Abstract:Approximately 3 billion people world-wide are exposed to air pollution from biomass burning. Herein, particulate matter (PM) emitted from artisanal cashew nut roasting, an important economic activity worldwide, was investigated. This study focused on: i) chemical characterization of polycyclic aromatic hydrocarbons (PAHs) and oxygenated (oxy-) PAHs; ii) intracellular levels of reactive oxygen species (ROS); iii) genotoxic effects and time- and dose-dependent activation of DNA damage signaling, and iv) differential expression of genes involved in xenobiotic metabolism, inflammation, cell cycle arrest and DNA repair, using A549 lung cells. Among the PAHs, chrysene, benzo[a]pyrene (B[a]P), benzo[b]fluoranthene, and benz[a]anthracene showed the highest concentrations (7.8-10 ng/m3), while benzanthrone and 9,10-anthraquinone were the most abundant oxy-PAHs. Testing of PM extracts was based on B[a]P equivalent doses (B[a]Peq). IC50 values for viability were 5.7 and 3.0 nM B[a]Peq at 24 h and 48 h, respectively. At these low doses, we observed a time- and dose-dependent increase in intracellular levels of ROS, genotoxicity (DNA strand breaks) and DNA damage signaling (phosphorylation of the protein checkpoint kinase 1 - Chk1). In comparison, effects of B[a]P alone was observed at micromolar range. To our knowledge, no previous study has demonstrated an activation of pChk1, a biomarker used to estimate the carcinogenic potency of PAHs in vitro, in lung cells exposed to cashew nut roasting extracts. Sustained induction of expression of several important stress response mediators of xenobiotic metabolism (CYP1A1, CYP1B1), ROS and pro-inflammatory response (IL-8, TNF-α, IL-2, COX2), and DNA damage response (CDKN1A and DDB2) was also identified. In conclusion, our data show high potency of cashew nut roasting PM to induce cellular stress including genotoxicity, and more potently when compared to B[a]P alone. Our study provides new data that will help elucidate the toxic effects of low-levels of PAH mixtures from air PM generated by cashew nut roasting.

Outdoor charcoal combustion in barbecue grills: Potential cytotoxic, oxidative stress and mutagenic effects

Toxicological and Mutagenic Effects of Particulate Matter from Domestic Activities

Biochar dust emission: Is it a health concern? Preliminary results for toxicity assessment

Emission characteristics and quantitative assessment of the health risks of cooking fumes during outdoor barbecuing

Health benefits from substituting raw biomass fuels for charcoal and briquette fuels: In vitro toxicity analysis

In vitro toxicity and lung cancer risk: Atmospheric particulate matter from a city in southeastern Brazil impacted by biomass burning

Compositional Characteristics and Toxicological Responses of Human Lung Epithelial Cells to Inhalable Particles (PM10) from Ten Typical Biomass Fuel Combustions

Biological Impact of Organic Extracts from Urban-Air Particulate Matter: An In Vitro Study of Cytotoxic and Metabolic Effects in Lung Cells

Characterization and cytotoxicity of PAHs in PM2.5 emitted from residential solid fuel burning in the Guanzhong Plain, China

Polycyclic Aromatic Hydrocarbons in Foods: Biological Effects, Legislation, Occurrence, Analytical Methods, and Strategies to Reduce Their Formation

Review of polycyclic aromatic hydrocarbons pollution characteristics and carcinogenic risk assessment in global cooking environments

Health impacts of biomass burning aerosols: Relation to oxidative stress and inflammation

Genotoxicity and DNA damage signaling in response to complex mixtures of PAHs in biomass burning particulate matter from cashew nut roasting

Emission of fine organic aerosol from traditional charcoal broiling in China

Toxicity of particles derived from combustion of Ethiopian traditional biomass fuels in human bronchial and macrophage-like cells

Assessing the Effect of Reactive Oxygen Species and Volatile Organic Compound Profiles Coming from Certain Types of Chinese Cooking on the Toxicity of Human Bronchial Epithelial Cells

Release of Polycyclic Aromatic Hydrocarbons from Biochar Fine Particles in Simulated Lung Fluids: Implications for Bioavailability and Risks of Airborne Aromatics.

Assessment on the Personal Exposure Risk Associated With Real‐Time Indoor PM2.5 in Different Microenvironments

Particulate matter from a tropical city in southeast Brazil: Impact of biomass burning on polycyclic aromatic compounds levels, health risks, and in vitro toxicity

Oxidative potential of the inhalation bioaccessible fraction of PM10 and bioaccessible concentrations of polycyclic aromatic hydrocarbons and metal(oid)s in PM10

Ggatgatgatgataacctgc catggagaatatcacttgttgg catcaaccagtattatggctc ttcctttgttacagcttcc cagaagaccttttacctgag ggcaccatgtctatcttttc ccattttctggacaaacctg gaccttgctccttattgaag gttcacacaggttaaggaag tattcagattcaggcccttag agctggaagctgcagacctg cctttcagaatggctggca tatttcagttcccattgcag gtgatagaaagcaaggtcttc cac