Comparison of two methods of rapid theophylline testing in clinical practice.

K. Shaw,G. Fleisher,J. Schwartz

DOI: https://doi.org/10.1016/S0022-3476(88)80138-0

IF: 2.99

Jornal de Pediatria

Abstract:

What problem does this paper attempt to address?

Progressin the Study of Antiretroviral Therapy Related Cardiovascular Diseases in AIDS Patients

Lin Song,Yi Sun,Luyang Yu

2016-01-01

Abstract:The successful roll-out of antiretroviral therapy (ART) makes HIV infection into a manageable clinical entity.However,more and more clinical evidences define an elevated risk of developing cardiovascular disease (CVD) among HIV-positive patients who are with medical care.Beside immunological defect and metabolic disorder,adverse effects of antiretroviral therapy have become of particular concern within factors that may potentially contribute to HIV-related CVD.Currently,the effects of ART on cardiovascular disease are mainly linked with two kinds of backbone drugs,nucleoside reverse transcriptase irnhibitors (NRTIs) and protease inhibitors (PIs).The aim of this review is to introduce the research progresses of ART related cardiovascular diseases in AIDS patients.
Mitochondrial DNA depletion and morphologic changes in adipocytes associated with nucleoside reverse transcriptase inhibitor therapy

David Nolan,Emma Hammond,Annalise Martin,Louise Taylor,Susan Herrmann,Elizabeth McKinnon,Cecily Metcalf,Bruce Latham,Simon Mallal

DOI: https://doi.org/10.1097/00002030-200306130-00007

IF: 4.632

2003-06-13

AIDS

Abstract:Background: Nucleoside analogue reverse transcriptase inhibitor (NRTI) therapy provides sufficient conditions for progressive subcutaneous fat wasting in HIV-infected patients. As NRTI-induced host toxicity is proposed to involve cellular mitochondrial DNA (mtDNA) depletion, determinants of cellular mtDNA copy number and mitochondrial mass in adipocyte samples from NRTI-treated HIV-infected patients and antiretroviral-naive controls were investigated. Adipose tissue morphology was also assessed. Methods: Subcutaneous fat samples were obtained from NRTI-treated, HIV-infected patients (n = 21), antiretroviral therapy-naive HIV-infected controls (n = 11), and HIV-seronegative controls (n = 6). Non-adipocytes were removed by collagenase digestion. Adipocyte mtDNA copies/cell was measured using a real time PCR-based assay, and adipocyte mitochondrial protein content was also measured. Light and electron microscopy were performed on tissue samples. Findings: Adipocyte mtDNA copies/cell values were similar (P = 0.56) in HIV seronegative and HIV-infected control groups. NRTI treatment was associated with reduced adipocyte mtDNA copies/cell, representing mean mtDNA depletion in NRTI-treated individuals of 77.7% compared with the mean value for the HIV-infected control group (P < 0001). Additionally, significant differences were found in adipocyte mtDNA copies/cell between patients receiving stavudine (n = 12, mean mtDNA depletion 87.1%) and zidovudine (n = 9, mean mtDNA depletion 52.1%) (P < 0.001). Adipocyte mitochondrial mass was increased in the stavudine group only (mean increase 289%, P < 0.01). Interpretation: NRTI therapy is associated with mtDNA depletion and mitochondrial proliferation in adipocytes, consistent with the hypothesis that NRTI-induced mtDNA depletion contributes to the pathogenesis of subcutaneous fat wasting. Morphologic assessment also supports a role for NRTI therapy in inducing adipocyte metabolic dysfunction and cell death.
Clinical features and risk factors of lactic acidosis following long-term antiretroviral therapy: 4 fatal cases

H J ter Hofstede,S de Marie,N A Foudraine,S A Danner,K Brinkman

DOI: https://doi.org/10.1258/0956462001916498

Abstract:Our objective was to describe clinical features and predisposing factors attributed to lactic acidosis in 4 HIV-infected patients on long-term nucleoside reverse transcriptase inhibitor (NRTI) therapy. All patients had received at least 6-20 months of NRTI-containing antiretroviral therapy: all used stavudine (d4T), in one combined with lamivudine (3TC), in the other 3 with didanosine (ddI); in one hydroxyurea was added. In all, the initial symptoms were gastrointestinal (nausea and vomiting), followed by tachypnoea preceding the lactic acidosis; death followed 6-22 days after admission (liver failure and uncontrollable arrhythmias). Treatment with riboflavin was unsuccessful in one patient. The only definite risk factor in all cases was NRTI-induced mitochondrial toxicity; one patient was concomitantly treated for Kaposi's sarcoma (with bleomycin and vinblastine) and one just recovered from pneumococcal sepsis. None of the patients had a history of chronic hepatitis B virus (HBV) or hepatitis C virus (HCV) infection. In all patients, some sort of toxicity to other previously used NRTIs had occurred earlier. Lactic acidosis occurred after months of NRTI therapy in patients who had already suffered other forms of NRTI toxicity. Concomitant diseases or comedication might have aggravated the mitochondrial toxicity of the NRTIs. Screening methods to detect mitochondrial toxicity are necessary, since lactic acidosis occurs rather unexpectedly, with a rapid, fatal course.
The Impact of Highly Active Antiretroviral Treatment on the Blood Profiles of Patients with Acquired Immune Deficiency Syndrome

L. L. Tang,C. Z. Jin,L. J. Wu,N. H. Brockmeyer,A. Potthoff,N. P. Wu

DOI: https://doi.org/10.1177/147323001103900442

2011-01-01

Journal of International Medical Research

Abstract:This study retrospectively investigated the short- and long-term impact of highly active antiretroviral treatment (HAART) on the blood profiles of patients with acquired immune deficiency syndrome (AIDS), and their relationship with disease progression. CD4(+) T-cell count was measured by flow cytometry, plasma viral load of human immunodeficiency virus (HIV) RNA was detected by reverse transcription-polymerase chain reaction, and blood profile was determined by an automated analyser. CD4(+) T-cell count, total lymphocyte count (TLC) and haemoglobin concentration improved gradually in patients with AIDS after the initiation of HAART. Long-term effective HAART significantly increased CD4(+) T-cell counts TLC and haemoglobin concentrations, and reduced viral load to undetectable levels. An increase in haemoglobin was positively correlated with an increase in CD4(+) T-cells. These findings suggest that TLC is a valuable tool for determining the initiation of HAART, and that the haemoglobin concentration could be an additional indicator for long-term monitoring of HAART in resource-limited settings.
Muscle and liver lactate metabolism in HAART-treated and naive HIV-infected patients: the MITOVIR study

Jade Ghosn,Marguerite Guiguet,Claude Jardel,Rabah Benyaou,Valérie Zeller,Anne Simon,Marc-Antoine Valantin,Bahia Amellal,Lambert Assoumo,Jean-Yves Hogrel,Dominique Costagliola,Christine Katlama,Anne Lombès

Abstract:Objective: To assess the impact of nucleoside analogue reverse transcriptase inhibitor (NRTI) combination therapy on muscle and liver lactate metabolism in HIV-infected patients. Methods: This cross-sectional study involved HIV-infected patients who were either antiretroviral-naive (Group 1) or were receiving either a stable triple-drug combination including at least one d-drug (zidovudine, zalcitabine, stavudine, didanosine; Group 2) or a backbone of abacavir and lamivudine (Group 3). Lactataemia was measured at rest. Muscle lactate metabolism was assessed during a standardized exercise test and liver lactate metabolism during intravenous lactate infusion. Mitochondrial DNA was quantified in peripheral blood mononuclear cells. Results: A total of 65 patients were enrolled (16, 31 and 18 patients in Group 1, Group 2 and Group 3, respectively). None of the patients had symptoms of hyperlactataemia. Patients in Group 3 had received d-drugs for a median of seven years before switching to abacavir and lamivudine. Median baseline lactataemia, although within the normal range, was significantly higher in both treatment groups than in the naive patients (Group 2: 1.4, Group 3: 1.5, and Group 1: 1.0 mmol/l, P = 0.005). Muscle lactate clearance was significantly lower in both treatment groups than in naive patients (Group 2: 1.6, Group 3: 1.8, and Group 1: 2.1, P = 0.01). Lactate liver metabolism and mitochondrial DNA levels did not differ among the three groups. Conclusions: In HIV-infected patients without symptomatic hyperlactataemia, all NRTI-containing HAART regimens appear to cause muscle mitochondrial damage but to spare the liver. Absence of difference between Group 2 and Group 3 raises questions about the potential reversibility of muscle mitochondrial dysfunction, and/or the ability of abacavir and lamivudine to induce such mitochondrial damage.
Long-term exposure to lifelong therapies

W G Powderly

DOI: https://doi.org/10.1097/00126334-200202011-00005

Abstract:Three categories of highly active antiretroviral therapy (HAART)-associated major toxic effects have been identified: nucleoside-related toxic effects (e.g., neuropathy, myopathy, pancreatitis, hepatic steatosis, lactic acidosis, and possibly lipoatrophy), metabolic complications (e.g., fat redistribution, insulin resistance, and hyperlipidemia), and bone disease (e.g., osteopenia and/or osteoporosis). The toxic effects caused by nucleosides are hypothesized to be a result of mitochondrial injury and include myopathy, pancreatitis, liver failure, and lactic acidosis. Alterations in lactic acid metabolism range from common instances of asymptomatic lactic acidemia to rare occurrences of life-threatening lactic acidosis with hepatic steatosis. A metabolic syndrome consisting of lipodystrophy (i.e., fat redistribution), hyperlipidemia and insulin resistance has been observed, particularly with protease inhibitor treatment. Some additive interaction between protease inhibitors and nucleosides has also been described. The potential relationship of these metabolic abnormalities to increased risk of cardiovascular disease and diabetes has broad implications on long-term patient management. Lipodystrophy associated with HAART is generally accompanied by potentially serious abnormalities, including dyslipidemia (i.e., hypercholesterolemia and hypertriglyceridemia) and altered glucose metabolism (i.e., insulin resistance). Regimens of HAART may have adverse effects on bone metabolism, as indicated by emerging reports of osteopenia, osteoporosis, and avascular necrosis.
Chronic Nucleoside Reverse Transcriptase Inhibitors Disrupt Mitochondrial Homeostasis and Promote Premature Endothelial Senescence

Yi-Fan Chen,James E Stampley,Brian A Irving,Tammy R Dugas

DOI: https://doi.org/10.1093/toxsci/kfz203

2019-12-01

Abstract:Combination antiretroviral therapy (cART) has improved the life expectancy of HIV patients, thus increasing the number of people living with HIV (PLWH). However, cardiovascular diseases (CVD) are now one of the most prevalent causes of death among PLWH. Nucleoside reverse transcriptase inhibitors (NRTIs) are the backbone of cART, and the emtricitabine (FTC) and tenofovir disoproxil fumarate (TDF) coformulation is commonly used. In prior studies, acute NRTI treatment-induced endothelial dysfunction, increased reactive oxygen species production, and mitophagic activity, suggesting that mitochondrial dysfunction may be critical to NRTI-induced endothelial dysfunction. Mitochondrial dysfunction plays a causal role in endothelial senescence, whereas premature endothelial senescence can promote the development of CVD. We hypothesize that for chronic NRTI treatment, a disruption in mitochondrial homeostasis leads to premature endothelial senescence and predisposes PLWH to CVD. We used human aortic endothelial cells (HAEC) and HIV-1 transgenic (Tg26) mice to test the interrelationship between mitochondrial and vascular dysfunction after chronic NRTI treatment in vitro and in vivo. Mitochondrial DNA copy number was decreased in late-passage HAEC treated with NRTIs, and senescence-associated β-galactosidase accumulation was elevated. In late-passage HAEC, NRTIs decreased the activity of Parkin-mediated mitophagy. In Tg26 mice treated with FTC, plasma nitrite levels were decreased. Endothelium-dependent vasodilation in NRTI-treated Tg26 mice was also reduced. Our work suggests that long-term use of NRTI may disrupt mitochondrial homeostasis, induce premature endothelial senescence, and impair vascular function.
Mitochondrial Toxicogenomics for Antiretroviral Management: HIV Post-exposure Prophylaxis in Uninfected Patients

Maria Bañó,Constanza Morén,Sergio Barroso,Diana Luz Juárez,Mariona Guitart-Mampel,Ingrid González-Casacuberta,Judith Canto-Santos,Ester Lozano,Agathe León,Enric Pedrol,Òscar Miró,Ester Tobías,Josep Mallolas,Jhon F. Rojas,Francesc Cardellach,Esteban Martínez,Gloria Garrabou

DOI: https://doi.org/10.3389/fgene.2020.00497

IF: 3.7

2020-05-26

Frontiers in Genetics

Abstract:Background: Mitochondrial genome has been used across multiple fields in research, diagnosis, and toxicogenomics. Several compounds damage mitochondrial DNA (mtDNA), including biological and therapeutic agents like the human immunodeficiency virus (HIV) but also its antiretroviral treatment, leading to adverse clinical manifestations. HIV-infected and treated patients may show impaired mitochondrial and metabolic profile, but specific contribution of viral or treatment toxicity remains elusive. The evaluation of HIV consequences without treatment interference has been performed in naïve (non-treated) patients, but assessment of treatment toxicity without viral interference is usually restricted to in vitro assays.Objective: The objective of the present study is to determine whether antiretroviral treatment without HIV interference can lead to mtDNA disturbances. We studied clinical, mitochondrial, and metabolic toxicity in non-infected healthy patients who received HIV post-exposure prophylaxis (PEP) to prevent further infection. We assessed two different PEP regimens according to their composition to ascertain if they were the cause of tolerability issues and derived toxicity.Methods: We analyzed reasons for PEP discontinuation and main secondary effects of treatment withdrawal, mtDNA content from peripheral blood mononuclear cells and metabolic profile, before and after 28 days of PEP, in 23 patients classified depending on PEP composition: one protease inhibitor (PI) plus Zidovudine/Lamivudine (PI plus AZT + 3TC; n = 9) or PI plus Tenofovir/Emtricitabine (PI plus TDF + FTC; n = 14).Results: Zidovudine-containing-regimens showed an increased risk for drug discontinuation (RR = 9.33; 95% CI = 1.34–65.23) due to adverse effects of medication related to gastrointestinal complications. In the absence of metabolic disturbances, 4-week PEP containing PI plus AZT + 3TC led to higher mitochondrial toxicity (−17.9 ± 25.8 decrease in mtDNA/nDNA levels) than PI plus TDF + FTC (which increased by 43.2 ± 24.3 units mtDNA/nDNA; p < 0.05 between groups). MtDNA changes showed a significant and negative correlation with baseline alanine transaminase levels (p < 0.05), suggesting that a proper hepatic function may protect from antiretroviral toxicity.Conclusions: In absence of HIV infection, preventive short antiretroviral treatment can cause secondary effects responsible for treatment discontinuation and subclinical mitochondrial damage, especially pyrimidine analogs such as AZT, which still rank as the alternative option and first choice in certain cohorts for PEP. Forthcoming efforts should be focused on launching new strategies with safer clinical and mitotoxic profile.

genetics & heredity
The reform of medical education: an outsider's reflections

E. Ginzberg

DOI: https://doi.org/10.1097/00001888-199307000-00002

1993-07-01

Abstract:After reviewing some of the major structural changes that have altered American medical education over the last 80 years, the author depicts the recent climate that has fostered a number of proposals for educational reform to better prepare physicians for the next century. He lists the five major types of reform that have been suggested (for example, the integration of basic sciences and clinical knowledge) and then reflects on each type, asking questions about implementation such as: Who will accomplish the reform? How will it be carried out? What and where are the financial, knowledge, and other resources that will be needed? What must be overcome to accomplish the reform? He then discusses the forms of instruction that should accompany the proposed reforms in educational content (such as decreasing lectures and increasing small-group discussions). He observes that there is often a serious conflict between the need to provide students some free hours and departments' perceptions of the time needed to educate students properly. He closes with a review of some aspects of reform that have been neglected or minimized, such as the length of time and the costs that medical students must face to complete their education, and the economics of educational innovations.
Mitochondrial DNA Profiling in A Cohort of Antiretroviral Treated HIV Patients in Lagos, Nigeria: Assessment of Long-Term Effects of cART on Life Quality of PLWH

Azuka Patrick Okwuraiwe,Disu Tajudeen,Stephnie Nwaiwu,Patrick Irurhe,Rosemary Ajuma Audu,Chika Kingsley Onwuamah,Rahaman A. Ahmed

DOI: https://doi.org/10.24018/ejmed.2022.4.3.1243

2022-06-23

European Journal of Medical and Health Sciences

Abstract:The use of combined antiretroviral therapy (cART) has turned HIV infection to a manageable condition, significantly reducing HIV-related morbidity and mortality globally. Risk of transmission has been substantially reduced in Africa where 67% of global infection is domiciled. However, long-term impact of cART on life quality of HIV patients elicits concern due to possible oxidative stress stimulus and accumulated toxicity. Mitochondrion, responsible for molecular metabolism in eukaryotes has been proposed as a marker for cellular dysfunction and ageing. Metabolic dysfunction due to accumulated oxidative stress may lead to mitochondrial DNA (mtDNA) mutation, protein alteration, and premature apoptosis leading to ageing. A cohort study comprising of 302 HIV infected persons receiving cART (Tenofovir, Lamivudine, Dolutegravir; TLD) at NIMR HIV reference clinic, and 113 healthy controls. Venous blood was collected in vacutainer tubes and plasma isolated. DNA extraction was done using NIMR-Biotech DNA Extraction kit, and mtDNA levels measured using SYBRGreen dye-based quantitative real-time PCR assay on Quant Studio 5. Primer sequences from human 12S ribosomal RNA with CCACGGGAAACAGCAGTGAT and CTATTGACTTGGGTTAATCGTGTGA as forward and reverse sequences respectively were used to amplify mtDNA locus. Melting curve was performed for every run to confirm successful amplification of targeted region. Total DNA from an immortalized Hela cell line, diluted in 10-fold serial dilutions, was used as standard curve. Plasma mtDNA levels were evaluated and data analyzed using IBM SPSS software (version 24). Among HIV infected individuals, 185 (88.1%) were female and mean age was 32±0.43 years while 36 (32%) and 27±0.57 years were female and mean age among controls, respectively. Mean CD4 count among HIV subjects was 427±29 cells/μl while 62.4% had less than 50 viral copies/ml. Majority of subjects (74.9%) were on first line cART while mean exposure to ART regimens was 4±0.3 years. No significant difference was observed between mtDNA concentration of HIV subjects (mean = 256±38 copies/μl) and healthy controls (mean: 247±72 copies/μl), neither among only HIV subjects, when stratified based on viral load or CD4 count. No association was observed between cell free (cf)-mtDNA and cART exposure among HIV patients. Lack of baseline information on initial cf-mtDNA among Africans was challenging in establishing that new ART regimens had enhanced recovery from mitochondrial-DAMP. There is need to continuously assess prolonged effect of cART to ensure good quality of life and healthy ageing for people living with HIV (PLWH).
Echovirus 14 infection associated with fatal neonatal hepatic necrosis.

J. Hughes,C. Wilfert,Marcia Moore,K. Benirschke,E. Hoyos-Guevara

DOI: https://doi.org/10.1001/ARCHPEDI.1972.02110070111017

A M A Journal of Diseases of Children

Abstract:Echovirus 14 was isolated from the liver of a newborn infant with fatal hepatic necrosis. It appeared likely that the infection was acquired in utero. Ultrastructurally, the findings in the liver cells were consistent with a viral infection. In cell cultures the viral isolate was found to produce crystalline inclusions in the nucleus and cytoplasm. Negative stained virions measured approximately 30.3 mμ in diameter. To our knowledge, the electron microscopy of echovirus 14 has not been previously reported.
Identification and characterization of mRNA-like noncoding RNAs in Salvia miltiorrhiza

Dongqiao Li,Fenjuan Shao,Shanfa Lu

DOI: https://doi.org/10.1007/s00425-015-2246-z

IF: 4.54

2015-01-20

Planta

Abstract:
Liver Damage During Treatment with Reverse-Transcriptase Inhibitors in HIV Patients

Giorgiana Nicoleta Lungu,Gheorghe Iulian Diaconescu,Florentina Dumitrescu,Oanca Oana Docea,Radu Mitrut,Lucian Giubelan,Ovidiu Zlatian,Paul Mitrut

DOI: https://doi.org/10.12865/CHSJ.50.02.03

Abstract:The advent of highly active antiretroviral therapy (HAART) in 1996 has markedly enhanced the life expectancy of people living with HIV (PLWH), largely due to the effectiveness of reverse transcriptase inhibitors (RTIs). These drugs target the reverse transcriptase enzyme, crucial for the HIV virus to convert its RNA into DNA within host cells, effectively disrupting the viral replication process. This action reduces the patient's viral load, helping preserve immune function and prevent progression to AIDS. Consequently, the predominant causes of mortality among individuals living with HIV have transitioned from opportunistic infections and AIDS-related cancers to liver disease and cardiovascular complications. Liver damage in PLWH could arise from multiple sources including co-infections, chronic substance use, and notably, antiretroviral therapy itself, which can be hepatotoxic. This review highlights the risks of hepatic damage associated with nucleoside and non-nucleoside RTIs and underscores the variability in hepatotoxicity risks among different drugs. It emphasizes the necessity for regular monitoring of liver health in PLWH and adjusting antiretroviral regimens to minimize liver fibrosis risk. This risk is particularly pronounced in patients who associate the infection with hepatitis B or C virus, where the potential for hepatotoxicity significantly increases.
Impact of Antiretroviral Therapy on Anemia, Hepatotoxicity, and Immune Reconstitution Inflammatory Syndrome in HIV-Tuberculosis Co-Infected Patients

Priyanka Gupta,Anil Kumar Tripathi,Shikha Gupta,Abhishek Gupta

DOI: https://doi.org/10.1101/2024.09.24.24314274

2024-09-26

Abstract:Introduction: HIV continues to pose a significant global health challenge, causing gradual immune system decline and, if left untreated, progressing to AIDS. Although antiretroviral therapy (ART) has transformed the treatment landscape for HIV, it is frequently associated with adverse effects, including anemia, hepatotoxicity, and immune-related issues such as Immune Reconstitution Inflammatory Syndrome (IRIS), particularly in patients co-infected with tuberculosis (TB). Materials and methods: In this prospective cohort study, 400 ART-naive, HIV-positive patients undergoing anti-tuberculosis therapy (ATT) at King Georges Medical University, Lucknow, India, were enrolled. The study evaluated the occurrence of opportunistic infections (OIs), ART regimen effectiveness, and key laboratory markers, including CD4 counts and hemoglobin levels. Results: TB emerged as the most common OI, affecting 20.25% of the participants, with anemia present in 85% of the cohort. The prevalence of IRIS was notably higher in patients with a positive tuberculin skin test (20.6%) compared to those with a negative test (7.4%). Patients with IRIS exhibited significantly lower CD4 counts and hemoglobin levels compared to those without IRIS. Conclusion: This study underscores the importance of integrated management approaches for HIV patients co-infected with TB, focusing on the complex interaction between immune status, ART effectiveness, and comorbidities like anemia and hepatotoxicity. Properly addressing these factors is crucial for improving patient outcomes in this high-risk population.
The Toxicity of Azidothymidine (AZT) in the Treatment of Patients with AIDS and AIDS-Related Complex

Douglas D. Richman,Margaret A. Fischl,Michael H. Grieco,Michael S. Gottlieb,Paul A. Volberding,Oscar L. Laskin,John M. Leedom,Jerome E. Groopman,Donna Mildvan,Martin S. Hirsch,George G. Jackson,David T. Durack,Sandra Nusinoff-Lehrman,,

DOI: https://doi.org/10.1056/nejm198707233170402

IF: 158.5

1987-07-23

New England Journal of Medicine

Abstract:We conducted a double-blind, placebo-controlled trial of oral azidothymidine (AZT) in 282 patients with the acquired immunodeficiency syndrome (AIDS) or AIDS-related complex. Although significant clinical benefit was documented (N Engl J Med 1987; 317:185-91), serious adverse reactions, particularly bone marrow suppression, were observed. Nausea, myalgia, insomnia, and severe headaches were reported more frequently by recipients of AZT; macrocytosis developed within weeks in most of the AZT group. Anemia with hemoglobin levels below 7.5 g per deciliter developed in 24 percent of AZT recipients and 4 percent of placebo recipients (P less than 0.001). Twenty-one percent of AZT recipients and 4 percent of placebo recipients required multiple red-cell transfusions (P less than 0.001). Neutropenia (less than 500 cells per cubic millimeter) occurred in 16 percent of AZT recipients, as compared with 2 percent of placebo recipients (P less than 0.001). Subjects who entered the study with low CD4 lymphocyte counts, low serum vitamin B12 levels, anemia, or low neutrophil counts were more likely to have hematologic toxic effects. Concurrent use of acetaminophen was also associated with a higher frequency of hematologic toxicity. Although a subset of patients tolerated AZT for an extended period with few toxic effects, the drug should be administered with caution because of its toxicity and the limited experience with it to date.

medicine, general & internal
Progressive syringomyelia controlled by treatment of associated hydrocephalus in an infant with birth injury. Case report.

J. Piatt

DOI: https://doi.org/10.3171/PED.2005.103.2.0198

IF: 5.408

2005-08-01

Journal of Neurosurgery

Abstract:The author's aim in reporting this case is to extend awareness of the importance of management of associated hydrocephalus among patients with syringomyelia to the posttraumatic state. A full-term infant was delivered by cesarean section because of transverse lie. In the 2nd week of life, hypotonia affecting the lower limbs and the left upper limb was recognized. On MR imaging, posterior fossa subdural hemorrhage and spinal cord injury at the T-1 and T-2 levels were evident. Sequential imaging studies demonstrated progressive myelomalacic changes in the cervical spinal cord and eventual development of syrinx cavities as far cephalad as C-3. Hydrocephalus developed simultaneously as well. A ventriculoperitoneal cerebrospinal fluid shunt was inserted at 22 months of age. Six months after shunt insertion, MR imaging demonstrated regression of the posttraumatic syringomyelia. The patient was stable from an imaging standpoint at 16 months after shunt insertion, and she has continued to make developmental progress. The importance of treatment of associated hydrocephalus is widely recognized in the management of syringomyelia associated with the Chiari malformations. It should be considered in the management of posttraumatic syringomyelia as well.
Analysis of mammalian 20S proteasome biogenesis: the maturation of beta‐subunits is an ordered two‐step mechanism involving autocatalysis.

Gunter Schmidtke,Regine Kraft,S. Kostka,Peter Henklein,Cornelius Frommel,Jan Lowe,Robert Huber,P. Kloetzel,Marion Schmidt

DOI: https://doi.org/10.1002/j.1460-2075.1996.tb01081.x

1996-12-01

Abstract:Maturation of eukaryotic 20S proteasomes involves the processing of beta‐subunits by limited proteolysis. To study the processing mechanism we analysed different point mutations of the beta‐subunit LMP2 in transfected human T2 cells. Here we show that the presence of the intact Gly‐1Thr1 consensus motif and Lys33 are essential for correct processing. Mutation of Thr1, the active site residue in mature subunits, or of Lys33, results in complete inhibition of processing at the consensus site. In addition, proprotein processing in vitro of wild‐type LMP2, incorporated in immature 16S precursor complexes, can be blocked by a proteasome‐specific inhibitor. While the processing of inhibitor‐treated wild‐type proprotein was completely prevented, the site‐directed mutagenesis of LMP2 results in processing intermediates carrying an extension of 8–10 residues preceding Thr1, suggesting an additional cleavage event within the prosequence. Furthermore, exchange of mammalian prosequences interferes with processing efficiency and suggests subunit specificity. Based on our data we propose a model for self‐activation of proteasomal beta‐subunits in which residue Thr1 serves as nucleophile and Lys33 as proton donor/acceptor. We provide evidence that subunit processing of mammalian beta‐subunits proceeds via a novel ordered two‐step mechanism involving autocatalysis.
Consequences of Intraspecific Predation: A Stage Structured Population Model Approach

W. Gabriel,F. Bosch

DOI: https://doi.org/10.1007/978-3-642-77020-3_22

1990-04-05

Abstract:
Protein tyrosine phosphatase (PC12, Br7,S1) family: expression characterization in the adult human and mouse.

K. Augustine,S. Silbiger,N. Bucay,L. Ulias,A. Boynton,L. D. Trebasky,E. Medlock

The Anatomical Record

Abstract:Protein tyrosine phosphatases (PTPs) play important roles in modulating signals transduced by tyrosine kinases. Certain phosphatases have been implicated as having important roles in embryonic development as well as in adult physiology. Although both kinases and phosphatases are equally important in regulating signal transduction, phosphatases as a group have not been well characterized. Thus, characterization of sequence, expression, and biological function for additional phosphatases is informative. PTPBr7/PC12 and PTPSl are mouse receptor PTPs sharing similar amino acid sequences. Northern blot analysis demonstrated expression of these genes in adult rodent brain and revealed previously uncharacterized transcripts in the brain and other tissues. Our results demonstrate that PTPBr7/PC12 and PTPSl are members of a larger family of PTPs. We have identified two novel family members as well as several novel transcriptional splice variants from both human and mouse colon cDNA libraries. Expression analysis demonstrated that the various mRNA transcripts are differentially expressed, with the highest levels found in the brain, intestinal tract, uterus, and placenta. In situ hybridization analysis of mouse brain and intestinal tissues established that each isoform has a unique expression pattern in specific cell populations as well as in tissue regions. Furthermore, these restricted patterns suggest that the encoded family of phosphatases may play roles in modulating signal transduction pathways important for specific cell types and biological processes.
Identification of Bacteriophage N4 Virion RNA Polymerase-Nucleic Acid Interactions in Transcription Complexes*

E. Davydova,Irene Kaganman,K. Kazmierczak,L. Rothman-Denes

DOI: https://doi.org/10.1074/jbc.M807785200

IF: 5.485

2009-01-23

Journal of Biological Chemistry

Abstract:Bacteriophage N4 mini-virion RNA polymerase (mini-vRNAP), the 1106-amino acid transcriptionally active domain of vRNAP, recognizes single-stranded DNA template-containing promoters composed of conserved sequences and a 3-base loop–5-base pair stem hairpin structure. The major promoter recognition determinants are a purine located at the center of the hairpin loop (–11G) and a base at the hairpin stem (–8G). Mini-vRNAP is an evolutionarily highly diverged member of the T7 family of RNAPs. A two-plasmid system was developed to measure the in vivo activity of mutant mini-vRNAP enzymes. Five mini-vRNAP derivatives, each containing a pair of cysteine residues separated by ∼100 amino acids and single cysteine-containing enzymes, were generated. These reagents were used to determine the smallest catalytically active polypeptide and to map promoter, substrate, and RNA-DNA hybrid contact sites to single amino acid residues in the enzyme by using end-labeled 5-iododeoxyuridine- and azidophenacyl-substituted oligonucleotides, cross-linkable derivatives of the initiating nucleotide, and RNA products with 5-iodouridine incorporated at specific positions. Localization of functionally important amino acid residues in the recently determined crystal structures of apomini-vRNAP and the mini-vRNAP-promoter complex and comparison with the crystal structures of the T7 RNAP initiation and elongation complexes allowed us to predict major rearrangements in mini-vRNAP in the transition from transcription initiation to elongation similar to those observed in T7 RNAP, a task otherwise precluded by the lack of sequence homology between N4 mini-vRNAP and T7 RNAP.

Comparison of two methods of rapid theophylline testing in clinical practice.

Progressin the Study of Antiretroviral Therapy Related Cardiovascular Diseases in AIDS Patients

Mitochondrial DNA depletion and morphologic changes in adipocytes associated with nucleoside reverse transcriptase inhibitor therapy

Clinical features and risk factors of lactic acidosis following long-term antiretroviral therapy: 4 fatal cases

The Impact of Highly Active Antiretroviral Treatment on the Blood Profiles of Patients with Acquired Immune Deficiency Syndrome

Muscle and liver lactate metabolism in HAART-treated and naive HIV-infected patients: the MITOVIR study

Long-term exposure to lifelong therapies

Chronic Nucleoside Reverse Transcriptase Inhibitors Disrupt Mitochondrial Homeostasis and Promote Premature Endothelial Senescence

Mitochondrial Toxicogenomics for Antiretroviral Management: HIV Post-exposure Prophylaxis in Uninfected Patients

The reform of medical education: an outsider's reflections

Mitochondrial DNA Profiling in A Cohort of Antiretroviral Treated HIV Patients in Lagos, Nigeria: Assessment of Long-Term Effects of cART on Life Quality of PLWH

Echovirus 14 infection associated with fatal neonatal hepatic necrosis.

Identification and characterization of mRNA-like noncoding RNAs in Salvia miltiorrhiza

Liver Damage During Treatment with Reverse-Transcriptase Inhibitors in HIV Patients

Impact of Antiretroviral Therapy on Anemia, Hepatotoxicity, and Immune Reconstitution Inflammatory Syndrome in HIV-Tuberculosis Co-Infected Patients

The Toxicity of Azidothymidine (AZT) in the Treatment of Patients with AIDS and AIDS-Related Complex

Progressive syringomyelia controlled by treatment of associated hydrocephalus in an infant with birth injury. Case report.

Analysis of mammalian 20S proteasome biogenesis: the maturation of beta‐subunits is an ordered two‐step mechanism involving autocatalysis.

Consequences of Intraspecific Predation: A Stage Structured Population Model Approach

Protein tyrosine phosphatase (PC12, Br7,S1) family: expression characterization in the adult human and mouse.

Identification of Bacteriophage N4 Virion RNA Polymerase-Nucleic Acid Interactions in Transcription Complexes*