Cholinergic system modulates growth, apoptosis, and secretion of cholangiocytes from bile duct-ligated rats.

G. Lesage,D. Alvaro,A. Benedetti,S. Glaser,L. Marucci,L. Baiocchi,Wendy Eisel,A. Caligiuri,J. L. Phinizy,R. Rodgers,H. Francis,G. Alpini

DOI: https://doi.org/10.1016/S0016-5085(99)70567-6

IF: 29.4

1999-07-01

Gastroenterology

Abstract:

What problem does this paper attempt to address?

Occurrence of Black Dot of Potato Caused by Colletotrichum coccodes in Central Italy

R Buonaurio,G Natalini,L Covarelli,C Cappelli

DOI: https://doi.org/10.1094/PDIS.2002.86.5.562C

Abstract:Between 1997 and 2000, black dot of potato (Solanum tuberosum L.), caused by the polyphagous soilborne fungus Colletotrichum coccodes (Wallr.) Hughes, was observed each summer in fields located in Umbria (central Italy). Disease incidence ranged from 50 to 100%, and early potato cultivars were generally more susceptible than late-maturing ones. Disease symptoms were first observed during August as a yellowing and wilting of foliage in the tops of plants, followed by rotting of the roots and stems, which led to the premature death of 50 to 70% of plants. Setose1 sclerotia (300 to 500 mm in diameter) and acervuli of the fungus were found on roots and stems of infected plants. Acervuli produced hyaline, aseptate, cylindrical conidia (16 to 22 × 2.5 to 4.5 μm) formed on unicellular cylindrical phialidic conidiophores. The fungus was isolated from diseased stems and roots on potato dextrose agar (PDA) at pH 6.5. Pathogenicity of the fungus was confirmed by fulfilling Koch's postulates using 3- to 4-week-old potato plants of a local cultivar. A superficial 5-mm vertical cut was made with a scalpel into the base of potato stems (2 cm beneath the soil surface), and 5-mm-diameter plugs of PDA alone (control plants) or PDA plus fungal growth were placed over the cuts. The wounds were sealed with wet cotton swabs that were held in place with Parafilm. Symptoms that resembled those in the field were observed on inoculated plants 6 to 8 weeks postinoculation. Symptoms did not appear on the control plants. The same fungus was reisolated from the diseased plants. Based on morphological characteristics of sclerotia, acervuli, and conidia, as well as pathogenicity tests, the fungus was identified as C. coccodes. To our knowledge, this is the first report of C. coccodes as the causal agent of black dot of potato in central Italy. We did not observe foliar outbreaks of the disease, which were reported from the United States (2). In both 1921 (1) and 1951 (3), the fungus was reported to cause severe outbreaks of the disease in northern Italy. Since then, its presence in Italy has been rarely recorded in potato (4). The occurrence of extremely dry and hot weather conditions during the summers of 1997 to 2000, which are favorable for disease development, made the disease particularly severe. We cannot exclude the possibility that the disease may have been present in central Italy before our observations, as it can be misdiagnosed and its symptoms can be masked by the symptoms of other diseases. The significance of black dot in central Italy needs to be reappraised in terms of both yield loss and tuber quality. References: (1) C. Arnaudi. Atti Ist. Bot. Univ. Pavia. Ser. 3, 1:71, 1924. (2) A. W. Barkdoll and J. R. Davis. Plant Dis. 76:131, 1992. (3) G. Goidanich. Inf. Fitopatol. 1:5, 1951. (4) S. Vitale et al. J. Plant Pathol. 80:265, 1998.
Virulence of Novel Ralstonia pseudosolanacearum (Phylotype I) Strains from Rose, Blueberry, and Mandevilla on Seed Potato

Remco Overeem,Chiel Pel,Napoleon Tjou-Tam-Sin,Jeroen van de Bilt,Peggy Gorkink-Smits,Marco Landman,Ana Maria B Bocsanczy,David Norman,Maria Bergsma-Vlami

DOI: https://doi.org/10.1094/PDIS-12-22-2931-SR

Abstract:Potato (Solanum tuberosum L.) ranks fourth among the most important staple food in the world. Ralstonia solanacearum (phylotype [phy] IIB, sequevar [seq] 1 and 2), also known as R3B2, the causal agent of brown rot disease on potato, is extremely damaging, causing great economical losses to potato in temperate regions. It is thought that members of Ralstonia pseudosolanacearum (phy I) are not pathogenic at low temperatures and are usually found in warmer climates. R. pseudosolanacearum strain PD 7123 (seq 33) isolated from roses in the Netherlands, strain P824 (seq 13) isolated from blueberry, and strain P781 (seq 14) from mandevilla in Florida are phylogenetically closely related and could share the same host. The virulence and ability of these novel strains to multiply latently in potato in temperate regions is unknown. The objective of this work was to assess the virulence and presence of latent infections of the mentioned R. pseudosolanacearum strains on three commercial seed potato cultivars under warmer (28°C) and temperate (20°C) temperatures. At 28°C, all three R. pseudosolanacearum strains caused severe symptoms on all potato cultivars. Overall disease severity on potato was lower at 20°C than 28°C, but major differences in virulence of the three strains were observed at 42 days postinoculation (dpi) among potato cultivars. All asymptomatic potato plants and most of their daughter tubers had latent infections at 20°C. Altogether, these results show that the phy I strains from rose, blueberry, and mandevilla may pose a threat to potato production in temperate climates and the worldwide movement of seed potatoes.[Formula: see text] Copyright © 2023 The Author(s). This is an open access article distributed under the CC BY 4.0 International license.
First report of Geotrichum candidum causing rubbery rot of potato (Solanum tuberosum) in Michigan

Jaime F Willbur,Emma M Schlachter,Mio Satoh-Cruz,Sarah Ruth,Carson Burek,Jan Byrne

DOI: https://doi.org/10.1094/PDIS-04-22-0916-PDN

2022-10-27

Abstract:In April 2018, rotted 'Lamoka' tubers were received from a commercial storage facility (<1% incidence) in St. Joseph County, Michigan by the MSU Potato & Sugar Beet Pathology and Plant & Pest Diagnostics programs. Dense circular colonies of white fungal-like growth were observed on the surface of the tubers, and internal tissues were watery and spongy with gray to brown discoloration (Supplemental Figure 1). Tubers had a strong, sweet alcoholic odor. External and internal tuber tissues were surface disinfested in 0.825% sodium hypochlorite for 1 min, rinsed twice in sterile distilled water, blotted on sterile filter paper, and placed onto 1.5% (w/v) water agar (WA). After 3 days at 21-24°C and ambient light conditions, septate, branched mycelia and hyaline, cylindrical, single-celled conidia 5.2-8.9 µm x 3.6-5.2 µm (n=20 arthrospores) were observed singly or in chains (Supplemental Figure 2A&B). On potato dextrose agar (PDA), colonies were white, circular, and dense (Supplemental Figure 2C). These observations matched morphological descriptions of Geotrichum candidum (Carmichael 1957). No Pythium or Phytophthora spp. were detected. A mono-conidial isolate of the fungus was obtained and maintained on PDA. DNA was extracted from mycelia using a DNeasy plant mini kit (QIAGEN). Fragments of the internal transcribed spacer (ITS) and 18S ribosomal RNA gene regions were amplified using primers ITS1F/4 primers and NS3/8, respectively (White et al. 1990). Purified PCR products (QIAquick PCR purification kit, QIAGEN) were submitted for Sanger sequencing at the Genomics Research Technology Support Facility (East Lansing, MI). The ITS1F/4 and NS3/8 consensus sequences (OP142324 and OP153873) aligned with GenBank accessions of G. candidum KY103456.1 (100% identity) and JF262193.1 (99.75% identity), respectively. Healthy 'Lamoka' tubers were rinsed with tap water, surface disinfested in 0.825% sodium hypochlorite for 15 min, rinsed twice in sterile distilled water, and blotted dry on sterile paper towel. Ten tubers were inoculated by placing 10-mm diameter fully colonized agar plugs, excised from the margin of a 9-day-old PDA culture, onto the surface of each tuber (Duellman et al. 2021). Ten tubers were mock-inoculated using sterile PDA. Tubers were placed in a moist chamber and incubated in the dark at room temperature. After nine days, inoculated tubers exhibited white colony growth on tuber surfaces and an alcoholic scent was present. After 27 days, internal tissues were rubbery, but no discoloration was observed. No rubbery rot symptoms were observed on the control tubers. Samples were excised 1 cm laterally from and vertically beneath the inoculation site. Tissues were surface disinfested as described above and plated on 1.5% WA. After 9 days, a Geotrichum sp. identical to the original isolate was confirmed in 50% of samples from inoculated tubers. No Geotrichum sp. were detected from mock-inoculated tubers. Since 2018, G. candidum has been confirmed in commercial storages in three counties in the Lower Peninsula (incidences up to 1-2%). Geotrichum candidum was recently reported causing rubbery rot of potato in Idaho (Duellman et al. 2021); however, to our knowledge this is the first report of rubbery rot in Michigan. Despite increasing detection frequencies, incidences remain low and spread in storage appears limited. Seed decay leading to stand loss (incidence 1-3%) was observed after planting infected lots, which should be avoided or minimized.
[Mechanism of acute complications in thyrotoxicosis].

G. Gurevich

Abstract:
Identification and comparison of biological characteristics and pathogenicity of different mating types of V. dahliae isolated from potato and sunflower

NingNing Yan,Mandela Elorm Addrah,Yuanyuan Zhang,Ruifang Jia,Liru Kang,Jun Zhao,Jian Zhang

DOI: https://doi.org/10.1038/s41598-022-17196-x

IF: 4.6

2022-07-29

Scientific Reports

Abstract:Potato is one of the most important staple crops in the world. China is one of the leading producers of potatoes, but the industry faces soilborne diseases such as Verticillium wilt. Most potato planting areas in China rotate the crop with sunflower which is also highly susceptible to Verticillium wilt. The comparison of the biological characteristics and pathogenicity of different mating types of Verticillium dahliae isolated from potato and sunflower in the major planting regions in China is of great importance. This is to help unravel the diversity in V. dahliae population and the sudden increase in infected fields. The diseased samples collected were cultured on PDA and the growing colony of pathogen isolated. Molecular techniques using specific primers were used to identify the V. dahliae pathogens and their mating type of the isolates obtained from the diseased sunflower and potato plants as well as their planting materials. The data obtained revealed that the dominant mating type population in sunflower was MAT1-1, whiles that of potato was MAT1-2, but Race 2 was the only race type identified for all the samples. There was a significant presence of MAT1-1 isolates present in potatoes, which is a new trend. Conventional crop rotation farming using sunflower is causing an increasing prevalence of MAT1-1 and mating type shift of isolates in potato in these regions.

multidisciplinary sciences
First Report of Potato virus Y in Potato in Tajikistan

O J Alabi,J M Crosslin,N Saidov,R A Naidu

DOI: https://doi.org/10.1094/PDIS-03-12-0249-PDN

Abstract:Potato (Solanum tuberosum L.) is widely grown as a staple food and cash crop in Tajikistan and is an important food security crop in the country. In June 2011, we conducted a survey of potatoes in farmers' fields in the Buston and Dushanbe regions (about 200 miles apart) of Tajikistan. Potato plants with stunted growth and leaves showing chlorotic spots, curling, and necrotic spots and rings were observed with the disease incidence monitored in 10 fields each in Buston and Dushanbe areas varying between 10 and 60%. Representative samples from symptomatic plants tested positive for Potato virus Y (PVY) using virus-specific immunostrips (Agdia Inc., Elkhart, IN). Leaf samples from symptomatic plants were collected from Buston and Dushanbe areas, imprinted on FTA Classic Cards (Whatman International Ltd., Maidstone, UK), air dried, and shipped to the lab at Washington State University for confirmatory diagnostic tests. Total nucleic acids were eluted from FTA cards (1) and subjected to reverse transcription (RT)-PCR with primers (PVY/Y4A and PVY/Y3S) specific to the coat protein of PVY (3). Samples infected with PVY ordinary strain (PVYO), tuber necrosis strain (PVYNTN), tobacco veinal necrosis strains (PVYEU-N and PVYNA-N), and a recombinant strain (PVYN:O) were included as references to validate RT-PCR results. A single DNA product of approximately 480 bp was amplified from potato samples that tested positive with PVY-specific immunostrips. The amplified fragments from two samples from Dushanbe and six from Buston areas were cloned separately into pCR2.1 (Invitrogen Corp., Carlsbad, CA) and two independent clones per amplicon were sequenced from both orientations. Pairwise comparison of these sequences showed 90 to 100% identity among the cloned amplicons (GenBank Accession Nos. JQ743609 to JQ743616) and 90 to 100% with corresponding nucleotide sequence of reference PVY strains (GenBank Accession Nos. JQ743617 to JQ743621). A global phylogenetic analysis of sequences revealed the presence of PVYO in both samples from Dushanbe and one sample from Buston regions and presence of PVYNTN in the remaining five samples from the Buston region. Because of the possible occurrence of mixed infections of PVY strains (2), further studies are needed to determine the presence of mixed infections of two or more strains of PVY and their specificity to potato cultivars. To our knowledge, this study represents the first confirmed report of two distinct strains of PVY in potato in Tajikistan. The occurrence of PVYNTN, a quarantine pathogen in many countries (2), warrants additional investigations to improve sanitary status of potato fields and to facilitate the availability of virus-free seed in clean plant programs for significant yield increases in Tajikistan. References: (1) O. J. Alabi et al. J. Virol. Methods 154:111, 2008. (2) S. Gray et al. Plant Dis. 94:1384, 2010. (3) R. P. Singh et al. J. Virol. Methods 59:189, 1996.
First Report of Impatiens necrotic spot virus Infecting Greenhouse-Grown Potatoes in Washington State

J M Crosslin,L L Hamlin

DOI: https://doi.org/10.1094/PDIS-07-10-0542

Abstract:In April and May 2010, leaves on approximately one-half of 200 potato (Solanum tuberosum L. cv. Atlantic) plants, 20 to 25 cm high, grown from prenuclear minitubers in greenhouses located at the USDA-ARS facility in Prosser, WA exhibited necrotic spots similar to those produced by the early blight pathogen, Alternaria solani. Fungicide sprays did not reduce incidence of the symptoms. Observations associated the symptoms with thrips feeding damage so plants were tested for Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) with ImmunoStrips from Agdia, Inc (Elkhart, IN). Three of three, two of two, and two of two symptomatic plants from three greenhouses were positive for INSV and negative for TSWV. Two symptomless plants tested negative. Four of four symptomatic and zero of two symptomless plants were positive by reverse transcription (RT)-PCR with INSV specific primers (forward: 5' TAACACAACACAAAGCAAACC 3' and reverse: 5' CCAAATACTACTTTAACCGCA 3') (4). The 906-bp amplicon from one sample was cloned and three clones were sequenced. The three clones were 99.7% identical, and BLAST analysis of the consensus sequence (GenBank Accession No. HM802206) showed 99% identity to INSV accessions D00914 and X66972, and 98% identity to other INSV isolates. The isolate, designated INSV pot 1, was mechanically inoculated to one plant of potato cv. GemStar and produced local, spreading necrotic lesions. The virus did not go systemic, as determined by RT-PCR of upper leaves 30 days after inoculation. The local necrotic lesions on GemStar were positive for INSV by ImmunoStrips and RT-PCR. The original source of the INSV inoculum is unknown. However, hairy nightshade (Solanum sarrachoides Sendtn.) and plantain (Plantago major L.) weeds in an ornamental planting near one of the affected greenhouses tested positive for INSV by ImmunoStrips. The nightshade showed obvious thrips feeding damage but no obvious virus symptoms while the plantain showed less thrips feeding damage but distinct necrotic rings. Subsequently, two of two symptomatic potato plants of cv. Desiree in another greenhouse near the initial site tested INSV positive with the ImmunoStrips. In addition to the necrotic lesions on leaves observed in cv. Atlantic, these plants also showed necrosis of petioles and stems. INSV is transmitted by a number of species of thrips, but the western flower thrips (Frankliniella occidentalis Perg.) is considered the most important under greenhouse conditions. The species of thrips in the affected greenhouses was not determined before all materials were discarded. Both INSV and the thrips vector have large host ranges including many crops and weeds, and have become increasingly important in recent years (1,2). INSV was reported on greenhouse-grown potatoes in New York in 2005 (3). These findings indicate INSV can be a major problem in greenhouse potatoes, whether for research purposes or production of virus-free minitubers destined for field plantings. References: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997. (2) R. A. Naidu et al. Online publication. doi:10.1094/PHP-2005-0727-01-HN, Plant Health Progress, 2005. (3) K. L. Perry et al. Plant Dis. 89:340, 2005. (4) K. Tanina et al. Jpn. J. Phytopathol. 67:42, 2001. ERRATUM: A correction was made to this Disease Note on September 7, 2012. The forward and reverse INSV specific primer sequences were corrected.
Search for supernova-produced 60Fe in a marine sediment.

C. Fitoussi,G. Raisbeck,K. Knie,G. Korschinek,T. Faestermann,S. Goriely,D. Lunney,M. Poutivtsev,G. Rugel,C. Waelbroeck,A. Wallner

DOI: https://doi.org/10.1103/PhysRevLett.101.121101

IF: 8.6

2007-09-26

Physical Review Letters

Abstract:An 60Fe peak in a deep-sea FeMn crust has been interpreted as due to the signature left by the ejecta of a supernova explosion close to the solar system 2.8+/-0.4 Myr ago [Knie, Phys. Rev. Lett. 93, 171103 (2004)10.1103/PhysRevLett.93.171103]. In an attempt to confirm this interpretation with better time resolution and obtain a more direct flux estimate, we measured 60Fe concentrations along a dated marine sediment. We find no 60Fe peak at the expected level from 1.7 to 3.2 Myr ago. Possible causes for the discrepancy are discussed.
Bronchogenic carcinoma, a largely preventable lesion assuming epidemic proportions.

A. Ochsner

DOI: https://doi.org/10.1378/CHEST.59.4.358

IF: 9.6

1971-04-01

Chest

Abstract:
First Report of Rhizoctonia Solani AG-1-IB Infecting Potato with Stem Canker in Heilongjiang Province, China

S. Yang,Y. Kong,F. Min,J. Zhang,L. Wang,L. Hu,X. Wang

DOI: https://doi.org/10.1094/pdis-02-19-0390-pdn

IF: 4.5

2019-01-01

Plant Disease

Abstract:HomePlant DiseaseVol. 103, No. 8First Report of Rhizoctonia solani AG-1-IB Infecting Potato with Stem Canker in Heilongjiang Province, China PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Rhizoctonia solani AG-1-IB Infecting Potato with Stem Canker in Heilongjiang Province, ChinaS. Yang, Y. Kong, F. Min, J. Zhang, L. Wang, L. Hu, and X. WangS. Yanghttp://orcid.org/0000-0002-9733-6752Virus-free Seedling Research Institute, Heilongjiang Academy of Agricultural Sciences, Harbin, 150086, China, Y. KongHeilongjiang Academy of Land Reclamation Sciences, Harbin, 150030, China, F. MinVirus-free Seedling Research Institute, Heilongjiang Academy of Agricultural Sciences, Harbin, 150086, China, J. ZhangVirus-free Seedling Research Institute, Heilongjiang Academy of Agricultural Sciences, Harbin, 150086, China, L. Wang†Corresponding authors: L. Wang; E-mail Address: lingling6958@hotmail.com and L. Hu; E-mail Address: hulinshuang@126.comInstitute of Crop Cultivation and Tillage, Heilongjiang Academy of Agricultural Sciences, Harbin, 150086, China, L. Hu†Corresponding authors: L. Wang; E-mail Address: lingling6958@hotmail.com and L. Hu; E-mail Address: hulinshuang@126.comVirus-free Seedling Research Institute, Heilongjiang Academy of Agricultural Sciences, Harbin, 150086, China, and X. WangCollege of Plant Protection, China Agricultural University, Beijing, 100193, ChinaAffiliationsAuthors and Affiliations S. Yang1 Y. Kong2 F. Min1 J. Zhang1 L. Wang3 † L. Hu1 † X. Wang4 1Virus-free Seedling Research Institute, Heilongjiang Academy of Agricultural Sciences, Harbin, 150086, China 2Heilongjiang Academy of Land Reclamation Sciences, Harbin, 150030, China 3Institute of Crop Cultivation and Tillage, Heilongjiang Academy of Agricultural Sciences, Harbin, 150086, China 4College of Plant Protection, China Agricultural University, Beijing, 100193, China Published Online:11 Jun 2019https://doi.org/10.1094/PDIS-02-19-0390-PDNAboutSectionsSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Rhizoctonia solani is one of the most important soil-borne pathogenic fungi and causes disease of several important crops worldwide. The various symptoms of R. solani infection are damping off, root rot, stem cankers, crown rot, and blights (Ogoshi 1996). For potato (Solanum tuberosum L.), R. solani has been associated with black scurf and stem canker, causing both qualitative and quantitative damage (Djébali and Belhassen 2010). Isolates of R. solani anastomosis group 3 (AG3) are recognized as the predominant cause of these diseases on potato globally (Carling 1996) and in the northeast of China (Yang et al. 2017). In July 2017, two potato plants (cultivars Favorita and Youjin-885) displaying visible brown, slightly sunken, and sharped-edged lesions on subterranean stem and/or stolon typically associated with stem canker were collected from Harbin City (45°50′55″N, 126°50′27″E) and Kesan County (48°3′6″N, 125°51′46″E), located in the potato production regions of Heilongjiang Province, in China. Stem pieces (5 mm long) were taken from the margins of the healthy and diseased tissues and were surface disinfected with 70% ethanol for 30 s and 0.5% NaClO for 1 min, rinsed three times with sterile distilled water, and after drying placed on 2% water agar amended with 0.125 g/liter of streptomycin sulfate. After incubation for 48 to 72 h at 24°C, hyphal tips resembling Rhizoctonia were examined for morphological characters microscopically, transferred to potato dextrose agar (PDA), and incubated at 24°C in the dark until use. Characteristics of two fungal isolates were typical of R. solani Kühn, exhibiting hyphal branching at right angles, a septum near the branching point, and a slight constriction at the branch base, with 4.38 to 13.3 μm diameter. Hyphal cells were also determined to be multinucleate by staining with 1% safranin O and 3% KOH solution (Bandoni 1979). Meanwhile, the total DNA was extracted using the Plant Genomic DNA Kit (Tiangen, Beijing, China) according to the manufacturer's instructions, and polymerase chain reaction amplification and sequencing of the internal transcribed spacer region of ribosomal DNA (rDNA) were conducted by the universal primers ITS1 and ITS4 (White et al. 1990). The resulting sequences (GenBank accession nos. MK288031 and MK288032) showed 99% identity to AG-1-IB isolates (e.g., MH172667 and GU585667). On the basis of morphological characteristics and nucleotide homology, two isolates were confirmed as R. solani AG-1-IB. Koch's postulates were confirmed for each isolate by carrying out pathogenicity tests with 10 replicates. Symptomless mini-tubers (Favorita) of approximately the same size (10 to 20 g) were washed, visually inspected for black scurf, and allowed to sprout at room temperature for 10 days. Each mini-tuber was planted into autoclaved soil in a plastic pot (4-liter capacity) and placed in a greenhouse at 18/27°C (night/day) with 50% relative humidity and watered as required. The pots were inoculated by placing a 5-mm-diameter mycelial plug (from one PDA isolate) over the mini-tuber, which was then covered with potting mix. The control pots were inoculated with sterile PDA. The treatment of each isolate was performed on 30 plants, and the control was repeated. After 3 weeks, plants were removed and assessed for disease. No disease symptoms were noted on the control plants. Typical stem canker was observed on inoculated plants from each isolate. R. solani AG-1-IB was consistently reisolated from symptomatic stems and confirmed by the morphological and molecular characteristics mentioned above. To our knowledge, this is the first report of AG-1-IB causing disease on potatoes in Heilongjiang Province. Potato stem canker caused by R. solani AG-1-IB has been reported in Inner Mongolia Autonomous Region (Tian et al. 2011) and Shaanxi Province (Yang et al. 2015). Currently, it is not a major disease of potato, but it is considered an emerging problem owing to the high risk of soil-borne infection in northern China, which is the main seed potato producing area with limited crop rotation. Because seed potatoes are produced and transported across China, it will be important to monitor R. solani AG groups. This information will assist in monitoring pathogen spread and will be critical to developing disease management strategies.The author(s) declare no conflict of interest.References:Bandoni, R. J. 1979. Mycologia 71:873. https://doi.org/10.1080/00275514.1979.12021088 Crossref, ISI, Google ScholarCarling, D. 1996. Page 37 in: Rhizoctonia Species: Taxonomy, Molecular Biology, Ecology, Pathology and Disease Control. Kluwer Academic Publishers, Dordrecht, the Netherlands. Crossref, Google ScholarDjébali, N., and Belhassen, T. 2010. Crop Prot. 29:998. https://doi.org/10.1016/j.cropro.2010.06.012 Crossref, ISI, Google ScholarOgoshi, A. 1996. Page 1 in: Rhizoctonia Species: Taxonomy, Molecular Biology, Ecology, Pathology and Disease Control. Kluwer Academic Publishers, Dordrecht, the Netherlands. Google ScholarTian, X. Y., et al. 2011. Chin. Potato 25:298 (In Chinese). Google ScholarWhite, T. J., et al. 1990. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA. Crossref, Google ScholarYang, S., et al. 2017. Am. J. Potato Res. 94:95. https://doi.org/10.1007/s12230-016-9535-3 Crossref, ISI, Google ScholarYang, Y. G., et al. 2015. Eur. J. Plant Pathol. 143:99. https://doi.org/10.1007/s10658-015-0668-x Crossref, ISI, Google ScholarThe author(s) declare no conflict of interest.Funding: This work was supported by the Heilongjiang Postdoctoral Special Fund (LBH-T1717) and Heilongjiang Postdoctoral Fund (LBH-Z16187).DetailsFiguresLiterature CitedRelated Vol. 103, No. 8 August 2019SubscribeISSN:0191-2917e-ISSN:1943-7692 DownloadCaptionPistachio fruit infected by Neofusicoccum mediterraneum (Moral et al.). Photo credit: T. J. Michailides. Leaf blight on Hosta ventricosa caused by Pseudomonas syringae pv. syringae (Liu et al.). Photo credit: Z. X. Liu. Metrics Article History Issue Date: 1 Aug 2019Published: 11 Jun 2019First Look: 2 Apr 2019Accepted: 25 Mar 2019 Pages: 2126-2126 Information© 2019 The American Phytopathological SocietyFundingHeilongjiang Postdoctoral Special FundGrant/Award Number: LBH-T1717Heilongjiang Postdoctoral FundGrant/Award Number: LBH-Z16187KeywordsRhizoctonia solani AG-1-IBpotatofirst reportThe author(s) declare no conflict of interest.Cited byDiversity of Mycoviruses Present in Strains of Binucleate Rhizoctonia and Multinucleate Rhizoctonia, Causal Agents for Potato Stem Canker or Black Scurf6 February 2023 | Journal of Fungi, Vol. 9, No. 2First Report of Black Scurf Caused by Rhizoctonia solani AG 2-2IV on Potato Tubers in Heilongjiang Province, ChinaShuai Yang, Yu Kong, Mei Guo, Xuezhi Dong, Fanxiang Min, Qi Wei, Wenzhong Wang, Yanzhi Mao, Xin Gu, and Ling Wang7 October 2022 | Plant Disease, Vol. 106, No. 11
The Hospital and Chapel of Saint Mary Roncevall at Charing Cross.

J. Galloway

DOI: https://doi.org/10.1177/003591571300601516

1913-05-01

Proceedings of the Royal Society of Medicine

Abstract:
First Report of Fludioxonil-Resistant Isolates of Fusarium spp. Causing Potato Seed-Piece Decay

R D Peters,H W Platt,K A Drake,R H Coffin,S Moorehead,M M Clark,K I Al-Mughrabi,R J Howard

DOI: https://doi.org/10.1094/PDIS-92-1-0172A

Abstract:Potato (Solanum tuberosum L.) diseases incited by Fusarium spp. include postharvest dry rot and seed-piece decay. Fusarium seed-piece decay is commonly controlled by preplant applications of chemical seed treatments. However, isolates of Fusarium spp. resistant to benzimidazole fungicides have been reported (2,4). In the spring of 2007, samples of cut seed tubers (cvs. Shepody and Russet Burbank) showing extensive symptoms of decay were received from three seedlots in Prince Edward Island (PE) and one seedlot in Saskatchewan (SK), Canada. All seed tubers had been treated with fludioxonil (Maxim Potato Seed Protectant [PSP], 0.5% fludioxonil) following cutting and then stored for 10 to 14 days prior to planting. Using standard isolation protocols (4), the 19 potato tuber pieces examined from PE and 2 from SK yielded 21 Fusarium isolates for further study. Five isolates (including both isolates from SK) were identified as Fusarium sambucinum Fuckel and the remaining 16 isolates were identified as F. coeruleum (Libert) Sacc. (3). To confirm identifications, isolates were compared with two known standards of each of F. sambucinum and F. coeruleum identified by K. Seifert (Agriculture and Agri-Food Canada, Ottawa, ON) by DNA sequencing of the partial β-tubulin gene or the translation elongation factor 1-α ( http://fusarium.cbio.psu.edu ; [1]). These standard isolates were also used as fludioxonil-sensitive controls in amended agar assays for chemical sensitivity. Agar plugs (5 mm in diameter) taken from the margins of 7-day-old cultures of the Fusarium isolates were transferred to petri dishes containing ½-strength potato dextrose agar amended with 0, 0.1, 1.0, 10.0, or 100.0 mg/liter of fludioxonil. Fludioxonil (Maxim PSP, 0.5% a.i.) was prepared as a stock solution in sterile distilled water and added to the molten agar after autoclaving. Culture incubation and mycelial growth measurements were performed as described previously (4). Measurements from four replicate petri dishes per concentration of fludioxonil were taken. Calculated EC50 values (fludioxonil concentration inhibiting pathogen growth by 50%) were obtained. The trial was repeated three times. The two standard isolates of F. sambucinum were sensitive to fludioxonil, with mean EC50 values of 0.002 (±0.002 standard error [SE]) and 0.005 (±0.002 SE) mg/liter. The two standard isolates of F. coeruleum were also sensitive to fludioxonil, with mean EC50 values of 0.17 (±0.005 SE) and 0.19 (± 0.005 SE) mg/liter. All other tested isolates of F. sambucinum and F. coeruleum were resistant to fludioxonil and showed no growth inhibition even at 100 mg of fludioxonil per liter. To our knowledge, this is the first report of resistance to fludioxonil in isolates of Fusarium spp. causing potato seed-piece decay. Since the isolates of F. sambucinum were also resistant to thiophanate-methyl and thiabendazole (data not shown), multiclass (benzimidazole and pyrrole) resistance was also documented. References: (1) D. M. Geiser et al. Eur. J. Plant Pathol. 110:473, 2004. (2) L. M. Kawchuk et al. Am. Potato J. 71:185, 1994. (3) P. E. Nelson et al. Fusarium Species: An Illustrated Manual for Identification. Pennsylvania State University Press, 1983. (4) R. D. Peters et al. Plant Dis. 85:1030, 2001.
First Report of Tomato chlorosis virus in Potato in Brazil

D M S Freitas,I Nardin,N Shimoyama,J A C Souza-Dias,J A M Rezende

DOI: https://doi.org/10.1094/PDIS-12-11-1068-PDN

Abstract:Potato plants (Solanum tuberosum cv. Ágata) exhibiting symptoms of leaf roll and interveinal chlorosis, especially on older leaves, were found in a commercial crop in the County of Cristalina, State of Goiás, Brazil in June 2011. The crop was severely infested by whitefly Bemisia tabaci biotype B. Four potato tubers from symptomatic plants were indexed for the presence of the following viruses: Tomato chlorosis virus (ToCV), Potato leaf roll virus (PLRV), Tomato severe rugose virus (ToSRV), and Potato virus Y (PVY). Total RNA was extracted separately from each tuber and used for reverse transcription (RT)-PCR using the HS-11/HS-12 primer pair, which amplifies a fragment of 587 bp from the highly conserved region of the heat shock protein (HSP-70) homolog gene reported for ToCV. The RT-PCR product was subsequently tested by nested-PCR for detection of ToCV with specific primers ToC-5/ToC-6 (2). Amplicons of 463 bp, amplified from total RNA separately extracted from three tubers, were purified and directly sequenced. Comparisons among the three consensus sequences of 448 bp (GenBank Accession Nos. JQ288896, JQ288897, and JQ288898) revealed respectively, 98, 100, and 100% identity with the reported sequence of a tomato isolate of ToCV from Brazil (GenBank Accession No. EU868927) (1). For ToSRV detection, total DNA was extracted from two tubers and a fragment of approximately 820 bp was amplified by PCR with specific primers (3). PLRV and PVY were indexed in two and three tubers, respectively, by double-antibody sandwich-ELISA (SASA, Edinburg, Scotland). Virus-free B. tabaci biotype B were separately transferred to potato and tomato leaves infected with ToCV for an acquisition access period of 24 h. Groups of 30 viruliferous whitefly were transferred to four, young, sprout-grown potato plants cv. Ágata (two plants per virus isolate) for 24-h inoculation access period. After 37 days of inoculation, one plant inoculated with the potato and tomato isolates of ToCV, respectively exhibited symptoms of leaf roll and interveinal chlorosis on order leaves, which were similar to that induced by PLRV. Experimental infection of potato plants with ToCV, which induced leaf roll symptoms resembling PLRV infection, was reported in the United States by Wisler et al. (4). The potato isolate of ToCV was also transmitted by B. tabaci to one of two inoculated tomato plants. The presence of ToCV in all inoculated plants was detected by nested-RT-PCR as described above. To our knowledge, this is the first report on detection of ToCV in field potato plants in the world. Considering that ToCV occurs in innumerous countries around the world, it is transmitted by a cosmopolitan insect, and it induces symptoms similar to PLRV, this finding triggers an alert to field dependent seed-potato multiplication, virus inspector, and certification system. References: (1) J. C. Barbosa et al. Plant Dis. 92:1709, 2008. (2) C. I. Dovas et al. Plant Dis. 86:1345, 2002. (3) F. R. Fernandes et al. Trop. Plant Pathol. 35:43, 2010. (4) G. C. Wisler et al. Plant Dis. 82:270, 1998.
Identification of potato pathogens using different diagnostic methods

Andrey Robertovich Puhaev,Irina Gazdanova

DOI: https://doi.org/10.32417/1997-4868-2024-24-08-1007-1017

2024-09-03

Agrarian Bulletin of the

Abstract:Abstract. Potato diseases have far reaching implications for the agricultural industry as they not only reduce productivity and quality of potato crop but also negatively affect the livelihood of farmers. The purpose of the studies detection and identification of potato phytopathogens by visual assessment, real time polymerase chain reaction (PCR) and molecular genetic screening for phytopathogen resistance genes. Methods. Visual evaluation of each potato variety for major fungal, viral and bacterial diseases was carried out during the period of full sprouting, at plant height of 15–20 cm and in the phase of full flowering. The percentage of plants affected by diseases in relation to the total number of inspected plants was calculated. Diagnosis of resistance of potato samples to diseases was carried out on the basis of PCR. DNA markers of phytopathogen resistance genes YES3-3A, RYSC3, Ry186, TG 689, Gro1-4-1, Gpa2-2, PVX were used for molecular screening of potato. Infection of samples by PCR-RV (real-time) was determined using reagent kits of Syntol LLC Potato Virus X and Potato Virus Y, Potato spindle tuber viroid-PB, Clavibacter michiganensis subsp. sepedonicus-PB, Dickeya spp-PB. Results. According to the results of visual evaluation, the absence of symptoms of wrinkle mosaic in 20% of hybrids, mottle mosaic in 40%, mosaic leaf curl in 96 %, leaf curl in 72 hybrids, black leg in 100%, phytophthorosis in 88% of hybrids, alternaria in 84 %, rhizoctoniosis in 96 % of hybrids were observed. According to the results of PCR-RV analysis in 21 samples detected virus Y. The scientific novelty consists in the diagnosis of potato viruses using traditional visual assessment with the use of molecular markers that allow to identify correlation relationship between trhis methods.
Identification and Pathogenicity of Fusarium Fungi Associated with Dry Rot of Potato Tubers

Olga Gavrilova,Aleksandra Orina,Ilya Trubin,Tatiana Gagkaeva

DOI: https://doi.org/10.3390/microorganisms12030598

IF: 4.5

2024-03-16

Microorganisms

Abstract:Dry rot of potato tubers is a harmful disease caused by species of the Fusarium genus. Studies on the composition and features of Fusarium spp. that cause the disease in Russia are limited. Thirty-one Fusarium strains belonging to the F. sambucinum species complex (FSAMSC) and F. solani species complex (FSSC) were accurately identified using multilocus phylogenetic analysis of the tef and rpb2 loci, and their physiological characteristics were studied in detail. As a result, 21 strains of F. sambucinum s. str. and 1 strain of F. venenatum within the FSAMSC were identified. Among the analyzed strains within the FSSC, one strain of F. mori, four strains of F. noneumartii, and two strains of both F. stercicola and F. vanettenii species were identified. This is the first record of F. mori on potato as a novel host plant, and the first detection of F. noneumartii and F. stercicola species in Russia. The clear optimal temperature for the growth of the strains belonging to FSAMSC was noted to be 25 °C, with a growth rate of 11.6–15.0 mm/day, whereas, for the strains belonging to FSSC, the optimal temperature range was between 25 and 30 °C, with a growth rate of 5.5–14.1 mm/day. The distinctive ability of F. sambucinum strains to grow at 5 °C has been demonstrated. All analyzed Fusarium strains were pathogenic to potato cv. Gala and caused extensive damage of the tuber tissue at an incubation temperature of 23 °C for one month. Among the fungi belonging to the FSAMSC, the F. sambucinum strains were more aggressive and caused 23.9 ± 2.2 mm of necrosis in the tubers on average compared to the F. venenatum strain—17.7 ± 1.2 mm. Among the fungi belonging to the FSSC, the F. noneumartii strains were the most aggressive and caused 32.2 ± 0.8 mm of necrosis on average. The aggressiveness of the F. mori, F. stercicola, and especially the F. vanettenii strains was significantly lower: the average sizes of damage were 17.5 ± 0.5 mm, 17.2 ± 0.2 mm, and 12.5 ± 1.7 mm, respectively. At an incubation temperature of 5 °C, only the F. sambucinum strains caused tuber necroses in the range of 6.7 ± 0.5–15.9 ± 0.8 mm.

microbiology
Macrophage depletion of mouse lung following inhalation of 239PuO2.

S. R. Moores,R. J. Talbot,N. Evans,B. Lambert

DOI: https://doi.org/10.2307/3576694

1986-03-01

Radiation Research

Abstract:Changes in the free-cell population of the lungs of two strains of mice (SAS/4 and CBA/H) were studied up to 4 months after inhalation exposure to a sized fraction of 239PuO2 particles (1.5 micron AMAD) to give initial alveolar depositions (IADs) ranging from 17 to 810 Bq. A sample of the free-cell population of the lung was recovered by bronchoalveolar lavage, and a radiometric method was used to estimate the total number of pulmonary alveolar macrophages (PAM) in the lung. The response of the lung to 239PuO2 was characterized by an initial, dose-dependent depression in the total number of PAM following an IAD as low as 50 Bq. At IADs greater than 150 Bq, the initial depression continued for longer, merging into a chronic phase in which the PAM were larger and were accompanied by a minor infiltration of leukocytes. These findings were confirmed by histology, which also revealed focal accumulations of Type II pneumocytes. The results indicate that inhaled alpha-emitting particles are effective at producing a depletion in the alveolar macrophage population at relatively low IADs and that chronic effects on the cells can be produced by higher concentrations.
First Report of Verticillium Wilt Caused by Verticillium dahliae on Mango Trees (Mangifera indica) in Southern Spain

L Baeza-Montañez,R Gómez-Cabrera,M D García-Pedrajas

DOI: https://doi.org/10.1094/PDIS-94-3-0380C

Abstract:Verticillium wilt, primarily caused by Verticillium dahliae Klebahn and V. albo-atrum Reinke & Berthold, affects a wide range of economically important crops. This disease is an increasing problem in areas where young mango trees are planted on land previously planted in vegetable crops. In 2008, symptoms of Verticillium wilt were observed in mango cvs. Kent and Osteen in the subtropical fruit-producing area of Málaga in southern Spain. In a new mango grove of cv. Kent, previously planted in potatoes and tomatoes, ~20% of 200 1-year-old trees had one-sided branch dieback. In many of these trees the symptoms expanded, leading to decline and eventual death. Cross sections of affected branches revealed brown vascular discoloration. Verticillium was isolated from surface-sterilized segments of symptomatic branches placed on acidic potato dextrose agar (PDA). Plates were incubated at 24°C. After 3 days, slow-growing colonies were transferred to PDA. Verticillium was similarly isolated from symptomatic potato plants grown in a nearby field. Identification of V. dahliae was initially based on morphology and further confirmed by molecular methods. All isolates tested produced microsclerotia, a defining feature that distinguishes V. dahliae from V. albo-atrum. For molecular characterization, V. dahliae specific primers 19 and 22 (1) and universal primers ITS1 and ITS4, which amplify the rRNA internal transcribed spacer (ITS) region (4), were used. Bands of expected size were amplified with both primer combinations. ITS fragments were sequenced and identical to the V. dahliae reference sequence (GenBank AY555948) (3). Pathogenicity assays were conducted with a selected isolate from mango using tomato plants from the susceptible line 'Moneymaker' and the near isogenic 'Motabo' line carrying the Ve gene conferring resistance to race 1 isolates. Five 1-month-old plants (four-leaf stage) were inoculated by root immersion in a suspension of 107 conidia/ml. Five control plants were mock inoculated with distilled water. As a positive control, five plants were inoculated with the previously described race 1 strain Dvd-T5 (2), which induces severe symptoms in susceptible tomato cultivars. Symptoms were scored visually at various time points up to 40 days by a 0 to 5 scale in which 0 = negligible chlorosis or wilting, 1 = chlorosis and wilting and/or curling in individual leaves, 2 = necrosis in leaves, 3 = at least one branch dead, 4 = wilt and/or chlorosis in upper leaves and/or two or more branches dead, and 5 = plant dead or all leaves and most of stem necrotic. The isolate from mango caused typical Verticillium wilt symptoms with a mean disease rating of 3.6 at 40 days postinoculation in both lines. The mean disease rating for Dvd-T5 in Moneymaker 40 days postinoculation was 4.0. V. dahliae was reisolated from symptomatic plants but not from noninoculated controls. To our knowledge, this is the first report of Verticillium wilt on mango in Spain. More problems with Verticillium wilt are expected because of the increasing planting of mango in fields previously dedicated to horticultural crops. References: (1) J. H. Carder et al. Modern Assays for Plant Pathogenic Fungi: Identification, Detection and Quantification. CAB International, Oxford, 1994. (2) K. F. Dobinson et al. Can. J. Plant. Pathol. 18:55, 1996. (3) M. P. Pantou et al. Mycol. Res. 109:889, 2005. (4) T. J. White et al. PCR Protocols: A Guide to Methods and Amplification. Academic Press, San Diego, 1990.
Medical futility decisions and physicians' legal defensiveness: the impact of anticipated conflict on thresholds for end-of-life treatment.

J. Swanson,S. Mccrary

DOI: https://doi.org/10.1016/0277-9536(95)00082-8

Social Science & Medicine (1967)

Abstract:
Potato apical leaf curl disease: current status and perspectives on a disease caused by tomato leaf curl New Delhi virus

Ravinder Kumar,Rahul Kumar Tiwari,Arjunan Jeevalatha,Sundaresha Siddappa,Mohd. Abas Shah,Sanjeev Sharma,Vinay Sagar,Manoj Kumar,Swarup Kumar Chakrabarti

DOI: https://doi.org/10.1007/s41348-021-00463-w

2021-04-13

Journal of Plant Diseases and Protection

Abstract:Potato apical leaf curl disease (PALCD) caused by a unique bipartite virus [tomato leaf curl New Delhi virus (ToLCNDV)] has emerged as a global threat. With the inception of ToLCNDV in 1995, it was causing curling/leaf mosaics in tomato, brinjal, chili, okra, papaya, cucurbits, etc., but under the changing climate, overlapping planting and boost-up in <i>Bemisia tabaci</i> populations, it shifted on potato crops. The first observation of PALCD as leaf curling/stunting of the potato plant was recorded in 1999 from northern India, and now it is spreading at an alarming rate in India. Recent outbreaks of ToLCNDV on various solanaceous, cucurbit crops, and weeds in other countries as well as the exchange of genetic and planting material of potato between the borders have made it a potential threat to potato production worldwide. To mitigate this disease, no antiviral products as well as resistant cultivars are known yet except Kufri Bahar; only planting of the healthy seed potato is the most appropriate method in the practice. The management of the disease mainly depends on diagnostics, control of insect vectors, rouging, and seed certification. These preventive measures are not enough to fulfill the food demand of the increasing population, and therefore, some concrete alternatives should be explored. In this context, the development of resistant varieties through conventional/molecular breeding or the use of advanced techniques like genome editing to edit susceptibility genes could be the future approach to combat the disease. This review highlights the current status of the pathogen and its genome, origin, evolution, and diversity, virus-vector relationship, disease symptoms, diagnostics, and management strategies.

plant sciences,agriculture, multidisciplinary
Gene Expression of Putative Pathogenicity-Related Genes in Verticillium dahliae in Response to Elicitation with Potato Extracts and during Infection Using Quantitative Real-Time PCR

Xiaohan Zhu,Arbia Arfaoui,Mohammad Sayari,Lorne R Adam,Fouad Daayf,Lorne R. Adam

DOI: https://doi.org/10.3390/pathogens10050510

IF: 3.7

2021-04-23

Pathogens

Abstract:Quantitative real-time PCR was used to monitor the expression of 15 Verticillium dahliae’s genes, putatively involved in pathogenicity, highly (HAV) and weakly aggressive (WAV) V. dahliae isolates after either (i) elicitation with potato leaf, stem, or root extracts, or (ii) inoculation of potato detached petioles. These genes, i.e., coding for Ras-GAP-like protein, serine/threonine protein kinase, Ubiquitin-conjugating enzyme variant-MMS2, NADH-ubiquinone oxidoreductase, Thioredoxin, Pyruvate dehydrogenase E1 VdPDHB, myo-inositol 2-dehydrogenase, and HAD-superfamily hydrolase, showed differential upregulation in the HAV versus WAV isolate in response to plant extracts or after inoculation of potato leaf petioles. This suggests their potential involvement in the observed differential aggressiveness between isolates. However, other genes like glucan endo-1,3-alpha-glucosidase and nuc-1 negative regulatory protein VdPREG showed higher activity in the WAV than in the HAV in response to potato extracts and/or during infection. This, in contrast, may suggest a role in their lower aggressiveness. These findings, along with future functional analysis of selected genes, will contribute to improving our understanding of V. dahliae’s pathogenesis. For example, expression of VdPREG negatively regulates phosphorus-acquisition enzymes, which may indicate a lower phosphorus acquisition activity in the WAV. Therefore, integrating the knowledge about the activity of both genes enhancing pathogenicity and those restraining it will provide a guild line for further functional characterization of the most critical genes, thus driving new ideas towards better Verticillium wilt management.

microbiology

Cholinergic system modulates growth, apoptosis, and secretion of cholangiocytes from bile duct-ligated rats.

Occurrence of Black Dot of Potato Caused by Colletotrichum coccodes in Central Italy

Virulence of Novel Ralstonia pseudosolanacearum (Phylotype I) Strains from Rose, Blueberry, and Mandevilla on Seed Potato

First report of Geotrichum candidum causing rubbery rot of potato (Solanum tuberosum) in Michigan

[Mechanism of acute complications in thyrotoxicosis].

Identification and comparison of biological characteristics and pathogenicity of different mating types of V. dahliae isolated from potato and sunflower

First Report of Potato virus Y in Potato in Tajikistan

First Report of Impatiens necrotic spot virus Infecting Greenhouse-Grown Potatoes in Washington State

Search for supernova-produced 60Fe in a marine sediment.

Bronchogenic carcinoma, a largely preventable lesion assuming epidemic proportions.

First Report of Rhizoctonia Solani AG-1-IB Infecting Potato with Stem Canker in Heilongjiang Province, China

The Hospital and Chapel of Saint Mary Roncevall at Charing Cross.

First Report of Fludioxonil-Resistant Isolates of Fusarium spp. Causing Potato Seed-Piece Decay

First Report of Tomato chlorosis virus in Potato in Brazil

Identification of potato pathogens using different diagnostic methods

Identification and Pathogenicity of Fusarium Fungi Associated with Dry Rot of Potato Tubers

Macrophage depletion of mouse lung following inhalation of 239PuO2.

First Report of Verticillium Wilt Caused by Verticillium dahliae on Mango Trees (Mangifera indica) in Southern Spain

Medical futility decisions and physicians' legal defensiveness: the impact of anticipated conflict on thresholds for end-of-life treatment.

Potato apical leaf curl disease: current status and perspectives on a disease caused by tomato leaf curl New Delhi virus

Gene Expression of Putative Pathogenicity-Related Genes in Verticillium dahliae in Response to Elicitation with Potato Extracts and during Infection Using Quantitative Real-Time PCR