SSDP1 gene encodes a protein with a conserved N-terminal FORWARD domain.

D. Bayarsaihan

DOI: https://doi.org/10.1016/S1570-9639(02)00376-X

2002-09-23

Biochimica et Biophysica Acta

Abstract:

What problem does this paper attempt to address?

First report of tomato spotted wilt virus (TSWV) isolated from nasturtium (Tropaeolum majus L.) with a serious leaf mosaic disease in China

Meichun Yu,Caixia Yang,Junzhu Wang,Qiushi Hou,Song Zhang,Mengji Cao

DOI: https://doi.org/10.1094/PDIS-03-20-0688-PDN

2020-09-28

Abstract:Tomato spotted wilt virus (TSWV, Genus Orthotospovirus, Family Tospoviridae) is a thrips-transmitted negative-stranded RNA virus with a large host range. Major economic losses caused by TSWV have been recorded in various crops such as tomato, pepper and lettuce (Pappu et al., 2009; Adams et al., 2017). Nasturtium (Tropaeolum majus L.), a common flowering plant species native to Peru, is generally cultivated as a garden and greenhouse ornamental plant in China. It is also known for its medical, edible and cosmetic values (Jakubczyk et al., 2018). In June 2019, a serious leaf mosaic disease (Figure S1) was observed in ~77% of T. majus plants in Beiling Park in Shenyang City, Liaoning, China. To reveal the possible viral agent associated with the disease, leaf tissue was collected from 9 symptomatic and 2 asymptomatic plants, followed by total RNA extraction from each of the samples using RNASimple Total RNA Kit (Tiangen, Beijing, China). The RNA from one representative symptomatic sample (Figure S1, d) was used to construct an rRNA-depleted library using the Ribo-Zero™ rRNA Removal Kit (Plant Leaf) (Illumina, CA, USA). The library was subjected to RNA-Seq using a BGISEQ platform (Shenzhen Huada Gene Science and Technology Service Co., Ltd., Shenzhen, China). A total of 109,279,540 quality-filtered reads were obtained using the CLC Genomics Workbench 9.5 software (Qiagen, Valencia, CA, USA). Clean reads were assembled into 88,091 contigs ranging in length from 200 to 19,695 bp using Velvet (Zerbino and Birney 2008). Among the contigs, three sized at 8801, 4617 and 2909 bp were found to share a sequence identity of 98.74-99.35% with the RNA segments (L, M and S) of TSWV. No sequences of other viruses, viroids included, were detected. Ten primer pairs were designed based on the TSWV contigs to obtain the full genome sequence of the virus (Table S1). Five, three, and two amplicons were obtained for the TSWV RNA segments L, M and S, respectively, from the same RNA sample used in the RNA-Seq process. These amplicons were then cloned into the pMD18T vector (TaKaRa, Dalian, China) and Sanger sequenced. The resulting sequences were assembled and analyzed using the DNAMAN version 8.0 (LynnonBiosoft, Quebec, Canada) and DNAStar version 6.0 software (DNAStar Inc, Madison, WI, USA) (Table S1). The RNA segments were determined to be 8,914 nt (L, accession no. MT241883), 4,791 nt (M, MT241884) and 2,922 nt (S, MT241885) in length. They shared a sequence identity of >99% with the "LL-N.05" (segment L, KP008128) and "SPAIN-1" (segment S, AY744479) isolates from tomatoes in Spain and the "Beijing" isolate (segment M, MH717046) from chrysanthemum in China. These results, together with phylogenetic analysis, suggest that the isolate (designated as isolate LN-HJL) was likely resulted from genome reassortment between other isolates. No reliable recombination events were detected in the RNA segments of LN-HJL by the RDP4 program (Martin et al., 2015). RT-PCR assay with primer pair S-1F/1R on all samples led to positive detection of TSWV only in the symptomatic samples (Figure S1, g), indicating that the virus was likely responsible for the disease symptoms observed in T. majus. To the best of our knowledge, this is the first report of the TSWV infection in T. majus in China, and the second in the world since the first report in the USA (Ie, 1964). TSWV-infected T. majus plants not only lose their aesthetic and economic values (Figure S1, f), but also may act as reservoirs for the spread of TSWV to other important crops. T. majus should therefore be monitored regularly for the virus and managed accordingly in China.
First Report of Tomato Spotted Wilt Virus in Argyranthemum Frutescens in China

Liang Yan,Yuan Chen-Qing,Li

DOI: https://doi.org/10.1007/s42161-019-00463-8

IF: 2.2

2020-01-01

Journal of Plant Pathology

Abstract:Argyranthemum frutescens, a member of Asteraceae family, is a popular ornamental plant grown in public parks.In December 2018, 5% to 10% of plants, grown in a glasshouse in Shunyi District, Beijing, China, showed virus-like symptoms, such as yellowing, mottling and internode shortening.Leaves collected from six symptomatic plants were tested for several common viruses that infect ornamental plants including cucumber mosaic virus (CMV), tobacco mosaic virus (TMV), tomato spotted wilt virus (TSWV), and Impatiens necrotic spot virus (INSV) by DAS-ELISA (Agdia).Among the naturally infected A. frutescens plants, only TSWV was detected while CMV, TMV and INSV were not.To further confirm the TSWV infection, RT-PCR was performed using the following specific primers (Yin et al. 2013; TSWV-L-F: 5′-ACTGCCAT AGGACTTTTGACC-3′, TSWV-L-R: 5'-ACGGCTCT ATAGGAGAGGTC-3′; TSWV-M-F: 5'-AGGGCTAG TGATGCTTACAG-3′, TSWV-M-R: 5'-TCACAATT GCCCTGAGTTC-3′) designed to amplify portions of TSWV genome segments.As a result, 680 bp, 863 bp and 650 bp products of the TSWV L RNA, M RNA and S RNA genome segments, respectively, were detected from all diseased samples, which were then cloned and sequenced.BLASTn analyses revealed that the partial RdRp gene sequence (MK936047) of TSWV-L RNA had the highest nucleotide similarly of 94-99% with isolates from different hosts in Beijing (MK433644), Spain (KP008130), Italy (KJ575619; MH763621).The TSWV-M fragment sequences (MK936048) obtained from GenBank database showed a 96%-99% similarity with isolates from different hosts in South Korea (KC261948; KC261963) and Spain (KP008133; AY744493).The TSWV-S fragment (MK693040) was 97%-99% identical to that of tomato and
The genetics of ACTH resistance syndromes.

L. Metherell,L. Chan,A. Clark

DOI: https://doi.org/10.1016/J.BEEM.2006.09.002

2006-12-01

Abstract:
First Report of Pepper Veinal Mottle Virus Infecting Pepper in Mainland China

S. B. Zhang,Zijin Zhao,Limin Zheng,D. Y. Zhang,Ye Liu,Jun Liu,Jianxiu Du,Jing Peng,Fei Yan,F. Li,Yan Xie,Zhiyuan Cheng

DOI: https://doi.org/10.1094/pdis-08-15-0870-pdn

IF: 4.5

2016-01-01

Plant Disease

Abstract:HomePlant DiseaseVol. 100, No. 5First Report of Pepper veinal mottle virus Infecting Pepper in Mainland China PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Pepper veinal mottle virus Infecting Pepper in Mainland ChinaS. B. Zhang, Z. B. Zhao, L. M. Zheng, D. Y. Zhang, Y. Liu, J. Liu, J. Du, J. Peng, F. Yan, F. Li, Y. Xie, and Z. B. ChengS. B. ZhangSearch for more papers by this author, Z. B. ZhaoSearch for more papers by this author, L. M. ZhengSearch for more papers by this author, D. Y. ZhangSearch for more papers by this author, Y. LiuSearch for more papers by this author, J. LiuSearch for more papers by this author, J. DuSearch for more papers by this author, J. PengSearch for more papers by this author, F. YanSearch for more papers by this author, F. LiSearch for more papers by this author, Y. XieSearch for more papers by this author, and Z. B. ChengSearch for more papers by this authorAffiliationsAuthors and Affiliations S. B. Zhang Z. B. Zhao L. M. Zheng D. Y. Zhang Y. Liu J. Liu J. Du J. Peng , Key Laboratory of Pest Management of Horticultural Crop of Hunan Province, Hunan Plant Protection Institute, Hunan Academy of Agricultural Science, Changsha 410125, China F. Yan , Virology and Biotechnology Institute, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, China F. Li , Key Laboratory of Agricultural Biodiversity for Pest Management of China Education Ministry, Yunnan Agricultural University, Kunming 650201, China Y. Xie , Institute of Biotechnology, Zhejiang University, Hangzhou 310058, China Z. B. Cheng , Institute of Plant Protection, Jiangsu Academy of Agricultural Sciences, Nanjing 201014, China. Published Online:29 Feb 2016https://doi.org/10.1094/PDIS-08-15-0870-PDNAboutSections ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Pepper veinal mottle virus (PVMV), a virus species in the genus Potyvirus in the family Potyviridae, has been reported to infect several crops of Solanaceae in several countries and regions of Africa (Huguenot et al. 1996) and East Asia (Taiwan and South Korea) (Ceng et al. 2009; Ha et al. 2008). During a survey of pepper diseases in June 2013, about 15% of red pepper (Capsicum annuum) plants with viral-like symptoms of stunting, veinal chlorosis, and leaf curl and mottle were observed in Changsha, Hunan Province, China. Three diseased plants were collected and tested by high throughput small RNA sequencing (Ho et al. 2014) for pathogen identification. Total RNA was extracted using Trizol reagent (Sangon Biotech, Shanghai, China) from pooled leaf samples of the three plants. Small RNA libraries were constructed using the “Small RNA v1.5 Sample Prep” kit (Illumina, San Diego, CA) and sequenced by high throughput sequencing using a Solexa sequencer (Illumina). Raw data of approximate 8 million reads were analyzed using the Illumina GA Pipeline v1.3. High quality small RNA reads (18 to 30 nt) were assembled to contigs using the software Velvet 1.0.5. A BLASTn search of the resultant contigs to the viral genomes of the GenBank database identified about 300 contigs with high nucleotide sequence homologies (>96%) to seven viruses, among which PVMV was matched by 16 contigs with high identities (>98%). To confirm the presence of PVMV, the samples were tested by reverse transcription (RT)-PCR using a primer pair PMF (5′-AATTAAGCCATTGATTGACCA-3′) and PMR (5′-AGCGCCAATTATGAAACCGC-3′), and a ∼744-bp fragment of partial coat protein gene of PVMV was amplified from three symptomatic samples, but not from a healthy pepper sample. The DNA fragment from a selected sample was sequenced and deposited under GenBank Accession No. KT285204. This fragment shared 99% nucleotide identity with a PVMV isolate from South Korea (DQ645484). Northern blot using a digoxigenin-labeled PCR fragment amplified by primers PMF and PMR also confirmed the presence of PVMV from an infected plant. To our best knowledge, this is the first report of PVMV naturally infecting pepper in mainland China.References:Ceng, Y. H., et al. 2009. Plant Dis. 93:107. Google ScholarHa, J. H., et al. 2008. Arch. Virol. 153:2315. https://doi.org/10.1007/s00705-008-0245-0 Crossref, ISI, Google ScholarHo, T., et al. 2014. Virology 471-473:54. https://doi.org/10.1016/j.virol.2014.09.019 Crossref, ISI, Google ScholarHuguenot, C., et al. 1996. J. Phytopathol. 144:29. https://doi.org/10.1111/j.1439-0434.1996.tb01484.x Crossref, ISI, Google ScholarDetailsFiguresLiterature CitedRelated Vol. 100, No. 5 May 2016SubscribeISSN:0191-2917e-ISSN:1943-7692 Metrics Article History Issue Date: 15 Apr 2016Published: 29 Feb 2016First Look: 5 Nov 2015Accepted: 19 Oct 2015 Pages: 1025-1025 Information© 2016 The American Phytopathological SocietyCited byPepper veinal mottle virusCABI Compendium, Vol. CABI CompendiumIdentification of a novel pepper-infecting monopartite begomovirus in China20 March 2021 | Archives of Virology, Vol. 166, No. 6Capsicum annuum and Capsicum frutescens (Bell pepper, Chilli, Pepper, Sweet pepper)6 June 2020
First report of Impatiens necrotic spot orthotospovirus infecting Tulbaghia violacia Harv. in China

Jingyu Hu,Lei Zhang,Zhizhong Yang,HuaLi Qian,Zhe Xu,JunJie Hao,PengZhang Ji,Jia Hong Dong

DOI: https://doi.org/10.1094/PDIS-06-22-1325-PDN

2022-08-10

Abstract:Tulbaghia violacea Harv. indigenous to southern African countries, is an herbaceous perennial bulbous plant belonging to the family Amaryllidaceae. It is a popular garden plant in China. This attractive plant is traditionally used as medicine and repellent (Kubec et al. 2002; Moodley et al. 2015). In June 2021, T. violacea plants showing typical tospovirus-like symptoms of chlorotic rings patterns, were found at the campus of Yunnan University of Chinese Medicine (Fig.S1). Disease incidence was about 11.0% during the field survey. Total RNA was extracted from symptomatic leaves of T. violacea plants using the TRIzol reagent (ambio, Carlsbad, CA). Reverse transcription (RT)-PCR was conducted to identify the virus using RNA extract as the template. The degenerate primers (dTospo-F2 and dTospo-R2) (Huang et al. 2018) were used to amplify the conserved regions of the orthotospoviral L RNA sequences. No amplification was obtained from extracts of two asymptomatic plants. The amplicons from four symptomatic samples were cloned into the pMD19-T vector (TaKaRa) and sequenced (three clones for each amplicon) by Tsingke (Shanghai, China). The obtained DNA fragments were determined to be 312 bp. The sequences from four symptomatic samples were identical (GenBank acc.no. OK258285) and shared the highest nucleotide identities (98.0%) with a corresponding sequence of segment L of impatiens necrotic spot virus (INSV) isolated (GQ336991) from Phalaenopsis amabilis in Yunnan province, China. To further confirm the INSV infection to T. violacea, the samples were analyzed with the specific primers for the N, NSs and NSm genes of INSV (Table S1), respectively. Amplicons of the expected size, 789 bp, 1344 bp and 912 bp, were produced, respectively. Amplicons were cloned and sequenced. The 789-bp N (ON529554) and 1344-bp NSs (ON529554) gene sequences had 99.1% and 99.3% nucleotide identities with the corresponding region of previously described INSV Phalenopsis isolate (GQ336989), respectively. The 912-bp NSm (ON529553) gene sequence shared 99.5% nucleotide identity with the corresponding region of INSV Phalenopsis isolate (GQ336990). Metavirome and Sanger sequencing were used to complete the genome of INSV from T. violacea. The leaves of the symptomatic sample were used to construct an rRNA-depleted library using Nextera XT reagents (Illumina, San Diego, CA). The library was subjected to RNA-Seq a NovaSeq 6000 platform (Illumina, San Diego, CA). A total of 33,193,233 quality-filtered reads were obtained using BBMAP (https://github.com/BioInfoTools/BBMapBBMap - Bushnell B. - sourceforge.net/projects/bbmap/). Among 161052 reads mapped to virus sequences, 151407 reads (read ratios 94.0%) were mapped to INSV. Three complete segments of INSV genome were determined to 8,778 nt (L segment, Acc. No. ON529552), 4,958 nt (M segment, Acc. No. ON529553), and 2,983 nt (S segment, Acc. No. ON529554) in length. These segments were validated by RT-PCR and Sanger sequencing. Three segments share nucleotide sequence identities of 99.6%, 99.3% and 98.9% with the L (GQ336991), M (GQ336990) and S segments (GQ336989) of INSV Phalenopsis isolate, respectively. The results of sequence comparisons showed no evidence of reassortment between INSV and another orthotospovirus. There was a report of tomato spotted wilt virus infecting T. violacea in Florida, USA (Dey et al. 2019). No other virus infecting T. violacea was reported. INSV has been reported to infect several economically important crops including Phalenopsis, pepper etc. in China (Chen et al. 2016). INSV-infected T. violacea not only losses landscaping value but also plays an important intermedia host role in the spread of INSV. Additional surveys and evaluation will be needed to understand the potential medicinal effect of this virus on this plant. To our knowledge, this is first report of INSV in T. violacea.
First report of Tomato spotted wilt orthotospovirus infecting agapanthus (Agapanthus praecox) in South Africa

Rachelle Bester,Shadelene Unisha Demas,Hans Jacob Maree

DOI: https://doi.org/10.1094/PDIS-12-22-2765-PDN

2023-02-01

Abstract:Agapanthus praecox Willd. is an ornamental flowering plant that is indigenous to southern Africa and was reported to be a host of tomato spotted wilt orthotospovirus (TSWV) in Australia in 2000 (Wilson et al. 2000). Tomato spotted wilt orthotospovirus (TSWV) belonging to the genus Orthotospovirus of the family Tospoviridae is a single-stranded negative sense RNA virus known to cause disease symptoms in many crops and ornamental plant species. This virus is in the top 10 of most economically important plant viruses worldwide (Rybicki 2015; Scholthof et al. 2011). In May 2021, leaf material from three agapanthus (Agapanthus praecox) plants displaying chlorotic mottling, and yellow lesions (Supplementary material 1A) was collected in Mbombela, South Africa. One gram of symptomatic leaf material was used for total RNA extraction from each of the three samples using a CTAB extraction protocol (Ruiz-García et al. 2019). The three RNA extracts were pooled, and a sequencing library was constructed using the Ion Total RNA-Seq Kit v2.0 and RiboMinus™ Plant Kit for RNA-Seq (ThermoFisher Scientific) (Central Analytical Facility (CAF), Stellenbosch University). The RNA library was sequenced on an Ion Torrent Proton Instrument (CAF). A total of 34,392,939 single-end reads were obtained. Data was trimmed for quality with Trimmomatic (CROP:250, MINLEN:50). De novo assembly was performed on the remaining 32,281,645 trimmed reads (average readlength: 100 nt, range: 50-250 nt) using SPAdes 3.13.0 and resulted in 4,788 contigs. BLASTn analysis identified viral contigs longer than 1,000 nucleotides (nts) with high nucleotide (nt) identity to TSWV (6 contigs), as well as to the newly discovered viruses, agapanthus tungro virus (AgTV) (1 contig), and agapanthus velarivirus (AgVV) (4 contigs) (Read et al 2021). Read mapping was performed against the relevant reference sequence with the highest nt identity to the contigs. For TSWV, 4995, 21221 and 14574 reads mapped to segment L (KY250488), M (KY250489) and S (KY250490) of isolate LK-1, respectively resulting in 99.97%, 100.00% and 99.97% genome coverage of the reference accessions. The nt identity between the reference accessions and the consensus sequences generated (OP921761-OP921763) were 97.26%, 97.64% and 97.82% for segment L, M and S. The presence of TSWV was confirmed in the HTS sample using an RT-PCR assay (primers L1 and L2) targeting the L segment of TSWV (Mumford et al. 1994). In July 2022, additional leaf samples displaying symptoms of chlorotic mottling, streaking, and ringspots were collected from 31 symptomatic and 3 asymptomatic agapanthus plants in public gardens in Stellenbosch, South Africa. Using the above-mentioned RT-PCR assay, 13 of the symptomatic samples tested positive for TSWV. All six plants displaying ring spot symptoms (Supplementary material 1B) were infected with TSWV. However, plants that displayed yellow streaking (five samples) and chlorotic mottling (two samples) (Supplementary material 1C-D) were also positive for TSWV which could be due to the presence of other viruses, plant growth stage, infection time or just variable symptom expression in a single host species as reported previously (Sherwood et al. 2003). The 275 bp RT-PCR amplicons of the HTS sample and three additional positive samples were validated with bidirectional Sanger sequencing (CAF) and had 96% identity to accession KY250488. The pairwise nt identity between amplicons was 98.55-100%. This is the first report of TSWV infecting agapanthus in South Africa. This study contributes information towards the distribution and incidence of TSWV and highlights the need for nurseries to screen plant material before propagation.
First Report of Chilli veinal mottle virus Infecting Tomato (Solanum lycopersicum) in China

F-F Zhao,D-H Xi,J Liu,X-G Deng,H-H Lin

DOI: https://doi.org/10.1094/PDIS-11-13-1188-PDN

Abstract:Chilli veinal mottle virus (ChiVMV), a potyvirus, is widespread over the world. In China, it was first reported in chili pepper (Capsicum annuum) in Hainan Province (south China) in 2006 (2). Subsequently, it was reported in tobacco (Nicotiana tabacum) in Yunnan Province (southwest China) in 2011 (1). Sichuan Province is one of the largest vegetable producing areas of China. In May 2012, tomatoes with leaves displaying virus-infected symptoms like mottling, mosaic, narrowing, or curling were observed in several fields of Chengdu, eastern Sichuan Province, southwest China. Of the 20 fields we investigated, four fields with 90% tomato plants were infected. During 2012 and 2013, six samples were collected from symptomatic tomato leaves based on different symptoms and locations. All six samples were assayed by western blotting using polyclonal antisera (Cucumber mosaic virus [CMV], Tobacco mosaic virus [TMV]) obtained from Agdia (Elkhart) and one antiserum to ChiVMV obtained from Yunnan Academy of Agricultural Science (China). Two samples from Pengzhou and one sample from Shuangliu exhibiting mosaic leaves were positive for TMV, one sample from Pixian exhibiting narrowing leaves was positive for CMV, and the other two samples from Shuangliu exhibiting mottle and leaf distortion were positive for ChiVMV. Total RNAs was extracted from all six samples and healthy tomato leaves using Trizol reagent (Invitrogen), First-strand cDNA synthesis primed with oligo(dT) by SuperScript III Reverse Transcriptase (Invitrogen). RT-PCR was performed using primer pairs ChiVMV-CP F (5'-GCAGGAGAGAGTGTTGATGCTG-3') and ChiVMV-CP R (5'-(T)16AACGCCAACTATTG-3'), which were designed to direct the amplification of the entire capsid protein (CP) gene and 3' untranslated region (3'-UTR) of ChiVMV (GenBank Accession No. KC711055). The expected 1,166-bp DNA fragment was amplified from the two tomato samples from Shuangliu that were positive for ChiVMV in the western blot tests, but not from the others. The obtained fragments were purified and cloned into the PMD18-T vector (TaKaRa) and sequenced. The sequencing results showed that the two ChiVMV isolates from tomato in Shuangliu were identical (KF738253). Nucleotide BLAST analysis revealed that this ChiVMV isolate shared ~84 to 99% nucleotide identities with other ChiVMV isolates available in GenBank (KC711055 to KF220408). To fulfill Koch's postulates, we isolated this virus by three cycle single lesion isolation in N. tabacum, and mechanically inoculated it onto tomato leaves. The same mottle and leaf distortion symptoms in systemic leaves were observed. Subsequent RT-PCR, fragment clone, and sequence determination tests were repeated and the results were the same. All the evidence from these tests revealed that the two tomato plants were infected by ChiVMV. To our knowledge, this is the first report of ChiVMV naturally infecting tomato in China. It shows that ChiVMV is spreading in China and is naturally infecting a new solanaceous crop in the southwest area, and the spread of the virus may affect tomato crop yields in China. Thus, it is very important to seek an effective way to control this virus. References: (1) M. Ding et al. Plant Dis. 95:357, 2011. (2) J. Wang et al. Plant Dis. 90:377, 2006.
First Report of Impatiens Necrotic Spot Orthotospovirus Infecting Tulbaghia Violacea in China

Jingyu Hu,Lei Zhang,Zhizhong Yang,Huali Qian,Zhe Xu,Junjie Hao,Pengzhang Ji,JiaHong Dong

DOI: https://doi.org/10.1094/pdis-06-22-1325-pdn

IF: 4.5

2023-01-01

Plant Disease

Abstract:HomePlant DiseaseVol. 107, No. 3First Report of Impatiens Necrotic Spot Orthotospovirus Infecting Tulbaghia violacea in China PreviousNext DISEASE NOTE OPENOpen Access licenseFirst Report of Impatiens Necrotic Spot Orthotospovirus Infecting Tulbaghia violacea in ChinaJingyu Hu, Lei Zhang, Zhizhong Yang, Huali Qian, Zhe Xu, Junjie Hao, Pengzhang Ji, and JiaHong DongJingyu HuSchool of Chinese Materia Medica and Yunnan Key Laboratory of Southern Medicinal Resource, Yunnan University of Chinese Medicine, Yunnan 650500, ChinaInstitute of Medicinal Plant Cultivation, Academy of Southern Medicine, Yunnan University of Chinese Medicine, Yunnan 650500, ChinaSearch for more papers by this author, Lei ZhangSchool of Chinese Materia Medica and Yunnan Key Laboratory of Southern Medicinal Resource, Yunnan University of Chinese Medicine, Yunnan 650500, ChinaInstitute of Medicinal Plant Cultivation, Academy of Southern Medicine, Yunnan University of Chinese Medicine, Yunnan 650500, ChinaSearch for more papers by this author, Zhizhong YangSchool of Chinese Materia Medica and Yunnan Key Laboratory of Southern Medicinal Resource, Yunnan University of Chinese Medicine, Yunnan 650500, ChinaSearch for more papers by this author, Huali QianSchool of Chinese Materia Medica and Yunnan Key Laboratory of Southern Medicinal Resource, Yunnan University of Chinese Medicine, Yunnan 650500, ChinaInstitute of Medicinal Plant Cultivation, Academy of Southern Medicine, Yunnan University of Chinese Medicine, Yunnan 650500, ChinaSearch for more papers by this author, Zhe XuSchool of Chinese Materia Medica and Yunnan Key Laboratory of Southern Medicinal Resource, Yunnan University of Chinese Medicine, Yunnan 650500, ChinaInstitute of Medicinal Plant Cultivation, Academy of Southern Medicine, Yunnan University of Chinese Medicine, Yunnan 650500, ChinaSearch for more papers by this author, Junjie HaoSchool of Chinese Materia Medica and Yunnan Key Laboratory of Southern Medicinal Resource, Yunnan University of Chinese Medicine, Yunnan 650500, ChinaSearch for more papers by this author, Pengzhang JiSchool of Chinese Materia Medica and Yunnan Key Laboratory of Southern Medicinal Resource, Yunnan University of Chinese Medicine, Yunnan 650500, ChinaInstitute of Medicinal Plant Cultivation, Academy of Southern Medicine, Yunnan University of Chinese Medicine, Yunnan 650500, ChinaSearch for more papers by this author, and JiaHong Dong†Corresponding author: J. Dong; E-mail Address: [email protected]https://orcid.org/0000-0002-8067-4691School of Chinese Materia Medica and Yunnan Key Laboratory of Southern Medicinal Resource, Yunnan University of Chinese Medicine, Yunnan 650500, ChinaInstitute of Medicinal Plant Cultivation, Academy of Southern Medicine, Yunnan University of Chinese Medicine, Yunnan 650500, ChinaSearch for more papers by this authorAffiliationsAuthors and Affiliations Jingyu Hu1 2 Lei Zhang1 2 Zhizhong Yang1 Huali Qian1 2 Zhe Xu1 2 Junjie Hao1 Pengzhang Ji1 2 JiaHong Dong1 2 † 1School of Chinese Materia Medica and Yunnan Key Laboratory of Southern Medicinal Resource, Yunnan University of Chinese Medicine, Yunnan 650500, China 2Institute of Medicinal Plant Cultivation, Academy of Southern Medicine, Yunnan University of Chinese Medicine, Yunnan 650500, China Published Online:21 Feb 2023https://doi.org/10.1094/PDIS-06-22-1325-PDNAboutSectionsView articlePDFSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat View articleTulbaghia violacea Harv., indigenous to southern Africa, is an herbaceous perennial bulbous plant in the family Amaryllidaceae and a popular garden plant in China. This attractive plant is traditionally used as a medicine and repellent (Kubec et al. 2002; Moodley et al. 2015). In June 2021, T. violacea plants showing typical tospovirus-like symptoms of chlorotic and necrotic ringspot patterns were found at the campus of Yunnan University of Chinese Medicine. Disease incidence was about 11.0% in a field survey. Total RNA was extracted from symptomatic leaves of T. violacea plants using the TRIzol reagent (ambio, Carlsbad, CA). Reverse transcription (RT)-PCR was conducted to identify the virus using RNA extract as the template. The degenerate primers (dTospo-F2 and dTospo-R2) (Huang et al. 2018) were used to amplify the conserved regions of the orthotospoviral L RNA sequences. No amplification was obtained from extracts of two asymptomatic plants. The amplicons from four symptomatic samples were cloned into the pMD19-T vector (TaKaRa) and sequenced (three clones for each amplicon) by Tsingke (Shanghai, China). The obtained DNA fragments were 312 bp. The sequences from four symptomatic samples were identical (GenBank acc. no. OK258285) and shared the highest nucleotide identity (98.0%) with a corresponding sequence of segment L of Impatiens necrotic spot virus (INSV) (GQ336991) isolated from Phalaenopsis amabilis in Yunnan province, China. To further confirm the INSV infection on T. violacea, the samples were analyzed with the specific primers for the N, NSs, and NSm genes of INSV, and amplicons of the expected sizes, 789, 1,344, and 912 bp, respectively, were produced. Amplicons were cloned and sequenced. The 789-bp N (ON529554) and 1,344-bp NSs (ON529554) gene sequences had 99.1 and 99.3% nucleotide identities with the corresponding region of the previously described INSV Phalaenopsis isolate (GQ336989), respectively. The 912-bp NSm (ON529553) gene sequence shared 99.5% nucleotide identity with the corresponding region of the INSV Phalaenopsis isolate (GQ336990). Metavirome and Sanger sequencing were used to complete the genome of INSV from T. violacea. The leaves of the symptomatic sample were used to construct an rRNA-depleted library using Nextera XT reagents (Illumina, San Diego, CA). The library was subjected to a NovaSeq 6000 platform (Illumina) for RNA-Seq. A total of 33,193,233 quality-filtered reads were obtained using BBMAP (https://github.com/BioInfoTools/BBMap/blob/master/sh/bbmap.sh). Among 161,052 reads mapped to virus sequences, 151,407 reads (read ratios 94.0%) were mapped to INSV. Three complete segments of INSV genome were determined to be 8,778 nt (L segment, acc. no. ON529552), 4,958 nt (M segment, acc. no. ON529553), and 2,983 nt (S segment, acc. no. ON529554) in length. These segments were validated by RT-PCR and Sanger sequencing. The segments shared nucleotide sequence identities of 99.6, 99.3, and 98.9% with the L (GQ336991), M (GQ336990), and S segments (GQ336989), respectively, of the INSV Phalaenopsis isolate. Sequence comparisons showed no evidence of reassortment between INSV and another orthotospovirus. There was a report of tomato spotted wilt virus infecting T. violacea in Florida, U.S.A. (Dey et al. 2019). No other virus infecting T. violacea has been reported. INSV has been reported to infect several economically important crops, including Phalaenopsis and pepper, in China (Chen et al. 2016). INSV-infected T. violacea not only looses landscaping value but also plays an important intermedia host role in the spread of INSV. Additional surveys and evaluation will be needed to understand the potential medicinal effect of INSV on this plant. To our knowledge, this is first report of INSV in T. violacea.The author(s) declare no conflict of interest.References:Chen, X.-J., et al. 2016. Plant Dis. 100:1029. https://doi.org/10.1094/PDIS-10-15-1178-PDN Link, ISI, Google ScholarDey, K. K., et al. 2019. Plant Health Prog. 20:131. https://doi.org/10.1094/PHP-03-19-0020-BR Link, ISI, Google ScholarHuang, K. S., et al. 2018. Eur. J. Plant Pathol. 150:457. https://doi.org/10.1007/s10658-017-1295-5 Crossref, ISI, Google ScholarKubec, R., et al. 2002. Phytochemistry 60:21. https://doi.org/10.1016/S0031-9422(02)00065-1 Crossref, ISI, Google ScholarMoodley, K., et al. 2015. BMC Complement. Altern. Med. 15:408. https://doi.org/10.1186/s12906-015-0932-9 Crossref, ISI, Google ScholarFunding: This research was carried out with the support of the NSFC (31371919), Foundation of Yunnan University of Chinese Medicine (30270104870), Natural Science Foundation of Yunnan Province (2017FA019), and High Level Talents Project of Yunnan University of Chinese Medicine (2019YZG09).The author(s) declare no conflict of interest.DetailsFiguresLiterature CitedRelated Vol. 107, No. 3 March 2023SubscribeISSN:0191-2917e-ISSN:1943-7692 Download Metrics Article History Issue Date: 3 Apr 2023Published: 21 Feb 2023First Look: 10 Aug 2022Accepted: 8 Aug 2022 Page: 974 Information© 2023 The American Phytopathological SocietyFundingNSFCGrant/Award Number: 31371919Foundation of Yunnan University of Chinese MedicineGrant/Award Number: 30270104870Natural Science Foundation of Yunnan ProvinceGrant/Award Number: 2017FA019High Level Talents Project of Yunnan University of Chinese MedicineGrant/Award Number: 2019YZG09Keywordsfirst reportImpatiens necrotic spot orthotospovirusTulbaghia violaceaThe author(s) declare no conflict of interest.PDF download
First report of Tomato Zonate Spot Virus infecting Belamcanda chinensis in China

Boxin Zhang,Yuting Xu,Lei Zhang,PengZhang Ji,Jia Hong Dong

DOI: https://doi.org/10.1094/PDIS-06-24-1234-PDN

2024-08-22

Abstract:Tomato zonate spot virus (TZSV, Orthotospovirus tomatozonae, genus Orthotospovirus, family Tospoviridae) was first reported to infect tomato (Solanum lycopersicum) in China in 2008 (Dong et al. 2008). Belamcanda chinensis (L.) Redouté is a perennial herbaceous medicinal plant of the family Iridaceae, which is widely distributed in China. Its rhizome contains abundant active components, mainly including flavonoids, and has antibacterial, anticancer, and antioxidative effects. In July 2023, four B. chinensis plants with virus-like symptoms were collected in Fuyuan County, Yunnan Province in China. The diseased leaves showed chlorosis and ringspots (Fig. S1). Spherical virus particles with a diameter of 80-100 nm were observed in the saps of diseased leaves under a transmission electron microscope (Fig. S2). The presence of an orthotospovirus was confirmed by the previously reported method to amplify the partial sequence (312 nt) of L segment (Huang et al. 2018) (Fig. S3). BLASTn analysis showed that the obtained 312-nt sequence was 95.62% nucleotide identity with TZSV tomato-YN isolate (accession no. NC_010491.1). To obtain the complete genome of this isolate, total RNA from symptomatic leaves of two single diseased B. chinensis were extracted using Hipure Universal RNA Mini Kit (Magen Biotech) and subjected to high-throughput sequencing with a NovaPE150 (Illumina, USA) at MAGIGENE (Shenzhen, China). A total of 41,144,571 clean reads were obtained after removing low quality reads. Quality-controlled, qualified reads were assembled into contigs using Megahit v1.1.2 software. Thirteen contigs shared nucleotide identity ranging 86.94%-97.73% with the L, S, and M segments of TZSV using BLASTn searches online (https://blast.ncbi.nlm.nih.gov/Blast.cgi). In addition, no contigs were mapped to other viral (taxid:10239) and viroidal (taxid:12884) sequences in GenBank Databases. The full-length L, M, and S RNA segments of TZSV-Bc isolate was determined tbe 8917 nt (PP314222), 4718 nt (PP314223) and 3213 nt (PP314224), respectively. These segments were validated by RT-PCR, and Sanger sequencing. They shared nucleotide sequence identities of 95.9%, 97.2%, and 93.1% of the L (NC_010491.1), M (NC_010490.1), and S (NC_010489.1) segments, of the TZSV tomato-YN isolate, respectively. Compared to the TZSV tomato-YN isolate, there exists a missing segment with 113 nt in the intergenic region of S RNA and a segment with 199 nt in M RNA. To further confirm the TZSV infection on B. chinensis, three primers pairs Tosp10/ Tosp11， Tosp5/Tosp6, and NSs-F/NSs-R were tested by RT-PCR for TZSV based on the previous report (Dong et al, 2008). The sequences of amplicons shared >99% nucleotide identity with the corresponding TZSV-Bc isolate sequences. Total of 14 B. chinensis samples were detected with the primer pair N-F/N-R (5'-ATGTCTAACGTCCGGAGTTTAACA-3'/ 5'-AAAAGACAGATCATTGCTGCTCTT-3') by One Step RT-PCR, 6 samples (42.85%) showed the positive results. The mechanical inoculation and RT-PCR detection confirmed TZSV-Bc isolate can infect N. bethamiana. So far, tomato zonate spot virus has been detected in different plants including tobacco (N. tabacum) (Huang et al. 2017), sticktight (Bidens pilosa) (Xu et al. 2022), pepper (Capsicum annuum) (Li et al. 2023) in China. To our knowledge, it is the first report of TZSV naturally infecting B. chinensis plants, which enriches information on the host range of TZSV and will be helpful for disease management.
First report of tomato brown rugose fruit virus infecting Solanum lycopersicum in Northeast China

Huiyan Guo,Xue Dong,Zhiping Wang,Mengnan An,Xueqing Yang,Zihao Xia,Yuanhua Wu

DOI: https://doi.org/10.1094/pdis-11-23-2395-pdn

IF: 4.5

2023-12-06

Plant Disease

Abstract:Tomato (Solanum lycopersicum L.) is an important fruit and vegetable crop with high economic value due to its rich vitamins (Friedman. 2002). Over the past five years, due to tomato brown rugose fruit virus (ToBRFV) infection, the tomato production in many countries and regions in Asia, America and Europe have experienced declines in yield and quality (Salem et al. 2023). ToBRFV is a positive-sense single-stranded RNA virus of the genus Tobamovirus in the family Virgaviridae (Salem et al. 2016). In the field, ToBRFV mainly infects solanaceous crops, including tomato and pepper (Zhang et al. 2022). Symptoms on ToBRFV-infected tomato plants mainly include foliar mottle, vein necrosis, and brown mottled rugose fruit (Alfaro-Fernández et al. 2020, Hamborg et al. 2022, Ma et al. 2021). In April 2023, about 150 tomato plants showing leaf curl, brown patch, and rugose surface on fruits were found in a greenhouse grown with about 500 tomato plants in Huludao City, Liaoning province, China. Two leaves and eight fruits from each of 10 symptomatic tomato plants were sampled and subjected to dot enzyme-linked immunosorbent assay (Dot-ELISA) with an antibody against ToBRFV (LV BAO, Chengdu, China); and all samples tested positive. Sap inoculations were prepared from 0.1 g of ToBRFV-positive tomato leaves via homogenization with 0.01 mol·L-1 PBS (phosphate buffered saline, pH 7.2), which were then inoculated mechanically onto 10 tomato cv. Moneymaker and 10 Nicotiana benthamiana plants at four- to six-leaf stage, respectively. At 10 days post inoculation (dpi), the leaf curl symptoms of all tomato plants were shown, which were consistent with those on greenhouse-infected plants. At 5 dpi, the upper leaves of all N. benthamiana plants showed yellowing and curling symptoms. The results of Dot-ELISA assays revealed that these mechanically inoculated plants were positive for ToBRFV. Total RNAs of inoculated and greenhouse-collected samples were extracted using TRIzolTM reagent and analyzed by reverse-transcription (RT)-PCR with specific primers ToBRFV-FD (5' GTCCCGATGTCTGTAAGGCTTGC) and ToBRFV-RD (5' GCAGGTGCAGAGGACCATTGTAA) for ToBRFV detection, respectively. The results showed that a 680-bp fragment was obtained in all tested samples. Then, primers ToBRFV-F1 (5' GTGTATTTTTTACAACATATACC) and ToBRFV-R1 (5' AACCATTGACTCAGAACTC), ToBRFV-F2 (5' TAGCCAAGAATCACGCATG) and ToBRFV-R2 (5' AGCAGCAATAATCACCGTA), ToBRFV-F3 (GAAAGAGTGGGGACGTTACAACATTCATCGGTAAT) and ToBRFV-R3 (TGGGCCCCTACCGGGGGTTCCGGGGGAATTCGAAT) were used to amplify the full-length sequence of ToBRFV using field-collected samples. The methods of primer design are shown in supplemental file 1. The sequence obtained by Sanger sequencing showed 99.86% nucleotide (nt) identity with ToBRFV-SD isolate (accession no. MT018320.1) from Shandong province, China. The full-length sequence of ToBRFV was uploaded to GenBank database with the accession number OR437354. To our knowledge, this is the first report of ToBRFV infecting tomato in Northeast China.

plant sciences
First report of tomato yellow mottle-associated virus infecting Solanum nigrum in China

Zhenggang Li,Yafei Tang,Xiaoman She,Guobing Lan,Lin Yu,Zifu He

DOI: https://doi.org/10.1094/PDIS-05-22-1096-PDN

2022-07-08

Abstract:First report of tomato yellow mottle-associated virus infecting Solanum nigrum in China Zhenggang Li, Yafei Tang, Xiaoman She, Guobing Lan, Lin Yu, and Zifu He† Guangdong Provincial Key Laboratory of High Technology for Plant Protection, Plant Protection Research Institute, Guangdong Academy of Agricultural Sciences, Guangzhou, 510640, P. R. China. Tomato yellow mottle-associated virus (TYMaV) is a newly found cytorhabdovirus associated with epinasty of leaflet blades, yellow spots, puckering, and mottling symptoms in tomato plants in China (Xu et al., 2017). In May 2020, Solanum nigrum plants exhibiting leaf crinkling and mosaic symptoms (eXtra S1) were found in Shantou city, Guangdong, China. To identify the causal pathogens, the leaves of three symptomatic plants were collected and subjected to total RNA extraction with TRIzol Reagent (Takara, Kusatsu, Japan). About 100 μg RNA mixture, which consisted of an equal amount of total RNA extracted from the three samples, was subjected to small RNA deep sequencing and assembly (sRSA) (Kreuze et al., 2009). Small RNA cDNA library was constructed with the method described previously (Mi et al., 2008). Small RNA deep sequencing was performed with Illumina HiSeq X Ten platform. VirusDetect (Zheng et al., 2017) was used to analyze the sequence data. The result showed that the sequence data includes about 11 million reads and generated 194 unique contigs after removal of host-derived contigs. Subsequently, the unique contigs were screened using BLASTn search against the virus database. One hundred and five unique contigs were mapped to TYMaV genome (reference sequence, KY075646), 21 unique contigs were mapped to RNA1 segment of tomato chlorosis virus (ToCV) genome (reference sequence, KY618796), 67 unique contigs were mapped to RNA2 segment of ToCV genome (reference sequence, KY618797), and one unique contig was mapped to pepper veinal mottle virus (PVMV) genome (reference sequence, FJ617225) (eXtra S1). To verify the sRSA result for TYMaV detection, RT-PCR was performed with two primer pairs TYMaV-F1/R1 (5'-TCATTAGACTCAGGCCTAATCCTCA AAGT-3'/5'-GATATGGAGACGTCCAAGTTCAAAGGGATGGA-3'), and TYMaV-F2/R2 (5'-TATGCGGCAGCTTTCATGTCTATAGACCCT-3'/5'-ATGACCTAGCTTCAATAACAGTCGCG-3'), which are designed according to the sRSA result. All the symptomatic samples tested positive for TYMaV (eXtra S2). Western blot with TYMaV N protein-specific antibody further verified the result (eXtra S2). To obtain the nearly full-length sequence of TYMaV identified in Shantou, 13 primer pairs were designed to amplify the viral fragments. The amplified PCR products were then introduced into pMD19T (Takara, Kusatsu, Japan) and sequenced by Sangon Biotech Co. (Shanghai, China). The nearly full-length sequence of TYMaV Shantou isolate (TYMaV-ST) was assembled from the 13 overlapping sequences (reference sequence, MW527091). TYMaV-ST genome comprises of 13401 nt and shares 84.93% nucleotide sequence identity with the reference genome (KY075646). In addition, 37 S. nigrum samples and 20 tomato samples nearby with viral disease symptoms were collected from different sites of Guangdong province, China. Six S. nigrum samples and five tomato plant samples tested positive for TYMaV by RT-PCR, suggesting a wide spread of the virus in the surveyed region. These results together with those of the sRSA assay also suggest that the disease symptoms shown in the original S. nigrum plants may not necessarily be caused by TYMaV or by TYMaV alone. To our knowledge, this is the first report of TYMaV infecting S. nigrum in China. S. nigrum is a common weed which belongs to the family Solanaceae and may serve as a reservoir for TYMaV in the fields. Further research is needed to verify whether this is indeed the case, and to understand the characteristics of this virus including its transmission, pathogenicity, and economic significance. The authors declare no conflict of interest. Funding This work was supported by the Key Research and Development Program of Guangdong Province (2018B020202006), the Agricultural Competitive Industry Discipline Team Building Project of Guangdong Academy of Agricultural Sciences (202103TD and 202105TD), the Science and Technology Program of Guangzhou (202102020504), and Special Fund for Scientific Innovation Strategy-Construction of High-Level Academy of Agriculture Science (R2019PY-QF003). References: Kreuze, J. F., et al. 2009. Virology. 388: 1. Mi, S., et al. 2008. Cell. 133: 116. Xu, C., et al. 2017. J Virol. 91: 11. Zheng, Y., et al. 2017. Virology. 500: 130.
First Report of a Tospovirus on Sunflower (Helianthus annus L.) from India

K Venkata Subbaiah,D V R Sai Gopal,M Krishna Reddy

DOI: https://doi.org/10.1094/PDIS.2000.84.12.1343B

Abstract:Virus-like symptoms were observed on sunflower in and around Tirupati during January 1998. Infected plants exhibited severe mosaic, systemic necrosis along the stem and floral heads, leaf distortion, and ringspots on leaves. The causal virus, mechanically transmissible from sunflower to sunflower cvs. Morden, MHSF8, MHSF18, KBHS1, and Cargil, developed symptoms like those in the original plant. The virus caused chlorotic and necrotic spots on Chenopodium amaranticolor, chlorotic and necrotic rings on cowpea cv. C-152, chlorotic spots on Datura metal and Petunia hybrida, chlorotic rings and systemic infection on Gomphrena globosa, tarlike symptoms on Catharanthus roseus, and local brown lesions on Cassia tora (1). Virus was isolated from infected sunflower leaves (2), and particles in negatively stained preparations were enveloped and 80 to 90 nm in diameter. Cytopathic effects included accumulation of virus particles in the endoplasmic reticulum, the formation of viroplasm, and aggregates consisting of nonenveloped viral nucleocapsids in the cytoplasm of ultrathin sections of infected sunflower leaves. Sodium dodecyl sulfate polyacrylamide gel electrophoresis analysis of capsid protein resolved as a single band of 31 kD. The dsRNA isolated from infected sunflower leaves resolved as three bands of 9, 4.9, and 3 kb in 2% agarose gel electrophoresis. In enzyme-linked immunosorbent assay, the purified virus reacted with homologous and Peanut bud necrosis virus (PBNV-ICRISAT, India) antisera and not to polyclonal antibodies to Iris yellow spot virus (Netherlands), Tomato spotted wilt virus-T (Georgia), Impatiens necrotic spot virus, and several isolates of Cucumber mosaic virus (CMV-B, CMV-C, CMV-To). In western blotting analysis, the virus coat protein reacted with homologous and PBNV antisera corresponding to coat protein band of 31 kD. In reverse transcription polymerase chain reaction, the viral RNA was amplified by using primers derived from NP gene sequence of PBNV and Watermelon silver mottle virus (WSMV). Based on these properties, the virus causing sunflower mosaic followed by necrosis in India was identified as a tospovirus, which may be as a distinct isolate of sero group IV. References: (1) A. A. Brunt et al. Viruses of Plants Online. 1996. Australian National University, Canberra, 1996. (2) D. V. R. Reddy et al. Bud necrosis virus: A disease of peanut caused by Tomato spotted wilt virus. ICRISAT Inf. Bull. No. 31, 1991.
First Report of Sweet Potato Feathery Mottle Virus Infecting Dendrobium Candidum in China

Zhongyang Sun,Y. H. Zhang,Qian Xu,Zhong Chen,Li Xie,Bizeng Mao

DOI: https://doi.org/10.1094/pdis-07-18-1165-pdn

IF: 4.5

2019-01-01

Plant Disease

Abstract:HomePlant DiseaseVol. 103, No. 5First Report of Sweet Potato Feathery Mottle Virus Infecting Dendrobium candidum in China PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Sweet Potato Feathery Mottle Virus Infecting Dendrobium candidum in ChinaZ. Y. Sun, Y. H. Zhang, Q. Q. Xu, Z. X. Chen, L. Xie, and B. Z. MaoZ. Y. Sunhttp://orcid.org/0000-0003-4453-0284Institute of Biotechnology, Zhejiang University, Hangzhou 310058, China; and Search for more papers by this author, Y. H. ZhangInstitute of Biotechnology, Zhejiang University, Hangzhou 310058, China; and Search for more papers by this author, Q. Q. XuInstitute of Biotechnology, Zhejiang University, Hangzhou 310058, China; and Search for more papers by this author, Z. X. ChenInstitute of Biotechnology, Zhejiang University, Hangzhou 310058, China; and Search for more papers by this author, L. XieAnalysis Center of Agrobiology and Environmental Science, Zhejiang University, Hangzhou 310058, ChinaSearch for more papers by this author, and B. Z. Mao†Corresponding author: B. Z. Mao; E-mail: E-mail Address: [email protected]Institute of Biotechnology, Zhejiang University, Hangzhou 310058, China; and Search for more papers by this authorAffiliationsAuthors and Affiliations Z. Y. Sun1 Y. H. Zhang1 Q. Q. Xu1 Z. X. Chen1 L. Xie2 B. Z. Mao1 † 1Institute of Biotechnology, Zhejiang University, Hangzhou 310058, China; and 2Analysis Center of Agrobiology and Environmental Science, Zhejiang University, Hangzhou 310058, China Published Online:26 Feb 2019https://doi.org/10.1094/PDIS-07-18-1165-PDNAboutSections ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Dendrobium candidum is one of the traditional medicinal plants of China and has been recorded in the Chinese Pharmacopoeia (2005 edition) as one of the original materials of “Shi Hu” (Li et al. 2008). Its stems are made as medicine for antipyretic, eyes-benefiting, antitumor, antiaging, and tonic purposes. In May 2018, chlorotic blotches, mosaic, and mottle symptoms were observed on 3-year-old seedlings in the greenhouse in Menghai City, Yunnan Province, China. After negative staining of samples with phosphotungstic acid, flexuous filamentous virus particles of 600 to 900 nm in length were observed using a transmission electron microscope (TEM). Bundles of flexuous filamentous particles and cylindrical inclusion bodies typical of potyviruses were observed in the cells of D. candidum under TEM after ultrathin sectioning. Leaf samples were collected from 18 symptomatic plants and tested by double antibody sandwich ELISA (Takara) with antisera against sweet potato feathery mottle virus (SPFMV), zucchini yellow mosaic virus, turnip mosaic virus, and potato virus Y. Eight samples reacted with the SPFMV antiserum, but none of the 18 samples reacted with the other antisera. Total nucleic acids were extracted from six symptomatic leaf samples using Fruit-mate for RNA Purification (Takara) and TRIzol, and they were then tested with reverse transcription polymerase chain reaction (PCR) using a pair of specific primers, SPFMV-F and SPFMV-R (Kwak et al. 2014). A single band of 356 bp was observed when the PCR products were analyzed on a 1% agarose gel. The PCR product was purified using a DNA Gel Extraction Kit (Tsingke, China), cloned in pGEM-T Easy Vector (Promega), and sequenced in both directions. A consensus sequence was obtained from six clones and submitted to GenBank (MH508094). This isolate shared 98 to 99% nucleotide identity with corresponding SPFMV sequences deposited in GenBank and showed the highest nucleotide sequence identity (99%) with the Korean isolate of SPFMV from sweet potato (KP115608). This is the first report of SPFMV naturally infecting D. candidum in China; therefore, effective management strategies should be adopted to prevent introduction of this virus in D. candidum growing regions.References:Kwak, H.-R., et al. 2014. Plant Pathol. J. 30:416. https://doi.org/10.5423/PPJ.OA.04.2014.0029 Crossref, ISI, Google ScholarLi, Y., et al. 2008. Chem. Pharm. Bull. (Tokyo) 56:1477. https://doi.org/10.1248/cpb.56.1477 Crossref, ISI, Google ScholarZ. Y. Sun and Y. H. Zhang contributed equally to this article.Funding: This research was supported by the key research and development projects of Zhejiang Province in 2018 (no. 2018C02034) and Zhejiang province agricultural Chinese medicine new variety breeding major science and technology special project (no. 2016C02058-3).DetailsFiguresLiterature CitedRelated Vol. 103, No. 5 May 2019SubscribeISSN:0191-2917e-ISSN:1943-7692 DownloadCaptionTomato leaves infected with Tomato chlorotic dwarf viroid (Olmedo-Velarde, Roy, Belanger, Watanabe, Hamasaki, Mavrodieva, Nakhla, and Melzer). Photo credit: M. J. Melzer. Spinach plants with downy mildew symptoms caused by Peronospora effusa (Kandel, Mou, Shishkoff, Shi, Subbarao, and Klosterman). Photo credit: S. L. Kandel. Metrics Article History Issue Date: 8 May 2019Published: 26 Feb 2019First Look: 15 Nov 2018Accepted: 12 Nov 2018 Pages: 1047-1047 Information© 2019 The American Phytopathological SocietyFundingkey research and development projects of Zhejiang Province in 2018Grant/Award Number: 2018C02034Zhejiang province agricultural Chinese medicine new variety breeding major science and technology special projectGrant/Award Number: 2016C02058-3Cited byDevelopment of a dual RT-RPA detection for Sweet potato feathery mottle virus and Sweet potato chlorotic stunt virusMolecular and Cellular Probes, Vol. 65Sweet potato feathery mottle virus (internal cork disease of sweet potato)CABI Compendium, Vol. CABI CompendiumDissipation, occurrence, and risk assessment of 12 pesticides in Dendrobium officinale Kimura et MigoEcotoxicology and Environmental Safety, Vol. 222A rapid sap‐direct reverse transcription‐polymerase chain reaction method for detection of dendrobium viroid in Dendrobium plants19 May 2021 | Letters in Applied Microbiology, Vol. 73, No. 1Dendrobium viroid, a new monocot-infecting apscaviroidVirus Research, Vol. 282
[Effects of human dendritic cells derived from CD34(+) cells on the biologic characteristic of bone marrow-derived mesenchymal stem cells].

Yong-feng Su,Siwei Huo,Xiao-Xia Jiang,Yuanlin Liu,Ying Wu,N. Mao,Yi Zhang

2009-08-01

Abstract:This study was purposed to clarify whether biology function of mesenchymal stem cells (MSCs) is changed by suppressing the development of dendritic cells (DC) derived from hematopoietic stem cells (HSCs). MSCs were cocultured with dendritic cells derived from CD34 positive hematopoietic stem cells (HSCs), and then the expression of cytokines and phenotypes of DCs/MSCs were detected by RT-PCR and flow cytometry respectively. Induced experiments were used to analyze the differentiation ability of MSCs. The results showed that DCs/MSCs were negative for the CD14, CD34, CD45, CD31, CD86, but positive for HLA-ABC, CD29, CD73, though the percentage decreased as MSCs vs DCs/MSCs (93.1% vs 13.44%, 98.3% vs 78.8%, 95.3% vs 75.9%). In addition, the expression of cytokines such as M-CSF, TGF-beta increased in DCs/MSCs. After differentiation induction, DCs/MSCs were deprived of the potential to differentiate into adipocytes, but maintained osteogenesis characteristics. It is concluded that the basic characteristics of MSCs are altered after coculture with DCs, and DCs/MSCs result in lower expression of mesenchymal phenotypes and decrease differentiation ability, but increase the expression of cytokines related to hematopoiesis and immunity.
First report of Tomato yellow mottle-associated virus infecting pepper (Capsicum annuum L.) in China

Changjie Li,Yi Liu,Chuanlin Yin,Kai Sun,Guangfu Liu,Pengjun Zhang

DOI: https://doi.org/10.1094/PDIS-09-22-2050-PDN

2022-10-24

Abstract:Tomato yellow mottle-associated virus (TYMaV), is a member of the genus Cytorhabdovirus in the family Rhabdoviridae, which has been reported to infect tomato (Lycopersicon esculentum) (Xu et al. 2017), Solanum nigrum (Li et al., 2022) and Nicotiana benthamiana (Zhou et al. 2019). In July 2021, virus-like symptoms of chlorosis, mosaic, and ring spots were observed in pepper, tomato, and eggplant during a survey of viral symptoms in Huzhou City, Zhejiang Province, China. To identify viral agents potentially associated with these diseases, an Oxford Nanopore cDNA library from the mixed samples was generated and sequenced. Briefly, total RNA from 10 leaf tissue samples (3 pepper plants, 4 tomato plants, and 3 eggplant plants) was extracted using RNAiso Plus (TaKaRa, Tokyo, Japan) and pooled in equal amounts (100 ng/l each). The library was constructed using a PCR-cDNA sequencing kit (SQK-PCS109; Oxford Nanopore Technologies, Oxford, UK) in accordance with the manufacturer's instructions. Approximately 8.6 million reads were obtained from the Oxford MinION platform. After removing adapters and low-quality reads using iVar v1.3.1 (Grubaugh et al., 2019), the clean reads were subjected to BLASTn search in the GenBank database. We identified sequences derived from potato virus X (PVX), potato virus Y (PVY), cucumber mosaic virus (CMV), pepper mottle virus (PepMoV), and TYMaV. Of these reads, 339 with lengths ranging from 375 to 8651 nt were mapped to the genome of TYMaV (GeneBank Accession No. KY075646.1) at a 98.2% query coverage. To identify TYMaV-infected plants in the pooled samples, all 10 samples were analyzed by two-step RT-PCR using AMV reverse transcriptase (Takara, Tokyo, Japan) combined with random primers N6 (Takara, Dalian, China) and high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo, Osaka, Japan) with primer pairs: N-F 5'- CAGGGAGAGAATGTACAAGTTGATC'/N-R 5'- GACCTTGCTCATCTGATGCAAC -3', amplifying 420 bp of the 3'end of nucleoprotein (N) gene. A pepper sample showing chlorosis symptom was positive for the TYMaV infection, but negative for PVX, PVY, CMV or PepMoV infection when tested using the primers listed in table S1. To confirm the genome sequence of TYMaV Zhejiang isolate (TYMaV-ZJ), we carried out two-step RT-PCR with seven primer pairs (Table S1) designed based on the reference TYMaV genome (GeneBank accession number KY075646.1). PCR products were cloned into pLB vector (Tiangen, Beijing, China) and Sanger sequenced in both directions. At least five independent clones of each fragment were sequenced to avoid possible mutations introduced by PCT. The sequences were assembled into a nearlyfull-length genome of TYMaV -ZJ which was composed of 13344nt (GeneBank accession number OP296980). Pairwise sequence comparison revealed that TYMaV -ZJ genome shared 91.50% and 85.59% nt sequence identity with that of the TYMaV tomato isolate (KY075646.1) and the Solanum nigrum isolate (MW527091.1), which is higher than the species demarcation threshold of 75% for the genus Cytorhabdovirus (Walker et al., 2022). To the best of our knowledge, this is the first report of TYMaV infecting pepper.
Mouse embryos and uterine epithelia show adhesive interactions in culture.

J. Morris,S. W. Potter,P. Buckley

DOI: https://doi.org/10.1002/JEZ.1402220211

1982-08-10

The Journal of Experimental Zoology

Abstract:To investigate the cellular mechanisms in preimplantation adhesion of the mammalian blastocyst to uterine epithelium, it is essential to avoid the complexities of the maternal environment but at the same time prevent the introduction of competing artificial surfaces, to which embryos preferentially adhere. We demonstrate here that sealed vesicles of isolated uterine epithelium cultured together with blastocysts in hanging drops provide an optimum system for encouraging and observing the adhesive interactions. The responses of the embryonic and maternal cells were identical to those known in vivo. Microvilli were seen on both surfaces, and in places the membranes were drawn into close apposition with some desmosomelike junctions. After blastocyst adhesion occurred trophoblast cells invaded the epithelium and showed phagocytic activity, closely resembling the invasion that follows adhesion during normal pregnancy in mice. Key words blastocyst, cell adhesion, implantation, microvilli, phagocytosis, trophoblast.
Serological Detection and Molecular Identification of Tomato Spotted Wilt Virus in Pepper in Chongqing

SUN Miao,JING Chenchen,CHU Chengru,WU Gentu,SUN Xianchao,XIE Yan,LIU Yong,QING Ling

DOI: https://doi.org/10.16420/j.issn.0513-353x.2016-0733

2017-01-01

Abstract:To identify the occurrence and variation of the coat protein gene(cp)of Tomato spotted wilt virus(TSWV)in pepper in Chongqing,a total of 298 diseased pepper samples were collected and subjected to the detection of Dot-ELISA with specific antiserum of TSWV and RT-PCR with specific primers.Results of Dot-ELISA detection revealed that 40 samples were positive with a detection ratio of 13.42％.Typical enveloped spherical particles were observed in the TSWV-positive samples through electron microscopy.Six positive samples were randomly selected and amplified by RT-PCR with primers specific for the cp gene of TSWV,and results revealed that an approximate 750 bp fragment was obtained in each sample.Sequencing showed that cp gene of the isolate TSWV-CQ (KX611497) shared 96.1％ to 99.4％ identities with those of the other 22 previously reported TSWV isolates.Phylogenetic analysis showed that the isolate TSWV-CQ was most closely related to TSWV isolates of China and suggested that geographical selection force played a role in virus evolution.
First Report of Tobacco Streak Virus in Cannabis sativa in New York

Derrick Grunwald,Chathura Wijesinghege,Tyler Gordon,Zachary Stansell,Shelby Ellison

DOI: https://doi.org/10.1094/PDIS-09-23-1810-PDN

2023-12-19

Abstract:In 2022, virus-like symptoms were observed in a field of diverse hemp (Cannabis sativa L.) germplasm in Ontario County, New York. Less than 1% of plants exhibited stunting and curled leaves (Figure S1), consistent with tobacco streak virus (TSV) symptoms on other plants (Liu et al. 2022). Most typically, the plants were considerably reduced in overall size, with upwards, adaxial curling along the leaf margin with newer leaves appearing to be the most affected. Fifteen symptomatic plants representing nine accessions were tested for 12 viruses and viroids through Agdia Testing Services (Elkhart, IN). Of these, eight plants representing five accessions including: G 33204 21UO SD ('Cherry Wine S1'), G 33211 21UO SD ('Wife'), G 33225 22CL01 CL ('Candida #2'), G 33270 22UO SD ('Falkowski CBD Mix'), and G 33365 22UO SD ('Queen Dream'), were positive for TSV, a type of Ilarvirus in the Bromoviridae family. Presence of TSV was confirmed through enzyme-linked immunosorbent assay testing. TSV is a positive-sense, single-stranded RNA virus with a wide host range that can be transmitted by thrips, mechanical injury, seed, and pollen (Zambrana-Echevarría et al. 2021). To confirm the presence of TSV, two putatively TSV-infected samples were subjected to RNA-Seq analysis. RNA was extracted using the RNeasy Plant Mini Kit (Qiagen, Aarhus, Denmark) per manufacturer's direction. Stranded RNA libraries were prepared using the Illumina TruSeq Stranded Total RNA with Ribo-Zero Plant kit (San Diego, California, USA). Paired-end 2x150bp sequencing was performed on an Illumina NovaSeq6000 sequencer. RNA-Seq data was trimmed using the fastp program (Chen et al. 2018) with default parameters to remove adapter sequences and low-quality bases. After filtering, 49,696,041 and 56,126,804 paired-end reads were retained from 'Wife' and 'Falkowski CBD Mix' samples, respectively. Filtered RNA-seq reads were mapped to TSV genome accession GCF_000865505.1 using the bowtie2 (Langmead & Salzberg 2012) aligner with default parameters. From 'Wife' and 'Falkowski CBD Mix' samples, 153 and 139 reads mapped to the TSV reference genome. To further validate the presence of TSV reads, RNA-Seq data was analyzed using the Kraken2 pipeline (Wood et al. 2019). Using the Kraken2 virus database, reads associated with TSV (NCBI taxonomy ID: 12317) were identified. This analysis identified 172 and 151 TSV reads from 'Wife' and 'Falkowski CBD Mix,' respectively. Higher numbers of reads identified using the Kraken2 analysis is due to the more permissive k-mer matching approach implemented in Kraken2. Furthermore, we identified several other virus taxa in the samples. Of note, both samples had a high number of reads associated with Amazon lily mild mottle virus with 254,493 and 116,150 reads from 'Wife' and 'Falkowski CBD Mix,' respectively. Among other virus species belonging to Ilarviruses, Cassava Ivorian bacilliform virus and Cowpea chlorotic mottle viruses were detected from both samples. To further validate infection by TSV, samples from both ELISA-positive and ELISA-negative plants were subjected to PCR using the primers and protocol described in Zambrana-Echevarría et al. 2021. Amplification of an approximately 700 base-pair product was observed in the putatively ELISA-positive samples, but not in the ELISA-negative samples. The amplicons were further cloned into the pGEM-T Easy vector (Promega, Madison, WI, U.S.A) using the manufacturer's protocol and sequenced using M13 forward and M13 reverse primers (Functional Biosciences, Madison, WI, U.S.A). Sequencing results indicated considerable similarity to TSV genomes available in GenBank, between 88% and 99%. Raw sequence data generated from this study was deposited in NCBI under the bioproject ID PRJNA1009441. Though it cannot be ruled out that the observed symptoms were caused exclusively by TSV infection due to the high number of other viral reads, the results contribute to the literature that indicates hemp can host TSV and should be considered a potential source of TSV inoculum (Chiginsky et al. 2021). This new inoculum source could cause significant crop damage and economic loss when grown with TSV susceptible row and specialty crops.
Decompression "Iridopathy" Following Diode Laser Cycloablation.

T. A. Williams,F. Sii,M. Chiang,P. Shah

DOI: https://doi.org/10.3928/15428877-20100216-13

Abstract:
First Report of Pea as a Natural Host of tomato mottle mosaic virus in China

Shu Zhang,Guanlin Tan,Fan Li

DOI: https://doi.org/10.1094/PDIS-02-21-0280-PDN

2021-08-19

Abstract:Tomato mottle mosaic virus, a new species in the genus Tobamovirus and family Virgaviridae, was first reported on tomato in Mexico in 2013 (Li et al. 2013). Subsequently, tomato mottle mosaic virus (ToMMV) was found infecting pepper and eggplant in China (Li et al. 2014; Chai et al. 2018). ToMMV was thought to pose a serious risk to solanaceous crops due to its potential to break resistance and numerous transmission ways (Li et al. 2020), meanwhile, some plant species in the families of Amaranthaceae, Brassicaceae, Cucurbitaceae, and Verbenaceae, were found as the hosts of ToMMV under experimental condition (Sui et al. 2017; Li et al. 2020). To clarify the occurrence of ToMMV in Yunnan province of China, 395 plant samples, including tomato (Solanum lycopersicum L.), pepper (Capsicum annuum L.) and pea (Pisum sativum L.), exhibiting viral-like symptoms were collected in major crop plantations in Yunnan province in 2020. Total nucleic acids were extracted from the diseased samples using a CTAB method (Li et al. 2008), and tested by reverse transcription polymerase chain reaction (RT-PCR) with ToMMV specific primers, ToMMVMPF (5'-ATGGCTCTAACTGTTAGTGGT-3') and ToMMVMPR (5'-TTAATACGAATCAGATCCCGCG-3'), which were designed based on the movement protein gene sequence of ToMMV YYMLJ isolate (KR824950). ToMMV was detected in 13 symptomatic samples (11 cherry tomato and 2 green pea plants) with a total detection rate of 3.29%. An 807-bp fragment was amplified from 2 out of 86 pea samples showing foliar chlorosis, mosaic, malformation and necrosis symptoms, and the amplicons were cloned and sequenced. Sequences obtained from the two pea samples were identical. Therefore, one sequence was deposited in the GenBank (accession no. MW561348). BLAST search result showed that the nucleotide sequence had the highest identity of 99.88% with the ToMMV TiLhaLJ isolate (KR824951). The ToMMV infection on the two pea samples was also verified by dot-enzyme immunoassay (Dot-ELISA) using ToMMV monoclonal antibody (kindly provided by Dr. Jianxiang Wu, Zhejiang University, China). To determine the pathogenicity of ToMMV on pea, ToMMV infectious cDNA clone was used to inoculate into 3-week-old healthy pea plants via an Agrobacterium-mediated method (Tu et al. 2021). Mottle or slight mosaic, chlorosis and malformation symptoms were observed on the upper leaves of the 8 out of 12 inoculated plants 8 days postinoculation, and ToMMV could be detected by RT-PCR from the 8 symptomatic plants but not from the asymptomatic and healthy control pea plants with the above described ToMMV specific primer pair. ToMMV has now only been detected in Mexico, China, Spain, USA, Israel and Australia on tomato, pepper and eggplant (Webster et al. 2014; Turina et al. 2016; Ambrós et al. 2017; Lovelock et al. 2020). To the best of our knowledge, this is the first report of natural infection of ToMMV in pea as well as the natural infection of ToMMV on plants outside of the family Solanaceae. The result also implies that ToMMV has a potential risk to more crops in the field. Since pea, pepper and tomato are economically important cash crops in China, proper virus management strategies for the cultivation of these crops should be adopted.

SSDP1 gene encodes a protein with a conserved N-terminal FORWARD domain.

First report of tomato spotted wilt virus (TSWV) isolated from nasturtium (Tropaeolum majus L.) with a serious leaf mosaic disease in China

First Report of Tomato Spotted Wilt Virus in Argyranthemum Frutescens in China

The genetics of ACTH resistance syndromes.

First Report of Pepper Veinal Mottle Virus Infecting Pepper in Mainland China

First report of Impatiens necrotic spot orthotospovirus infecting Tulbaghia violacia Harv. in China

First report of Tomato spotted wilt orthotospovirus infecting agapanthus (Agapanthus praecox) in South Africa

First Report of Chilli veinal mottle virus Infecting Tomato (Solanum lycopersicum) in China

First Report of Impatiens Necrotic Spot Orthotospovirus Infecting Tulbaghia Violacea in China

First report of Tomato Zonate Spot Virus infecting Belamcanda chinensis in China

First report of tomato brown rugose fruit virus infecting Solanum lycopersicum in Northeast China

First report of tomato yellow mottle-associated virus infecting Solanum nigrum in China

First Report of a Tospovirus on Sunflower (Helianthus annus L.) from India

First Report of Sweet Potato Feathery Mottle Virus Infecting Dendrobium Candidum in China

[Effects of human dendritic cells derived from CD34(+) cells on the biologic characteristic of bone marrow-derived mesenchymal stem cells].

First report of Tomato yellow mottle-associated virus infecting pepper (Capsicum annuum L.) in China

Mouse embryos and uterine epithelia show adhesive interactions in culture.

Serological Detection and Molecular Identification of Tomato Spotted Wilt Virus in Pepper in Chongqing

First Report of Tobacco Streak Virus in Cannabis sativa in New York

Decompression "Iridopathy" Following Diode Laser Cycloablation.

First Report of Pea as a Natural Host of tomato mottle mosaic virus in China