[Mechanism of acute complications in thyrotoxicosis].

G. Gurevich

Abstract:

What problem does this paper attempt to address?

First Report of Potato virus Y in Potato in Tajikistan

O J Alabi,J M Crosslin,N Saidov,R A Naidu

DOI: https://doi.org/10.1094/PDIS-03-12-0249-PDN

Abstract:Potato (Solanum tuberosum L.) is widely grown as a staple food and cash crop in Tajikistan and is an important food security crop in the country. In June 2011, we conducted a survey of potatoes in farmers' fields in the Buston and Dushanbe regions (about 200 miles apart) of Tajikistan. Potato plants with stunted growth and leaves showing chlorotic spots, curling, and necrotic spots and rings were observed with the disease incidence monitored in 10 fields each in Buston and Dushanbe areas varying between 10 and 60%. Representative samples from symptomatic plants tested positive for Potato virus Y (PVY) using virus-specific immunostrips (Agdia Inc., Elkhart, IN). Leaf samples from symptomatic plants were collected from Buston and Dushanbe areas, imprinted on FTA Classic Cards (Whatman International Ltd., Maidstone, UK), air dried, and shipped to the lab at Washington State University for confirmatory diagnostic tests. Total nucleic acids were eluted from FTA cards (1) and subjected to reverse transcription (RT)-PCR with primers (PVY/Y4A and PVY/Y3S) specific to the coat protein of PVY (3). Samples infected with PVY ordinary strain (PVYO), tuber necrosis strain (PVYNTN), tobacco veinal necrosis strains (PVYEU-N and PVYNA-N), and a recombinant strain (PVYN:O) were included as references to validate RT-PCR results. A single DNA product of approximately 480 bp was amplified from potato samples that tested positive with PVY-specific immunostrips. The amplified fragments from two samples from Dushanbe and six from Buston areas were cloned separately into pCR2.1 (Invitrogen Corp., Carlsbad, CA) and two independent clones per amplicon were sequenced from both orientations. Pairwise comparison of these sequences showed 90 to 100% identity among the cloned amplicons (GenBank Accession Nos. JQ743609 to JQ743616) and 90 to 100% with corresponding nucleotide sequence of reference PVY strains (GenBank Accession Nos. JQ743617 to JQ743621). A global phylogenetic analysis of sequences revealed the presence of PVYO in both samples from Dushanbe and one sample from Buston regions and presence of PVYNTN in the remaining five samples from the Buston region. Because of the possible occurrence of mixed infections of PVY strains (2), further studies are needed to determine the presence of mixed infections of two or more strains of PVY and their specificity to potato cultivars. To our knowledge, this study represents the first confirmed report of two distinct strains of PVY in potato in Tajikistan. The occurrence of PVYNTN, a quarantine pathogen in many countries (2), warrants additional investigations to improve sanitary status of potato fields and to facilitate the availability of virus-free seed in clean plant programs for significant yield increases in Tajikistan. References: (1) O. J. Alabi et al. J. Virol. Methods 154:111, 2008. (2) S. Gray et al. Plant Dis. 94:1384, 2010. (3) R. P. Singh et al. J. Virol. Methods 59:189, 1996.
Prevalence, distribution and control of potato virus Y (PVY) strains in Kenyan potato cultivars

John Onditi,Moses Nyongesa,René van der Vlugt

DOI: https://doi.org/10.1007/s40858-022-00520-1

2022-08-03

Tropical Plant Pathology

Abstract:Potato virus Y (PVY) causes major yield losses in potato ( Solanum tuberosum L.) crops worldwide. Over the past few decades, two new PVY strains (PVY N−Wi/N:O and PVY NTN ) have become prevalent and widely distributed worldwide. In Kenya, there is limited information on the prevalence and distribution of PVY strains in potato cultivars grown in the farmer's fields. This is a major limiting factor in making decisions for setting up a basis for PVY control. This study was therefore conducted (a) to determine the present prevalence and distribution of the different PVY strains in cultivars grown in different potato-growing counties and (b) to use this knowledge on virus prevalence and distribution in proposing a strategy for PVY control. To this end, a leaf sampling survey was conducted in 354 potato farms in five major potato-growing counties in Kenya with follow-up surveys in two of the five counties for two more seasons. Collected leaf samples were tested using DAS-ELISA, and those found to be infected with PVY were subjected to reverse transcription polymerase chain reactions (RT-PCR) to determine the PVY strains. Overall PVY prevalence was generally low (8.2%). Out of all the PVY-infected plants, PVY N−Wi/N:O was the most prevalent strain (54.9%) followed by PVY O (28.0%) and PVY NTN (17.1%), while PVY N was not detected. The PVY N−Wi/N:O strain occurred across the three seasons and across the counties but only on specific cultivars. Three cultivars were identified as PVY resistant, and the most widely grown cultivar Shangi (60.2%) had only a low PVY prevalence of 0.6%. This is an indication that this cultivar may have already been useful in minimizing virus prevalence in farmer's fields. This report is the first prevalence survey of PVY strains and resistance; in addition, the results obtained provide a basis for a major focus on PVY resistance breeding in Kenya.

plant sciences
Potato virus Y; the Andean connection

Segundo Fuentes,Roger A C Jones,Hiroki Matsuoka,Kazusato Ohshima,Jan Kreuze,Adrian J Gibbs

DOI: https://doi.org/10.1093/ve/vez037

IF: 5.614

2019-07-01

Virus Evolution

Abstract:Abstract Potato virus Y (PVY) causes disease in potatoes and other solanaceous crops. The appearance of its necrogenic strains in the 1980s made it the most economically important virus of potatoes. We report the isolation and genomic sequences of 32 Peruvian isolates of PVY which, together with 428 published PVY genomic sequences, gave an alignment of 460 sequences. Of these 190 (41%) were non-recombinant, and 162 of these provided a dated phylogeny, that corresponds well with the likely history of PVY, and show that PVY originated in South America which is where potatoes were first domesticated. The most basal divergences of the PVY population produced the N and C: O phylogroups; the origin of the N phylogroup is clearly Andean, but that of the O and C phylogroups is unknown, although they may have been first to establish in European crops. The current PVY population originated around 156 CE. PVY was probably first taken from South America to Europe in the 16th century in tubers. Most of the present PVY diversity emerged in the second half of the 19th century, after the Phytophthora infestans epidemics of the mid-19th century destroyed the European crop and stimulated potato breeding. Imported breeding lines were shared, and there was no quarantine. The early O population was joined later by N phylogroup isolates and their recombinants generated the R1 and R2 populations of damaging necrogenic strains. Our dating study has confirmed that human activity has dominated the phylodynamics of PVY for the last two millennia.

virology
Macrophage depletion of mouse lung following inhalation of 239PuO2.

S. R. Moores,R. J. Talbot,N. Evans,B. Lambert

DOI: https://doi.org/10.2307/3576694

1986-03-01

Radiation Research

Abstract:Changes in the free-cell population of the lungs of two strains of mice (SAS/4 and CBA/H) were studied up to 4 months after inhalation exposure to a sized fraction of 239PuO2 particles (1.5 micron AMAD) to give initial alveolar depositions (IADs) ranging from 17 to 810 Bq. A sample of the free-cell population of the lung was recovered by bronchoalveolar lavage, and a radiometric method was used to estimate the total number of pulmonary alveolar macrophages (PAM) in the lung. The response of the lung to 239PuO2 was characterized by an initial, dose-dependent depression in the total number of PAM following an IAD as low as 50 Bq. At IADs greater than 150 Bq, the initial depression continued for longer, merging into a chronic phase in which the PAM were larger and were accompanied by a minor infiltration of leukocytes. These findings were confirmed by histology, which also revealed focal accumulations of Type II pneumocytes. The results indicate that inhaled alpha-emitting particles are effective at producing a depletion in the alveolar macrophage population at relatively low IADs and that chronic effects on the cells can be produced by higher concentrations.
Dynamics of Potato Virus Y Infection Pressure and Strain Composition in the San Luis Valley, Colorado

Jeremy Daniel,Mohamad Chikh-Ali

DOI: https://doi.org/10.1094/PDIS-10-23-2166-SR

Abstract:The San Luis Valley (SLV), Colorado, is the second-largest fresh-potato-growing region in the United States, which accounts for about 95% of the total production in Colorado. Potato virus Y (PVY) is the leading cause of seed potato rejection in the SLV, which has caused a constant decline in seed potato production over the past two decades. To help potato growers control PVY, we monitored the dynamics of PVY infection pressure over the growing seasons of 2022 and 2023 (May through August) using tobacco bait plants exposed to field infection weekly. PVY infection dynamics were slightly different between the two seasons, but July and August had the highest infection in both years. The first PVY infection was detected in the second half of June, which coincides with the emergence of potato crops in the valley. PVY infection increased toward the beginning of August and declined toward the end of the season. Three PVY strains were identified in tobacco bait plants and potato fields, namely PVYO, PVYN-Wi, and PVYNTN. Unlike other producing areas of the United States, PVYO is still the major strain infecting potato crops in Colorado, comprising ∼40% of total PVY strain composition. This could be explained by the prevalence of the potato cultivar Russet Norkotah that lacks any identified N genes, including the Nytbr that controls PVYO, which imposes no negative selection against this strain. The current study demonstrated the usefulness of bait plants to understand PVY epidemiology and develop more targeted control practices of PVY.
Molecular Footprints of Potato Virus Y Isolate Infecting Potatoes (Solanum tuberosum) in Kenya

Maryrose Nyakio,Mariam Were,Clabe Wekesa,Henry Lungayia,Patrick Okoth,Hassan Were

DOI: https://doi.org/10.1155/2024/2197725

2024-08-06

Abstract:Potato virus Y (PVY) is a highly diverse and genetically variable virus with various strains. Differential evolutionary routes have been reported in the genus Potyvirus, caused by natural selection pressure, mutation, and recombination, with their virulence being dependent on different environmental conditions. Despite its significance and economic impact on Solanaceous species, the understanding of PVY's phylogeography in Kenya remains limited and inadequately documented. The study centers on the molecular characterization of a Kenyan PVY isolate, GenBank accession number PP069009. In-depth phylogenetic analysis unveiled a strong evolutionary association between the Kenyan isolate and isolate [JQ924287] from the United States of America, supported by a robust 92% probability. Recombinant analyses exposed a mosaic-like genetic architecture within the Kenyan isolate, indicating multiple gene recombination events. Selection pressure scrutiny identified specific sites under selective pressure, with evidence of positive/diversifying and negative/purifying selection. Population genetics analysis revealed a calculated nucleotide diversity (π) of 0.00354881, while analysis of molecular variance (AMOVA) unveiled a structured genetic landscape with an øST value of 0.45224. The extensive haplotype network depicted the possibility of diverse PVY strains occurring across continents. This analysis provides valuable insights into the genetic diversity and distribution of PVY globally, highlighting the importance of understanding evolutionary dynamics for effective management and control strategies of PVY on a global scale.
Muscle Synergy-based Grasp Classification for Robotic Hand Prosthetics

Sezen Yagmur Günay,F. Quivira,Deniz Erdoğmuş

DOI: https://doi.org/10.1145/3056540.3076208

2017-06-21

Abstract:The main goal of this study is analyzing whether muscle synergies based on surface electromyography (EMG) measurements could be used for hand posture classification in the context of robotic prosthetic control. Target grasps were selected according to usefulness in daily activities. Additionally, due to the feasibility constraints of robotic prosthetics, only 14 gestures (13 feasible grasps and 1 resting state) were analyzed. EMG signals of intact-limb subjects were decomposed into base and activation components for muscle activity evaluation. The results demonstrate that features based on muscle synergies derived from non-negative matrix factorization (NMF) outperform the ones derived from principal component analysis (PCA). Moreover, we also examine the robustness of these methods in the absence of electrodes (muscle importance) and show that NMF is able to provide sufficiently accurate results.
Resistance of Potato Cultivars as a Determinant Factor of Potato virus Y (PVY) Epidemiology

B. Dupuis,C. Bragard,O. Schumpp

DOI: https://doi.org/10.1007/s11540-018-9401-4

2018-10-02

Potato Research

Abstract:Potato virus Y (PVY) is considered the most economically damaging virus for seed-potato production. PVY isolates are usually divided into three historical PVY strains, namely PVYC, PVYO and PVYN. More recently, recombinant strains named PVYNTN and PVYN-Wi appeared in Europe and North America, rapidly spread into seed-potato production and gradually replaced historical strains. This progression can be explained by several factors, including the differential susceptibility of cultivars to PVY strains. This article presents the results of a Swiss survey of PVY strains conducted in 2012 in which the progressive increase of the prevalence of PVYN-Wi was observed. The occurrence of PVY strains in the two main potato cultivars grown in Switzerland, cv. Agria and cv. Charlotte, is described through the 2012 survey and one additional PVY strain survey conducted in 2014. Both surveys were completed with a mechanical-inoculation assay. The inoculation assay showed that cv. Agria is more susceptible to PVYN-Wi than to PVYNTN, whereas cv. Charlotte is susceptible to both strains. The inoculation assay also showed that the expression of symptoms on cultivars is strain-dependent. These results stress the major role of the resistance profile of cultivars to explain the balance of the PVY strains in potato crops.

agronomy
Distribution and species composition of potato viruses in the Novosibirsk region

V S Maslennikova,M B Pykhtina,K A Tabanyukhov,E V Shelikhova,K I Mosalev,A V Katokhin,A A Bondar,A B Beklemishev,M I Voevoda

DOI: https://doi.org/10.18699/vjgb-24-61

Abstract:Among the many diseases that affect potato plants, viral infections are the most common and cause significant damage to farms, affecting both the yield and quality of potatoes. In this regard, an important condition for preserving the potato seed fund in Russia is systematic monitoring and early highly specific detection of potato viral infections. The purpose of the work is to study samples of potato varieties collected in the Novosibirsk region for the presence of viral infections using RT-PCR. 130 potato plants from three districts of the Novosibirsk region (NR) were studied. As a result of monitoring, the following viruses were identified: PVY (potato virus Y), PVS (potato virus S), PVM (potato virus M) and PVX (potato virus X). The quarantine pathogen potato spindle tuber viroid (PSTVd) was not detected in any of the samples analyzed. The maximum frequency of occurrence in the region was noted for three viruses: PVY, PVM and PVS. A significant proportion of the samples were mixed viral infections: the occurrence of the combination of infection PVY + PVM in plants was 25.0 %, and PVY + PVS, 22.6 %. To develop methods for determining the strain affiliation of the studied samples, the nucleotide sequences of the capsid protein genes of 10 Y-virus isolates were sequenced. Phylogenetic analysis of the studied sequences of NR isolates was carried out with a set of sequences of reference strains 261-4, Eu-N, N:O, NE-11, NTNa, NTNb, N-Wi, O, O5, SYR_I, SYR_II and SYR_III retrieved from GenBank. As a result of phylogenetic analysis, it was established that NR viral samples fell into two groups of strains: group 1, which also includes isolates of the reference strains 261-4/SYR_III, and group 2, NTNa. The obtained results of the strain affiliation of NR samples lay the basis for the development of DNA and immunodiagnostic systems for identifying PVY circulating in NR, as well as for elucidating the source and routes of entry of specific virus strains.Key words: Solanum tuberosum; viral infections; RT-PCR; potato Y virus; phylogenetic analysis.
Three Sensitive and Reliable Serological Assays for Detection of Potato Virus A in Potato Plants

Wu Jia-yu,Zhang Yu,Zhou Xue-ping,Qian Ya-juan

DOI: https://doi.org/10.1016/s2095-3119(20)63492-x

2021-01-01

Abstract:Vegetative propagation of seed potato often allows passaging of viruses to seed tubers, resulting in significant yield losses and reduction of potato tuber quality. Thus, virus detection approach is crucial for effective virus management programs and the production of virus-free seed potatoes. Among the reported potato-infecting viruses, potato virus A (PVA) is considered as one of the most important viruses in potato-growing regions worldwide. This study prepared four hybridoma lines secreting PVA-specific monoclonal antibodies (MAbs) (2D4, 8E11, 14A6 and 16H10) using purified PVA virions as an immunogen. Western blotting results indicated that all the four MAbs reacted strongly and specifically with the putative capsid protein of PVA. Using these four MAbs, this study developed antigen-coated plate enzyme-linked immunosorbent assay (ACP-ELISA), Dot-ELISA and Tissue print-ELISA for detection of PVA infection in potato plants. The results indicated that PVA can be detected in crude tissue extracts from infected potato plants diluted up to 1:327680 (w/v, g mL–1) by ACP-ELISA or up to 1:10240 by Dot-ELISA. The Tissue print-ELISA is the quickest and easiest approach among the three serological assays, and is more suitable for onsite large-scale potato screening programs. Further analyses of field-collected potato samples showed that the sensitivities and specificities of the three serological approaches were similar to those of RT-PCR in PVA detection and confirmed that PVA is currently widespread in Yunnan and Zhejiang provinces of China. Hence, the results strongly suggest that these highly sensitive serological approaches based on PVA-specific MAbs are useful and powerful for PVA-free seed potato production programs and PVA field surveys.
Differential Spread of Potato virus Y (PVY) Strains O, N:O and NTN in the Field: Implications for the Rise of Recombinant PVY Strains in New Brunswick, Canada

Tyler D. B. MacKenzie,Jacques Lavoie,Xianzhou Nie,Mathuresh Singh

DOI: https://doi.org/10.1007/s12230-018-9632-6

2018-01-16

American Journal of Potato Research

Abstract:Potato virus Y (PVY) is a major cause of yield and quality loss in potato crops worldwide. Recently, populations of PVY strains have shifted dramatically toward recombinant strains such as PVYNTN and PVYN:O. A 2010 to 2016 survey of PVY strains in commercial fields of New Brunswick (NB), Canada, and five field trials tracking PVY spread in NB and Manitoba, were conducted to study the current status of PVY strains and their relative rates of spread. In NB, PVYO dropped from 82% of infections in 2010 to 14% in 2016, replaced mostly by PVYNTN (64%) and PVYN:O (22%).In field trials with Russet Burbank and Gold rush varieties, PVYNTN spread most effectively compared to PVYN:O and PVYO. Strain-specific PVY spread varied with the potato variety, possibly due to selective PVYO resistance in Goldrush, mostly expressed at the plant-to-plant transmission level with little difference in transduction to tubers in infected plants. Relevance of in-field differences in spread of strains to changes in regional PVY populations, and potential mechanisms responsible, are discussed.
Identification of Potato virus Y strains in infected potato plants from some places of Heilongjiang Province

Hongyi LIU,Wusheng LIANG,Zhongmei LIU,Hongxiang ZHANG,Liqun YANG

DOI: https://doi.org/10.3969/j.issn.1005-9369.2014.01.008

2014-01-01

Abstract:Some potato plant samples potentially infected by Potato virus Y(PVY) were collected from the fields in Keshan, Nehe, Wudalianchi and Beian of Heilongjiang Province, China. Total RNA was extracted from the leaves of the samples. Reverse transcription, PCR and pyrosequencing were carried out with the primers designed and testified previously to identify the PVY strains in the samples. The sequencing results indicated that two samples from Keshan were infected by PVYN:Oand PVYN- Wi, respectively; two samples from Nehe both were infected by PVYN- Wi; two samples from Wudalianchi were infected by PVYN:Oand PVYN-Wi, respectively; and one sample from Beian was infected by PVYN-Wi. Taken together with the PVY strains previously identified from nine potato plant samples collected from Heilongjiang Province, the research results indicated that potato plants in Heilongjiang Province had been infected by at least four PVY strains(PVYN- Wi, PVYN:O, PVYNTNand PVYN). Furthermore, as PVYN- Wi was detected in seven of the 16 identified samples, but each of the three rest strains was only detected in three identified samples, respectively, and PVYN- Wiwas probably the predominant one of the four strains.
Dynamics of PVY strains in field grown potato: Impact of strain competition and ability to overcome host resistance mechanisms

Kim Davie,Ross Holmes,Jon Pickup,Christophe Lacomme

DOI: https://doi.org/10.1016/j.virusres.2017.06.012

IF: 6.286

2017-09-01

Virus Research

Abstract:Potato virus Y (PVY) is the most important viral pathogen affecting potato crops worldwide. PVY can be transmitted non-persistently by aphids that do not colonize the host plant, resulting in a rapid acquisition and transmission of the virus between plants. PVY exists as a complex of strains that can be distinguished according to their pathogenicity, serology and genomic analysis. While virus incidence remains low in Scottish seed potato crops, PVY has become the increasingly prevalent virus. The monitoring of PVYN and PVYO serotypes has revealed a recent shift towards PVYN which now accounts for more than 90% of all PVY cases. A survey of the molecular diversity of PVYN isolates indicated that 80%-90% belong to the recombinant European (EU)-NTN group, with North-American (NA)-NTN and non-recombinant EU-N variants accounting for the remainder. The shift from non-recombinant to recombinant PVY isolates is a common trend observed worldwide. Surveys of a range of PVY isolates representing the main strain and phylogenetic groups suggest that PVY has the ability to overcome hypersensitive response-mediated resistance with significant differences between isolates of the same strain group. Contrastingly, genes mediating extreme resistance (Ryadg, Rysto) provide efficient resistance to PVY transmission to progeny tubers. Transmission experiments in field conditions of PVY isolates representing the three main molecular groups (PVYO, PVYEU-NTN, PVYNA-NTN) indicate that PVYEU-NTN has the highest transmission rate. Our results suggest that PVYEU-NTN isolate has a competitive advantage over PVYO and PVYNA-NTN isolates which is likely to be an important factor in shaping the evolution of viruses and the population dynamics of PVY.

virology
A Novel Recombined Potato virus Y Isolate in China

Shuxin Han,Yanling Gao,Guoquan Fan,Wei Zhang,Cailing Qiu,Shu Zhang,Yanju Bai,Junhua Zhang,Carl Spetz

DOI: https://doi.org/10.5423/PPJ.OA.09.2016.0189

Abstract:This study reports the findings of a distinct Potato virus Y (PVY) isolate found in Northeast China. One hundred and ten samples (leaves and tubers) were collected from potato plants showing mosaic symptoms around the city of Harbin in Heilongjiang province of China. The collected tubers were planted and let to grow in a greenhouse. New potato plants generated from these tubers showed similar symptoms, except for one plant. Subsequent serological analyses revealed PVY as the causing agent of the disease. A novel PVY isolate (referred to as HLJ-C-44 in this study) was isolated from this sample showing unique mild mosaic and crisped leaf margin symptoms. The complete genome of this isolate was analyzed and determined. The results showed that HLJ-C-44 is a typical PVY isolate. Phylogenetic analysis indicated that this isolate belongs to the N-Wi strain group of PVY recombinants (PVYN-Wi) and also shared the highest overall sequence identity (nucleotide and amino acid) with other members of this strain group. However, recombination analysis of isolate HLJ-C-44 revealed a recombination pattern that differed from that of other PVYN-Wi isolates. Moreover, biological assays in four different potato cultivars and in Nicotiana tabacum also revealed a different phenotypic response than that of a typical PVYN-Wi isolate. This data, combined, suggest that HLJ-C-44 is a novel PVY recombinant with distinct biological properties.
The movement of potato virus Y (PVY) in the vascular system of potato plants

Brice Dupuis

DOI: https://doi.org/10.1007/s10658-016-1008-5

2016-08-10

European Journal of Plant Pathology

Abstract:Potato virus Y (PVY) is responsible for major viral diseases in most potato seed areas. It is transmitted by aphids in a non-persistent manner, and it is spread in potato fields by the winged aphids flying from an infected source plant to a healthy one. Six different PVY strains groups affect potato crops: PVYC, PVYN, PVYO, PVYN:O, PVYNTN, and PVYN-Wi. Nowadays, PVYNTN and PVYN-Wi are the predominant strains in Europe and the USA. After the infection of the leaf and accumulation of the virus, the virus is translocated to the progeny tubers. It is known that PVYN is better translocated than PVYO, but little is known about the translocation of the other PVY strains. The translocation of PVY occurs faster in young plants than in old plants; this mature plant resistance is generally explained by a restriction of the cell-to-cell movement of the virus in the leaves. The mother tuber may play an important role in explaining mature plant resistance. PVY is able to pass from one stem to the other stems of the same plant through the vascular system of the mother tuber, but it is unknown whether this vascular link between stems is permanent during the whole life of the plant. Two greenhouse trials were set up to study the spread of PVY in the vascular system of the potato plant. The PVY-susceptible cultivar Charlotte was used for both trials. It was demonstrated that all stems growing from a PVY-infected tuber will become infected sooner or later, and that PVYN-Wi translocates more efficiently to progeny tubers than PVYNTN. It was also demonstrated that the progressive decay of the mother tuber in the soil reduces the possibility for virus particles to infect healthy stems through the vascular system of the mother tuber. This new element contributes to a better understanding of the mechanism of mature plant resistance.

plant sciences,horticulture,agronomy
First Report of Impatiens necrotic spot virus Infecting Greenhouse-Grown Potatoes in Washington State

J M Crosslin,L L Hamlin

DOI: https://doi.org/10.1094/PDIS-07-10-0542

Abstract:In April and May 2010, leaves on approximately one-half of 200 potato (Solanum tuberosum L. cv. Atlantic) plants, 20 to 25 cm high, grown from prenuclear minitubers in greenhouses located at the USDA-ARS facility in Prosser, WA exhibited necrotic spots similar to those produced by the early blight pathogen, Alternaria solani. Fungicide sprays did not reduce incidence of the symptoms. Observations associated the symptoms with thrips feeding damage so plants were tested for Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) with ImmunoStrips from Agdia, Inc (Elkhart, IN). Three of three, two of two, and two of two symptomatic plants from three greenhouses were positive for INSV and negative for TSWV. Two symptomless plants tested negative. Four of four symptomatic and zero of two symptomless plants were positive by reverse transcription (RT)-PCR with INSV specific primers (forward: 5' TAACACAACACAAAGCAAACC 3' and reverse: 5' CCAAATACTACTTTAACCGCA 3') (4). The 906-bp amplicon from one sample was cloned and three clones were sequenced. The three clones were 99.7% identical, and BLAST analysis of the consensus sequence (GenBank Accession No. HM802206) showed 99% identity to INSV accessions D00914 and X66972, and 98% identity to other INSV isolates. The isolate, designated INSV pot 1, was mechanically inoculated to one plant of potato cv. GemStar and produced local, spreading necrotic lesions. The virus did not go systemic, as determined by RT-PCR of upper leaves 30 days after inoculation. The local necrotic lesions on GemStar were positive for INSV by ImmunoStrips and RT-PCR. The original source of the INSV inoculum is unknown. However, hairy nightshade (Solanum sarrachoides Sendtn.) and plantain (Plantago major L.) weeds in an ornamental planting near one of the affected greenhouses tested positive for INSV by ImmunoStrips. The nightshade showed obvious thrips feeding damage but no obvious virus symptoms while the plantain showed less thrips feeding damage but distinct necrotic rings. Subsequently, two of two symptomatic potato plants of cv. Desiree in another greenhouse near the initial site tested INSV positive with the ImmunoStrips. In addition to the necrotic lesions on leaves observed in cv. Atlantic, these plants also showed necrosis of petioles and stems. INSV is transmitted by a number of species of thrips, but the western flower thrips (Frankliniella occidentalis Perg.) is considered the most important under greenhouse conditions. The species of thrips in the affected greenhouses was not determined before all materials were discarded. Both INSV and the thrips vector have large host ranges including many crops and weeds, and have become increasingly important in recent years (1,2). INSV was reported on greenhouse-grown potatoes in New York in 2005 (3). These findings indicate INSV can be a major problem in greenhouse potatoes, whether for research purposes or production of virus-free minitubers destined for field plantings. References: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997. (2) R. A. Naidu et al. Online publication. doi:10.1094/PHP-2005-0727-01-HN, Plant Health Progress, 2005. (3) K. L. Perry et al. Plant Dis. 89:340, 2005. (4) K. Tanina et al. Jpn. J. Phytopathol. 67:42, 2001. ERRATUM: A correction was made to this Disease Note on September 7, 2012. The forward and reverse INSV specific primer sequences were corrected.
Monoclonal Antibody-Based Serological Assays for Detection of Potato Virus S in Potato Plants.

Ge Song,Jia-yu Wu,Yan Xie,Yong Liu,Ya-juan Qian,Xue-ping Zhou,Jian-xiang Wu

DOI: https://doi.org/10.1631/jzus.b1600561

2017-01-01

Journal of Zhejiang University SCIENCE B

Abstract:Potato virus S (PVS) often causes significant losses in potato production in potato-growing countries. In this study, the ordinary strain of PVS (PVSO) was purified from PVS-infected potato plants and used as the immunogen to produce hybridomas secreting monoclonal antibodies (MAbs). Five highly specific and sensitive murine MAbs (1A3, 16C10, 18A9, 20B12, and 22H4) against PVS were prepared using conventional hybridoma technology. Using these MAbs, tissue print-enzyme-linked immunosorbent assay (ELISA), dot-ELISA, and double-antibody sandwich (DAS)-ELISA were developed for sensitive and specific detection of PVS infection in potato plants. The results of sensitivity assays revealed that PVS could be reliably detected in PVS-infected leaf crude extracts diluted at 1:10 240 and 1:163 840 (w/v, g/ml) in phosphate buffer saline (PBS) by dot-ELISA and DAS-ELISA, respectively. Twenty-two samples collected from potato fields in Yunnan Province, China were tested for PVS infection using the serological assays we had developed, and 14 of them were found to be positive. This indicates that PVS is now prevalent in potato fields in Yunnan Province.
Estimates of use and costs of behavioural health care: a comparison of standard and finite mixture models.

P. Deb,Ann M. Holmes

DOI: https://doi.org/10.1002/1099-1050(200009)9:6<475::AID-HEC544>3.0.CO;2-H

IF: 2.395

2000-09-01

Health Economics

Abstract:Estimates of health care demand are known to depend on the empirical specification used in the analysis. In this paper, an innovative specification, the finite mixture model (FMM), is employed to estimate the utilization of and expenditures on behavioural health care. Unlike standard specifications, the FMM has the ability to distinguish between distinct classes of users of behavioural health care (e.g. the 'worried well' and the severely mentally ill). This new model is tested against standard empirical specifications using data from the National Medical Expenditure Survey. Using common risk stratifiers, estimates of utilization and costs are generated with each specification. It is found that the FMM provides a much better fit of both expenditure and utilization data than standard specifications, particularly among high intensity users that standard models have been unable to represent adequately. Furthermore, the results provide preliminary evidence that there are (at least) two distinct groups of users of behavioural health care. The empirical advantages of the FMM translate into superior estimates of mean costs and utilization that have widespread application in rate-setting exercises.
Importance and control of potato virus YN (PVYN) in seed potato production

H. L. Weidemann

DOI: https://doi.org/10.1007/bf02360024

1988-03-01

Potato Research

Abstract:The tobacco veinal necrosis strain of potato virus Y (PVYN) first became epidemic in several European countries in the 1950s. To prevent PVYN-infections, account must be taken of virus sources both within and without potato fields; for forecasting, the aphid vector species, their vector efficiency, and their flight activity must all be known. Well-timed haulm destruction needs knowledges of PVYN-translocation in potato plants and of the development of mature plant resistance. For successful virus control, also reliable methods for virus detection are needed, and for this ELISA has been well established for many years in seed potato certification schemes. A combined treatment of mineral oil and pyrethroids reduces aphid populations and the spread of stylet-borne viruses in the fields. In breeding for resistance, the major gene Ry induces complete protection against infections of all known PVY-strains.

agronomy
Changes in phytohormone levels and gene expression of potato plants in response to potato virus Y and a nonvector insect

GE Yang,ZHONG Jian,ZHANG Yadong,HE Xiaoli,LIU Lining,Asim MUNAWAR,MAO Lijuan,ZHU Zengrong,XU Yi,ZHOU Wenwu

DOI: https://doi.org/10.3785/j.issn.1008-9209.2022.03.301

2023-01-01

Abstract:Potato virus Y（PVY） and its nonvector insect of potato tuber moth（Phthorimaea operculella） are important disease and pest in global potato industry. In order to investigate whether PVY infection changed the physiological responses of potato plant to P. operculella, we studied performances of P. operculella on PVY-infected and non-infected healthy plants, and carried out the phytohormone analysis and comparative transcriptomic analysis for potato leaves which were affected by PVY infection and herbiory stimuli（dealing with the oral secretions of potato tuber moth）, or co-stressed treatment. The results showed that the resistance to P. operculella was significantly increased in potato plants infected by PVY. Moreover, PVY infection also inhibited the increase of abscisic acid induced by herbivory stimuli. Compared with the healthy control plants, herbivory stimuli and PVY infection treatments produced 3 998 and 104 differentially expressed genes（DEGs）, respectively; while 9 178 DEGs were induced by co-stressed treatment, suggesting that the co-stressed treatment may greatly affected the physiological responses in potato plants. Compared with the herbivory stimuli, the co-stressed plants had 743 DEGs, and many of them belong to the transferase activity, the protein processing in endoplasmic reticulum, and the phenylpropanoid biosynthesis pathways. And the expression levels of many genes in abscisic acid synthesis pathway were also down-regulated, which was consisted with the change of this phytohormone. In summary, this study systematically analyzed the physiological responses of potato plant confronted by the single-and co-stressed treatments of PVY infection and herbivory stimuli, which may provide scientific basis for exploring plant-virus-nonvector insect interactions.

[Mechanism of acute complications in thyrotoxicosis].

First Report of Potato virus Y in Potato in Tajikistan

Prevalence, distribution and control of potato virus Y (PVY) strains in Kenyan potato cultivars

Potato virus Y; the Andean connection

Macrophage depletion of mouse lung following inhalation of 239PuO2.

Dynamics of Potato Virus Y Infection Pressure and Strain Composition in the San Luis Valley, Colorado

Molecular Footprints of Potato Virus Y Isolate Infecting Potatoes (Solanum tuberosum) in Kenya

Muscle Synergy-based Grasp Classification for Robotic Hand Prosthetics

Resistance of Potato Cultivars as a Determinant Factor of Potato virus Y (PVY) Epidemiology

Distribution and species composition of potato viruses in the Novosibirsk region

Three Sensitive and Reliable Serological Assays for Detection of Potato Virus A in Potato Plants

Differential Spread of Potato virus Y (PVY) Strains O, N:O and NTN in the Field: Implications for the Rise of Recombinant PVY Strains in New Brunswick, Canada

Identification of Potato virus Y strains in infected potato plants from some places of Heilongjiang Province

Dynamics of PVY strains in field grown potato: Impact of strain competition and ability to overcome host resistance mechanisms

A Novel Recombined Potato virus Y Isolate in China

The movement of potato virus Y (PVY) in the vascular system of potato plants

First Report of Impatiens necrotic spot virus Infecting Greenhouse-Grown Potatoes in Washington State

Monoclonal Antibody-Based Serological Assays for Detection of Potato Virus S in Potato Plants.

Estimates of use and costs of behavioural health care: a comparison of standard and finite mixture models.

Importance and control of potato virus YN (PVYN) in seed potato production

Changes in phytohormone levels and gene expression of potato plants in response to potato virus Y and a nonvector insect