACAGGGGGC AAAGCAGATACGCAGTATTTT MAN2C1 FLQGRNFFL Conclusions The mutant Nas-T cell is a personalized immunotherapy. IR is a potential predictive biomarker. Legal entity responsible for the study Shunchang Jiao. Funding Has not received any funding. Disclosure All authors have declared no conflicts of interest.
Dendritic cell-targeted therapy expands CD8 T cell responses to bona-fide neoantigens in lung tumors

Lucía López,Luciano Gastón Morosi,Federica La Terza,Pierre Bourdely,Giuseppe Rospo,Roberto Amadio,Giulia Maria Piperno,Valentina Russo,Camilla Volponi,Simone Vodret,Sonal Joshi,Francesca Giannese,Dejan Lazarevic,Giovanni Germano,Patrizia Stoitzner,Alberto Bardelli,Marc Dalod,Luigia Pace,Nicoletta Caronni,Pierre Guermonprez,Federica Benvenuti

DOI: https://doi.org/10.1038/s41467-024-46685-y

IF: 16.6

2024-03-13

Nature Communications

Abstract:Abstract Cross-presentation by type 1 DCs (cDC1) is critical to induce and sustain antitumoral CD8 T cell responses to model antigens, in various tumor settings. However, the impact of cross-presenting cDC1 and the potential of DC-based therapies in tumors carrying varied levels of bona-fide neoantigens (neoAgs) remain unclear. Here we develop a hypermutated model of non-small cell lung cancer in female mice, encoding genuine MHC-I neoepitopes to study neoAgs-specific CD8 T cell responses in spontaneous settings and upon Flt3L + αCD40 (DC-therapy). We find that cDC1 are required to generate broad CD8 responses against a range of diverse neoAgs. DC-therapy promotes immunogenicity of weaker neoAgs and strongly inhibits the growth of high tumor-mutational burden (TMB) tumors. In contrast, low TMB tumors respond poorly to DC-therapy, generating mild CD8 T cell responses that are not sufficient to block progression. scRNA transcriptional analysis, immune profiling and functional assays unveil the changes induced by DC-therapy in lung tissues, which comprise accumulation of cDC1 with increased immunostimulatory properties and less exhausted effector CD8 T cells. We conclude that boosting cDC1 activity is critical to broaden the diversity of anti-tumoral CD8 T cell responses and to leverage neoAgs content for therapeutic advantage.

multidisciplinary sciences
Phenotypic signatures of circulating neoantigen-reactive CD8+ T cells in patients with metastatic cancers

Rami Yossef,Sri Krishna,Sivasish Sindiri,Frank J Lowery,Amy R Copeland,Jared J Gartner,Maria R Parkhurst,Neilesh B Parikh,Kyle J Hitscherich,Shoshana T Levi,Praveen D Chatani,Nikolaos Zacharakis,Noam Levin,Nolan R Vale,Shirley K Nah,Aaron Dinerman,Victoria K Hill,Satyajit Ray,Alakesh Bera,Lior Levy,Li Jia,Michael C Kelly,Stephanie L Goff,Paul F Robbins,Steven A Rosenberg

DOI: https://doi.org/10.1016/j.ccell.2023.11.005

IF: 50.3

2023-12-11

Cancer Cell

Abstract:Circulating T cells from peripheral blood (PBL) can provide a rich and noninvasive source for antitumor T cells. By single-cell transcriptomic profiling of 36 neoantigen-specific T cell clones from 6 metastatic cancer patients, we report the transcriptional and cell surface signatures of antitumor PBL-derived CD8+ T cells (NeoTCRPBL). Comparison of tumor-infiltrating lymphocyte (TIL)- and PBL-neoantigen-specific T cells revealed that NeoTCRPBL T cells are low in frequency and display less-dysfunctional memory phenotypes relative to their TIL counterparts. Analysis of 100 antitumor TCR clonotypes indicates that most NeoTCRPBL populations target the same neoantigens as TILs. However, NeoTCRPBL TCR repertoire is only partially shared with TIL. Prediction and testing of NeoTCRPBL signature-derived TCRs from PBL of 6 prospective patients demonstrate high enrichment of clonotypes targeting tumor mutations, a viral oncogene, and patient-derived tumor. Thus, the NeoTCRPBL signature provides an alternative source for identifying antitumor T cells from PBL of cancer patients, enabling immune monitoring and immunotherapies.
Abstract PR02: Tumor sequestered, neoantigen specific T cells are dynamically increased in circulation following neoadjuvant immunotherapy

Cem Sievers,Marco Craveiro,Jason Redman,Clint T. Allen

DOI: https://doi.org/10.1158/1557-3265.aacrahns23-pr02

IF: 13.801

2023-09-16

Clinical Cancer Research

Abstract:Improved recurrence free survival is observed following neoadjuvant immune checkpoint blockade (ICB), but the mechanisms underlying this clinical benefit are incompletely understood. To gain insights into changes in the tumor microenvironment (TME) that occur following ICB, we performed paired single-cell transcriptomic and T cell receptor (TCR) RNA sequencing on sorted tumor infiltrating T-lymphocytes before and after neoadjuvant treatment of patients with newly diagnosed oral carcinoma with bintrafusp alfa, a bifunctional PD-L1 mAb and TGF-b neutralizing construct. Analysis of pre- and post-treatment TIL with identical TCRs allowed characterization of changes within individual clonotypes after treatment. The addition of deep TCRb complimentary determining region 3 (CDR3) sequencing of peripheral T cells allowed assessment of dynamic changes in individual T cell clonotypes between the tumor and peripheral blood. Within the TME, multiple clearly defined clusters of CD8+ and CD4+ T cells with distinct transcriptional profiles were observed, including T cells expressing activation, exhaustion, and tissue-resident markers (exhausted) as well as T cells expressing progenitor and memory markers (memory). Multiple TCRs from clonotypes observed to be present in the exhausted and memory compartments were cloned for study of their antigen specificity. Putative neoepitopes were synthesized following in silico prediction of putative mutation derived neoantigens. Several TCRs from the exhausted compartment were specific for mutation-derived neoantigens. Conversely, TCRs from the memory compartment were specific for common viral antigens. With treatment, exhausted tumor-specific T cells transitioned between different exhausted clusters and some transitioned into a proliferating cluster and expanded in number. Expression of genes associated with TCR signaling and glycolysis increased in exhausted clonotypes that expanded with treatment. Expression of GLS, a key gene associated with glutaminolysis, associated with clonotypes that did not expand with treatment. Study of the peripheral blood revealed that CDR3 sequences matching exhausted, tumor specific TCRs from the TME were not detected or detected at very low frequencies prior to treatment. However, detected of CDR3 sequences matching exhausted, tumor specific TCRs from the TME significantly increased after treatment. CDR3 sequences matching memory, viral specific TCRs from the TME were detected at high levels in the peripheral blood prior to treatment, did not significantly change with treatment. Thus, neoadjuvant immunotherapy appears to expand exhausted, tumor specific T cells in the TME and results in increased frequency of these T cells in circulation. These data imply that tumor specific T cells may be largely sequestered into tissues, such as the tumor and possibly draining lymph nodes, in patients with newly diagnosed oral carcinoma and that surgical removal of disease without the use of neoadjuvant immunotherapy may remove a significant proportion of the patient's anti-tumor T cell immunity. Citation Format: Cem Sievers, Marco Craveiro, Jason Redman, Clint T. Allen. Tumor sequestered, neoantigen specific T cells are dynamically increased in circulation following neoadjuvant immunotherapy [abstract]. In: Proceedings of the AACR-AHNS Head and Neck Cancer Conference: Innovating through Basic, Clinical, and Translational Research; 2023 Jul 7-8; Montreal, QC, Canada. Philadelphia (PA): AACR; Clin Cancer Res 2023;29(18_Suppl) nr PR02.

oncology
Concurrent Delivery of Immune Checkpoint Blockade Modulates T Cell Dynamics to Enhance Neoantigen Vaccine-Generated Antitumor Immunity

Longchao Liu,Jiahui Chen,Hongyi Zhang,Jianfeng Ye,Casey Moore,Changzheng Lu,Yan Fang,Yang-Xin Fu,Bo Li

DOI: https://doi.org/10.1038/s43018-022-00352-7

IF: 22.7

2022-01-01

Nature Cancer

Abstract:Neoantigen vaccines aiming to induce tumor-specific T cell responses have achieved promising antitumor effects in early clinical trials. However, the underlying mechanism regarding response or resistance to this treatment is unclear. Here we observe that neoantigen vaccine-generated T cells can synergize with the immune checkpoint blockade for effective tumor control. Specifically, we performed single-cell sequencing on over 100,000 T cells and uncovered that combined therapy induces an antigen-specific CD8 T cell population with active chemokine signaling (Cxcr3+/Ccl5+), lower co-inhibitory receptor expression (Lag3−/Havcr2−) and higher cytotoxicity (Fasl+/Gzma+). Furthermore, generation of neoantigen-specific T cells in the draining lymph node is required for combination treatment. Signature genes of this unique population are associated with T cell clonal frequency and better survival in humans. Our study profiles the dynamics of tumor-infiltrating T cells during neoantigen vaccine and immune checkpoint blockade treatments and high-dimensionally identifies neoantigen-reactive T cell signatures for future development of therapeutic strategies. Li and colleagues use single-cell techniques to identify features of T cells in the tumor and draining lymph nodes involved in the efficacy of immune checkpoint blockade combined with a neoantigen vaccine in preclinical models.
DCs targeted therapy expands CD8 T cell responses to bona-fide neoantigens in lung tumors

Lucía López-Rodríguez,Luciano Morosi,Federica La Terza,Pierre Bourdely,Giuseppe Rospo,Roberto Amadio,Giulia Maria Piperno,Valentina Russo,Camilla Volponi,Simone Vodret,Sonal Joshi,Francesca Giannese,Dejan Lazarevi,Giovanni Germano,Patrizia Stoitzner,Alberto Bardelli,Marc Dalod,Luigia Pace,Nicoletta Caronni,Pierre Guermonprez,Federica Benvenuti

DOI: https://doi.org/10.1101/2024.01.26.576259

2024-01-30

Abstract:Cross-presentation by type 1 cDCs (cDC1) is critical to induce and sustain antitumoral CD8 T cell responses to model antigens, in various tumor settings. However, the impact of cross-presenting cDC1 and the potential of DC-based therapies in tumors carrying varied levels of neoantigens (neoAgs) remains unclear. Here we generated a non-small cell lung cancer model with distinct ranges of TMB and MHC-I neoepitopes to test immunogenicity and response to Flt3L+αCD40 (DC-therapy). We found that cDC1 are required to broaden the pattern of CD8 responses to basal and acquired neoAgs and DC-therapy strongly inhibits the growth of TMB tumors. In contrast, TMB tumors induce weaker responses that are not sufficient to block progression. scRNA transcriptional analysis, immune profiling and functional assays show that DC-therapy triggers the accumulation of lung cDC1 with increased immunostimulatory properties and CD8 T cells with enhanced cytotoxic functions and reduced exhaustion, most prominently in neoAgs tumors. We conclude that boosting cDC1 activity is critical to broaden the diversity of anti-tumoral CD8 T cell responses and to leverage neoAgs content for therapeutic advantage.

Immunology

Distribution of elastic fibres in the developing rabbit craniomandibular joint.

Neoantigen-specific CD4+ tumor-infiltrating lymphocytes are potent effectors identified within adoptive cell therapy products for metastatic melanoma patients

Identifying and engineering TCR specificity against solid tumor neoantigens

Abstract LB073: Adoptive transfer of one CD4TCR and one CD8TCR targeting autochthonous neoantigens are essential and sufficient for eradication of naturally heterogeneous solid tumors

Neoantigen-specific cytotoxic Tr1 CD4 T cells suppress cancer immunotherapy

Abstract A030: CD4 neoantigen mRNA vaccine enhances endogenous CD8 responses and tumor control

Neoantigen-specific stimulation of tumor-infiltrating lymphocytes enables effective TCR isolation and expansion while preserving stem-like memory phenotypes

CD4 + T cells with convergent TCR recombination reprogram stroma and halt tumor progression in adoptive therapy

Neoantigen Cancer Vaccines and Different Immune Checkpoint Therapies Each Utilize Both Converging and Distinct Mechanisms that in Combination Enable Synergistic Therapeutic Efficacy

Neoantigen-targeted CD8+ T cell responses with PD-1 blockade therapy

Abstract 895: Coexpression of MHC class I-restricted neoTCRs and ectopic CD8 receptors in precision genome engineered CD4 T cells significantly potentiates antigen-specific effector functions

One CD4+TCR and one CD8+TCR targeting autochthonous neoantigens are essential and sufficient for tumor eradication

A pilot study of lymphodepletion intensity for PBMC-derived, neoantigen-specific CD8+ T cells (Neo-Ts) therapy in patients with advanced solid tumors.

Neoantigen-driven B cell and CD4 T follicular helper cell collaboration promotes anti-tumor CD8 T cell responses

Abstract 6738: Overlapping and distinct mechanisms of effective neoantigen cancer vaccines and immune checkpoint therapy

The Mutant Neoantigen Specific T Cell is a Personalized Immunotherapy in Refractory Solid Tumour

Dendritic cell-targeted therapy expands CD8 T cell responses to bona-fide neoantigens in lung tumors

Phenotypic signatures of circulating neoantigen-reactive CD8+ T cells in patients with metastatic cancers

Abstract PR02: Tumor sequestered, neoantigen specific T cells are dynamically increased in circulation following neoadjuvant immunotherapy

Concurrent Delivery of Immune Checkpoint Blockade Modulates T Cell Dynamics to Enhance Neoantigen Vaccine-Generated Antitumor Immunity

DCs targeted therapy expands CD8 T cell responses to bona-fide neoantigens in lung tumors