Consequences of Intraspecific Predation: A Stage Structured Population Model Approach

W. Gabriel,F. Bosch

DOI: https://doi.org/10.1007/978-3-642-77020-3_22

1990-04-05

Abstract:

What problem does this paper attempt to address?

Increased Microbial Translocation is a Prognostic Biomarker of Different Immune Responses to ART in People Living with HIV

Xuebin Tian,Yiwen Xie,Jingjing Chen,Wanpeng Yin,Yu Long Zhao,Peng Yao,Mingqing Dong,Changzhong Jin,Nanping Wu

DOI: https://doi.org/10.2147/idr.s404384

2023-01-01

Infection and Drug Resistance

Abstract:Background Microbial translocation (MT) is a characteristic of human immunodeficiency virus (HIV) infection. Whether MT is also a biomarker of different immune responses to antiretroviral therapy (ART) received by people living with HIV (PLWH) is not known. Methods We examined the presence of MT in a cohort of 33 HIV-infected immunological responders (IRs) and 28 immunological non-responders (INRs) (≥500 and <200 cluster of differentiation (CD)4+ T-cell counts/µL after 2 years of HIV-1 suppression, respectively) with no comorbidities. Plasma samples were used to measure the circulating levels of MT markers. All enrolled study participants had received 2 years of viral-suppression therapy. Results Levels of lipopolysaccharide (P = 0.0185), LPS-binding protein (P < 0.0001), soluble-CD14 (P < 0.0001), and endogenous endotoxin-core antibody (P < 0.0001) at baseline were significantly higher in INRs than in IRs and were associated with an increased risk of an immunological non-response, whereas the level of intestinal fatty acid-binding protein did not show this association. Analysis of receiver operating characteristic (ROC) curves demonstrated the utility of these individual microbial markers in discriminating INRs after ART in people living with HIV with high sensitivity, specificity, and area under the ROC curve. Conclusion INRs in HIV infection are characterized by increased MT at baseline. These markers could be used as a rapid prognostic tool for predicting immune responses in people infected with the HIV.
Altered plasma metabolites and inflammatory networks in HIV-1 infected patients with different immunological responses after long-term antiretroviral therapy

Lianfeng Lu,Yang Yang,Zhangong Yang,Yuanni Wu,Xiaosheng Liu,Xiaodi Li,Ling Chen,Yang Han,Xiaojing Song,Ziqing Kong,Wei Cao,Taisheng Li

DOI: https://doi.org/10.3389/fimmu.2023.1254155

IF: 7.3

2023-09-27

Frontiers in Immunology

Abstract:Background: Chronic metabolic changes relevant to human immunodeficiency virus type 1 (HIV-1) infection and in response to antiretroviral therapy (ART) remain undetermined. Moreover, links between metabolic dysfunction caused by HIV and immunological inflammation in long-term treated individuals have been poorly studied. Methods: Untargeted metabolomics and inflammatory cytokine levels were assessed in 47 HIV-infected individuals including 22 immunological responders (IRs) and 25 non-responders (INRs) before and after ART. The IRs and INRs were matched by age, gender, baseline viral load, and baseline CD4+T cell counts. Another 25 age-matched uninfected healthy individuals were also included as controls. Results: Among the 770 plasma compounds detected in the current study, significant changes were identified in lipids, nucleotides, and biogenic amino acids between HIV-infected patients and healthy controls. Principal Component Analysis (PCA) and the Random Forest (RF) model suggested that levels of selected metabolites could differentiate HIV-infected patients clearly from healthy controls. However, the metabolite profiles identified in our patients were similar, and only three metabolites, maltotetraose, N, N-dimethyl-5-aminovalerate, and decadienedioic acid (C10:2-DC), were different between IRs and INRs following long-term ART. The pathway enrichment analysis results revealed that disturbances in pyrimidine metabolism, sphingolipid metabolism, and purine metabolism after HIV infection and these changes did not recover to normal levels in healthy controls even with suppressive ART. Correlation analysis of the metabolism-immune network indicated that interleukin (IL)-10, D-dimer, vascular cell adhesion molecule-1 (VCAM-1), intercellular cell adhesion molecule-1 (ICAM-1), and TNF-RII were positively correlated with most of the significantly changed lipid and amino acid metabolites but negatively correlated with metabolites in nucleotide metabolism. Conclusions: Significant changes in many metabolites were observed in HIV-infected individuals before and after ART regardless of their immunological recovery status. The disturbed metabolic profiles of lipids and nucleotides in HIV infection did not recover to normal levels even after long-term ART. These changes are correlated with modified cytokines and biomarkers of chronic non-AIDS events, warranting tryout of interventions other than ART.

immunology
Temporal Changes in Plasma Metabolic Signatures to Predict Immune Response of Antiretroviral Therapy among People Living with HIV.

Junnan Li,Jiali Lv,Fengting Yu,Yu Zhang,Yuqi Wang,Liting Yan,Qing Xiao,Qun Li,Cheng Wang,Xi Wang,Yan Hou,Fujie Zhang,Tao Zhang

DOI: https://doi.org/10.1002/jmv.29798

IF: 20.693

2024-01-01

Journal of Medical Virology

Abstract:Antiretroviral therapy (ART) is an effective treatment for people living with HIV (PLHIVs), requiring an extended period to achieve immune reconstitution. Metabolic alterations induced by ART are crucial for predicting long‐term therapeutic responses, yet comprehensive investigation through large‐scale clinical studies is still lacking. Here, we collected plasma samples from 108 PLHIVs to the untargeted plasma metabolomics study, based on the longitudinal metabolomics design. Cross‐sectional analyzes were performed at pre‐ and post‐ART to explore the metabolic transformation induced by the therapy. Subsequently, delta values between pre‐ and post‐ART measurements were calculated to quantify metabolic alterations. Then, the optimal set of metabolic traits and clinical signatures were further identified and applied to construct random forest model for predicting the future therapeutic responses to ART. We found distinct ART‐induced metabolic transformation among PLHIVs. After confounder‐adjustments, five metabolites exhibited significant associations with future immune response: tetracosatetraenoic acid (24:4n‐6) (pre‐ART) (odds ratio [OR]: 0.978, 95% confidence interval [CI]: 0.955~0.997), 1‐(3,4‐dihydroxyphenyl)−5‐hydroxy‐3‐decanone (pre‐ART) (OR: 1.298, 95% CI: 1.061~1.727), beta‐PC‐M6 (change) (OR: 0.967, 95% CI: 0.938~0.993), d‐Galactaro‐1,4‐lactone (change) (OR: 1.032, 95% CI: 1.007~1.063), Annuionone C (change) (OR: 1.100, 95% CI: 1.030~1.190). The addition of plasma metabolites to clinical markers accurately predicted immune response to ART with an area under curve of 0.91. Notably, most disrupted metabolites were significantly correlated with blood lipids, suggesting that metabolic transformation might contribute to dyslipidemia among PLHIVs. This study highlights the distinct metabolic transformation post‐ART among PLHIVs and reveals the potential role of metabolic transformation as key determinants of ART efficacy.
Metabolic and mitochondrial dysregulation in CD4+ T cells from HIV-positive women on combination anti-retroviral therapy

Matrona Akiso,Magdalene Ameka,Kewreshini Naidoo,Robert Langat,Janet Kombo,Delories Sikuku,Thumbi Ndung'u,Marcus Altfeld,Omu Anzala,Marianne Mureithi

DOI: https://doi.org/10.1371/journal.pone.0286436

IF: 3.7

2023-10-10

PLoS ONE

Abstract:Background: For optimal functionality, immune cells require a robust and adaptable metabolic program that is fueled by dynamic mitochondrial activity. In this study, we investigate the metabolic alterations occurring in immune cells during HIV infection and antiretroviral therapy by analyzing the uptake of metabolic substrates and mitochondrial phenotypes. By delineating changes in immune cell metabolic programming during HIV, we may identify novel potential therapeutic targets to improve anti-viral immune responses. Methods: After consent and voluntary participation was confirmed, whole blood was drawn from HIV uninfected women and women with chronic HIV infection on long-term combination antiretroviral therapy (HIV/cART). Peripheral blood mononuclear cells-derived immune cells were directly incubated with different fluorescently tagged metabolites and markers of mitochondrial activity: FITC-2-NBDG (2-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) amino]-2-deoxy-D-glucose), FITC-BODIPY (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Hexadecanoic Acid), FITC-MitoTracker Green and APC-MitoTracker Deep Red. The uptake of glucose and fats and the mitochondrial mass and potential were measured using flow cytometry. All values are reported quantitatively as geometric means of fluorescence intensity. Results: During chronic HIV infection, cellular uptake of glucose increases in HIV+ dendritic cells in particular. CD4+ T cells had the lowest uptake of glucose and fats compared to all other cells regardless of HIV status, while CD8+ T cells took up more fatty acids. Interestingly, despite the lower utilization of glucose and fats in CD4+ T cells, mitochondrial mass increased in HIV+ CD4+ T cells compared to HIV negative CD4+ T-cells. HIV+ CD4+ T cells also had the highest mitochondrial potential. Conclusions: Significant disparities in the utilization of substrates by leukocytes during chronic HIV/cART exist. Innate immune cells increased utilization of sugars and fats while adaptive immune cells displayed lower glucose and fat utilization despite having a higher mitochondrial activity. Our findings suggest that cART treated HIV-infected CD4+ T cells be dysfunctional or may prefer alternative fuel sources not included in these studies. This underscores the importance of understanding the metabolic effects of HIV treatment on immune function.
Plasma metabolomics by nuclear magnetic resonance reveals biomarkers and metabolic pathways associated with the control of HIV-1 infection/progression

León Gabriel Gómez-Archila,Martina Palomino-Schätzlein,Wildeman Zapata-Builes,Maria T. Rugeles,Elkin Galeano

DOI: https://doi.org/10.3389/fmolb.2023.1204273

IF: 6.113

2023-06-29

Frontiers in Molecular Biosciences

Abstract:How the human body reacts to the exposure of HIV-1 is an important research goal. Frequently, HIV exposure leads to infection, but some individuals show natural resistance to this infection; they are known as HIV-1-exposed but seronegative (HESN). Others, although infected but without antiretroviral therapy, control HIV-1 replication and progression to AIDS; they are named controllers, maintaining low viral levels and an adequate count of CD4 + T lymphocytes. Biological mechanisms explaining these phenomena are not precise. In this context, metabolomics emerges as a method to find metabolites in response to pathophysiological stimuli, which can help to establish mechanisms of natural resistance to HIV-1 infection and its progression. We conducted a cross-sectional study including 30 HESN, 14 HIV-1 progressors, 14 controllers and 30 healthy controls. Plasma samples (directly and deproteinized) were analyzed through Nuclear Magnetic Resonance (NMR) metabolomics to find biomarkers and altered metabolic pathways. The metabolic profile analysis of progressors, controllers and HESN demonstrated significant differences with healthy controls when a discriminant analysis (PLS-DA) was applied. In the discriminant models, 13 metabolites associated with HESN, 14 with progressors and 12 with controllers were identified, which presented statistically significant mean differences with healthy controls. In progressors, the metabolites were related to high energy expenditure (creatinine), mood disorders (tyrosine) and immune activation (lipoproteins), phenomena typical of the natural course of the infection. In controllers, they were related to an inflammation-modulating profile (glutamate and pyruvate) and a better adaptive immune system response (acetate) associated with resistance to progression. In the HESN group, with anti-inflammatory (lactate and phosphocholine) and virucidal (lactate) effects which constitute a protective profile in the sexual transmission of HIV. Concerning the significant metabolites of each group, we identified 24 genes involved in HIV-1 replication or virus proteins that were all altered in progressors but only partially in controllers and HESN. In summary, our results indicate that exposure to HIV-1 in HESN, as well as infection in progressors and controllers, affects the metabolism of individuals and that this affectation can be determined using NMR metabolomics.

biochemistry & molecular biology
Trans cohort metabolic reprogramming towards glutaminolysis in long-term successfully treated HIV-infection

Flora Mikaeloff,Sara Svensson Akusjärvi,George Mondinde Ikomey,Shuba Krishnan,Maike Sperk,Soham Gupta,Gustavo Daniel Vega Magdaleno,Alejandra Escós,Emilia Lyonga,Marie Claire Okomo,Claude Tayou Tagne,Hemalatha Babu,Christian L. Lorson,Ákos Végvári,Akhil C. Banerjea,Julianna Kele,Luke Elizabeth Hanna,Kamal Singh,João Pedro de Magalhães,Rui Benfeitas,Ujjwal Neogi

DOI: https://doi.org/10.1038/s42003-021-02985-3

IF: 6.548

2022-01-11

Communications Biology

Abstract:Abstract Despite successful combination antiretroviral therapy (cART), persistent low-grade immune activation together with inflammation and toxic antiretroviral drugs can lead to long-lasting metabolic flexibility and adaptation in people living with HIV (PLWH). Our study investigated alterations in the plasma metabolic profiles by comparing PLWH on long-term cART(>5 years) and matched HIV-negative controls (HC) in two cohorts from low- and middle-income countries (LMIC), Cameroon, and India, respectively, to understand the system-level dysregulation in HIV-infection. Using untargeted and targeted LC-MS/MS-based metabolic profiling and applying advanced system biology methods, an altered amino acid metabolism, more specifically to glutaminolysis in PLWH than HC were reported. A significantly lower level of neurosteroids was observed in both cohorts and could potentiate neurological impairments in PLWH. Further, modulation of cellular glutaminolysis promoted increased cell death and latency reversal in pre-monocytic HIV-1 latent cell model U1, which may be essential for the clearance of the inducible reservoir in HIV-integrated cells.

biology
Metabolic reprogramming of immune cells in HIV infection and treatment

Di Wu,Phoebe Xu

DOI: https://doi.org/10.1101/2024.09.26.615098

2024-09-29

Abstract:BACKGROUND: Immune cells undergo metabolic reprogramming, altering their energy production in response to HIV infection. During acute HIV infection, CD4+ T cells increase glycolysis to fuel viral replication and defense, but prolonged activation leads to immune exhaustion, with reduced T cell function and impaired pathogen elimination, contributing to AIDS progression. However, the details Metabolic dynamics of Immune Cells during HIV Infection (UT) and after receiving antiretroviral therapy (ART) remains unknown. Communication between Immune cells will be modified to response HIV infection, which can be mediated by metabolites. In this study, we deciphered Metabolic pathway dynamics of all Immune Cells by comparing UT and ART with seronegative controls (SN). Additionally, we investigate alteration of metabolite-mediated cell-cell communications in HIV Infection. METHODS: Single cell RNA sequencing (scRNA-seq) data of PBMC from SN, UT and ART were analyzed with KEGG Metabolic pathways by irGSEA and algorithm MEBOCOST to study cell-cell communications mediated by metabolites from sender cells and sensor proteins on receiver cells. RESULTS: lots of differentially expressed Metabolic Pathways were identified for immune cells, including Energy Production and Utilization, Lipid Metabolism, Amino Acid Metabolism, Glycosylation and Glycan Biosynthesis and Oxidative Stress and Antioxidant Defense. CONCLUSIONS: The analysis highlights the intricate metabolic interplay between monocytes and other immune cells, reflecting their central role in orchestrating immune responses through metabolite exchange. These insights may open avenues for therapeutic interventions, targeting metabolic pathways to enhance immune function or inhibit pathogen survival.

Immunology
Comprehensive Metabolomics Profiling Reveals Common Metabolic Alterations Underlying the Four Major Non-Communicable Diseases in Treated HIV Infection

Yingying Ding,Haijiang Lin,Xiaoxiao Chen,Bowen Zhu,Xiaohui Xu,Xiaoyi Xu,Weiwei Shen,Meiyang Gao,Na He

DOI: https://doi.org/10.1016/j.ebiom.2021.103548

IF: 11.205

2021-01-01

EBioMedicine

Abstract:Background: HIV infection and normal aging share immune and inflammatory changes that result in premature aging and non-communicable diseases (NCDs), but the exact pathophysiology is not yet uncovered. We identified the common metabolic pathways underlying various NCDs in treated HIV infection. Methods: We performed untargeted metabolomics including 87 HIV-negative (-) normal controls (NCs), 87 HIV-positive (+) NCs, and 148 HIV+ subjects with only one type of NCDs, namely, subclinical carotid atherosclerosis, neurocognitive impairment (NCI), liver fibrosis (LF) and renal impairment. All HIV+ subjects were virally suppressed. Results: HIV+ patients presented widespread alterations in cellular metabolism compared to HIV-NCs. Glycerophospholipid (GPL) metabolism was the only one disturbed pathway presented in comparisons including HIV-NCs across age groups, HIV+ NCs across age groups, HIV+ NCs vs HIV-NCs and each of HIV+ NCDs vs HIV+ NCs. D-glutamine and D-glutamate metabolism and alanine-aspartate-glutamate metabolism were presented in comparisons between HIV+ NCs vs HIV-NCs, HIV+ LF or HIV+ NCI vs HIV+ NCs. Consistently, subsequent analysis identified a metabolomic fingerprint specific for HIV+ NCDs, containing 42 metabolites whose relative abundance showed either an upward (mainly GPL-derived lipid mediators) or a downward trend (mainly plasmalogen phosphatidylcholines, plasmalogen phosphatidylethanolamines, and glutamine) from HIV-NCs to HIV+ NCs and then HIV+ NCDs, reflecting a trend of increased oxidative stress. Interpretation: GPL metabolism emerges as the common metabolic disturbance linking HIV to NCDs, followed by glutamine and glutamate metabolism. Together, our data point to the aforementioned metabolisms and related metabolites as potential key targets in studying pathophysiology of NCDs in HIV infection and developing therapeutic interventions. Funding: China National Science and Technology Major Projects on Infectious Diseases, National Natural Science Foundation of China, Yi-wu Institute of Fudan University, and Shanghai Municipal Health and Family Planning Commission. (c) 2021 The Author(s). Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/)
Systems Analysis of Gut Microbiome Influence on Metabolic Disease in HIV-Positive and High-Risk Populations

Abigail J S Armstrong,Kevin Quinn,Jennifer Fouquier,Sam X Li,Jennifer M Schneider,Nichole M Nusbacher,Katrina A Doenges,Suzanne Fiorillo,Tyson J Marden,Janine Higgins,Nichole Reisdorph,Thomas B Campbell,Brent E Palmer,Catherine A Lozupone

DOI: https://doi.org/10.1128/mSystems.01178-20

2021-05-18

mSystems

Abstract:Poor metabolic health, characterized by insulin resistance and dyslipidemia, is higher in people living with HIV and has been linked with inflammation, antiretroviral therapy (ART) drugs, and ART-associated lipodystrophy (LD). Metabolic disease is associated with gut microbiome composition outside the context of HIV but has not been deeply explored in HIV infection or in high-risk men who have sex with men (HR-MSM), who have a highly altered gut microbiome composition. Furthermore, the contribution of increased bacterial translocation and associated systemic inflammation that has been described in HIV-positive and HR-MSM individuals has not been explored. We used a multiomic approach to explore relationships between impaired metabolic health, defined using fasting blood markers, gut microbes, immune phenotypes, and diet. Our cohort included ART-treated HIV-positive MSM with or without LD, untreated HIV-positive MSM, and HR-MSM. For HIV-positive MSM on ART, we further explored associations with the plasma metabolome. We found that elevated plasma lipopolysaccharide binding protein (LBP) was the most important predictor of impaired metabolic health and network analysis showed that LBP formed a hub joining correlated microbial and immune predictors of metabolic disease. Taken together, our results suggest the role of inflammatory processes linked with bacterial translocation and interaction with the gut microbiome in metabolic disease among HIV-positive and -negative MSM.IMPORTANCE The gut microbiome in people living with HIV (PLWH) is of interest since chronic infection often results in long-term comorbidities. Metabolic disease is prevalent in PLWH even in well-controlled infection and has been linked with the gut microbiome in previous studies, but little attention has been given to PLWH. Furthermore, integrated analyses that consider gut microbiome, together with diet, systemic immune activation, metabolites, and demographics, have been lacking. In a systems-level analysis of predictors of metabolic disease in PLWH and men who are at high risk of acquiring HIV, we found that increased lipopolysaccharide-binding protein, an inflammatory marker indicative of compromised intestinal barrier function, was associated with worse metabolic health. We also found impaired metabolic health associated with specific dietary components, gut microbes, and host and microbial metabolites. This study lays the framework for mechanistic studies aimed at targeting the microbiome to prevent or treat metabolic endotoxemia in HIV-infected individuals.
Oxidative phosphorylation in HIV-1 infection: impacts on cellular metabolism and immune function

Natalia Rodriguez Rodriguez,Trinisia Fortune,Esha Hegde,Matthew Paltiel Weinstein,Aislinn M. Keane,Jesse F. Mangold,Talia H. Swartz

DOI: https://doi.org/10.3389/fimmu.2024.1360342

IF: 7.3

2024-03-11

Frontiers in Immunology

Abstract:Human Immunodeficiency Virus Type 1 (HIV-1) presents significant challenges to the immune system, predominantly characterized by CD4 + T cell depletion, leading to Acquired Immunodeficiency Syndrome (AIDS). Antiretroviral therapy (ART) effectively suppresses the viral load in people with HIV (PWH), leading to a state of chronic infection that is associated with inflammation. This review explores the complex relationship between oxidative phosphorylation, a crucial metabolic pathway for cellular energy production, and HIV-1, emphasizing the dual impact of HIV-1 infection and the metabolic and mitochondrial effects of ART. The review highlights how HIV-1 infection disrupts oxidative phosphorylation, promoting glycolysis and fatty acid synthesis to facilitate viral replication. ART can exacerbate metabolic dysregulation despite controlling viral replication, impacting mitochondrial DNA synthesis and enhancing reactive oxygen species production. These effects collectively contribute to significant changes in oxidative phosphorylation, influencing immune cell metabolism and function. Adenosine triphosphate (ATP) generated through oxidative phosphorylation can influence the metabolic landscape of infected cells through ATP-detected purinergic signaling and contributes to immunometabolic dysfunction. Future research should focus on identifying specific targets within this pathway and exploring the role of purinergic signaling in HIV-1 pathogenesis to enhance HIV-1 treatment modalities, addressing both viral infection and its metabolic consequences.

immunology
Mitochondrial DNA Profiling in A Cohort of Antiretroviral Treated HIV Patients in Lagos, Nigeria: Assessment of Long-Term Effects of cART on Life Quality of PLWH

Azuka Patrick Okwuraiwe,Disu Tajudeen,Stephnie Nwaiwu,Patrick Irurhe,Rosemary Ajuma Audu,Chika Kingsley Onwuamah,Rahaman A. Ahmed

DOI: https://doi.org/10.24018/ejmed.2022.4.3.1243

2022-06-23

European Journal of Medical and Health Sciences

Abstract:The use of combined antiretroviral therapy (cART) has turned HIV infection to a manageable condition, significantly reducing HIV-related morbidity and mortality globally. Risk of transmission has been substantially reduced in Africa where 67% of global infection is domiciled. However, long-term impact of cART on life quality of HIV patients elicits concern due to possible oxidative stress stimulus and accumulated toxicity. Mitochondrion, responsible for molecular metabolism in eukaryotes has been proposed as a marker for cellular dysfunction and ageing. Metabolic dysfunction due to accumulated oxidative stress may lead to mitochondrial DNA (mtDNA) mutation, protein alteration, and premature apoptosis leading to ageing. A cohort study comprising of 302 HIV infected persons receiving cART (Tenofovir, Lamivudine, Dolutegravir; TLD) at NIMR HIV reference clinic, and 113 healthy controls. Venous blood was collected in vacutainer tubes and plasma isolated. DNA extraction was done using NIMR-Biotech DNA Extraction kit, and mtDNA levels measured using SYBRGreen dye-based quantitative real-time PCR assay on Quant Studio 5. Primer sequences from human 12S ribosomal RNA with CCACGGGAAACAGCAGTGAT and CTATTGACTTGGGTTAATCGTGTGA as forward and reverse sequences respectively were used to amplify mtDNA locus. Melting curve was performed for every run to confirm successful amplification of targeted region. Total DNA from an immortalized Hela cell line, diluted in 10-fold serial dilutions, was used as standard curve. Plasma mtDNA levels were evaluated and data analyzed using IBM SPSS software (version 24). Among HIV infected individuals, 185 (88.1%) were female and mean age was 32±0.43 years while 36 (32%) and 27±0.57 years were female and mean age among controls, respectively. Mean CD4 count among HIV subjects was 427±29 cells/μl while 62.4% had less than 50 viral copies/ml. Majority of subjects (74.9%) were on first line cART while mean exposure to ART regimens was 4±0.3 years. No significant difference was observed between mtDNA concentration of HIV subjects (mean = 256±38 copies/μl) and healthy controls (mean: 247±72 copies/μl), neither among only HIV subjects, when stratified based on viral load or CD4 count. No association was observed between cell free (cf)-mtDNA and cART exposure among HIV patients. Lack of baseline information on initial cf-mtDNA among Africans was challenging in establishing that new ART regimens had enhanced recovery from mitochondrial-DAMP. There is need to continuously assess prolonged effect of cART to ensure good quality of life and healthy ageing for people living with HIV (PLWH).
Studying the Changes in Physical Functioning and Oxidative Stress-Related Molecules in People Living with HIV after Switching from Triple to Dual Therapy

Jessica Cusato,Anna Mulasso,Micol Ferrara,Alessandra Manca,Miriam Antonucci,Guido Accardo,Alice Palermiti,Gianluca Bianco,Francesco Chiara,Jacopo Mula,Maria Grazia Maddalone,Maria Cristina Tettoni,Simone Cuomo,Giulia Trevisan,Stefano Bonora,Giovanni Di Perri,Corrado Lupo,Alberto Rainoldi,Antonio D’Avolio

DOI: https://doi.org/10.3390/antiox13050518

IF: 7.675

2024-04-27

Antioxidants

Abstract:Background: Physical activity could increase the production of oxidative stress biomarkers, affecting the metabolism and excretion of antiretroviral drugs and, consequently, the clinical outcome. Nowadays, people living with HIV (PLWH) are mostly switching from triple to dual therapy, but no data are available in terms of physical functioning and oxidative stress. The aim of this study was to evaluate if some antioxidant biomarkers and physical functioning tests could be different according to triple or dual antiretroviral therapy. Methods: PLWH were evaluated at baseline (BL), while treated with three drugs, and six months after the switch to dual therapy. Physical functioning was quantified using validated tools. Mitochondrial and cytosol antioxidant molecules were evaluated through liquid chromatography. Results: Twenty-five patients were analyzed. A statistically significant difference between triple and dual therapy was found for mitochondrial glutathione, but not for physical tests. Evaluating differences between physically active and inactive individuals, the following statistically significant differences were suggested, considering triple therapy (mitochondrial n-formyl-methionine p = 0.022, triglycerides p = 0.023) and double therapy (mitochondrial glycine p = 0.035, cytosol glutamic acid p = 0.007, cytosol s-adenosylmethionine p = 0.021). Conclusions: For the first time, this study suggests possible differences in terms of antioxidant molecules and physical functioning in PLWH switching from triple to dual therapy.

biochemistry & molecular biology,chemistry, medicinal,food science & technology
Major depletion of insulin sensitivity-associated taxa in the gut microbiome of persons living with HIV controlled by antiretroviral drugs

Eugeni Belda,Jacqueline Capeau,Jean-Daniel Zucker,Emmanuelle Le Chatelier,Nicolas Pons,Florian Plaza Oñate,Benoit Quinquis,Rohia Alili,Soraya Fellahi,Christine Katlama,Karine Clément,Bruno Fève,Stéphane Jaureguiberry,Cécile Goujard,Olivier Lambotte,Joël Doré,Edi Prifti,Jean-Philippe Bastard

DOI: https://doi.org/10.1186/s12920-024-01978-5

2024-08-13

Abstract:Background: Persons living with HIV (PWH) harbor an altered gut microbiome (higher abundance of Prevotella and lower abundance of Bacillota and Ruminococcus lineages) compared to non-infected individuals. Some of these alterations are linked to sexual preference and others to the HIV infection. The relationship between these lineages and metabolic alterations, often present in aging PWH, has been poorly investigated. Methods: In this study, we compared fecal metagenomes of 25 antiretroviral-treatment (ART)-controlled PWH to three independent control groups of 25 non-infected matched individuals by means of univariate analyses and machine learning methods. Moreover, we used two external datasets to validate predictive models of PWH classification. Next, we searched for associations between clinical and biological metabolic parameters with taxonomic and functional microbiome profiles. Finally, we compare the gut microbiome in 7 PWH after a 17-week ART switch to raltegravir/maraviroc. Results: Three major enterotypes (Prevotella, Bacteroides and Ruminococcaceae) were present in all groups. The first Prevotella enterotype was enriched in PWH, with several of characteristic lineages associated with poor metabolic profiles (low HDL and adiponectin, high insulin resistance (HOMA-IR)). Conversely butyrate-producing lineages were markedly depleted in PWH independently of sexual preference and were associated with a better metabolic profile (higher HDL and adiponectin and lower HOMA-IR). Accordingly with the worst metabolic status of PWH, butyrate production and amino-acid degradation modules were associated with high HDL and adiponectin and low HOMA-IR. Random Forest models trained to classify PWH vs. control on taxonomic abundances displayed high generalization performance on two external holdout datasets (ROC AUC of 80-82%). Finally, no significant alterations in microbiome composition were observed after switching to raltegravir/maraviroc. Conclusion: High resolution metagenomic analyses revealed major differences in the gut microbiome of ART-controlled PWH when compared with three independent matched cohorts of controls. The observed marked insulin resistance could result both from enrichment in Prevotella lineages, and from the depletion in species producing butyrate and involved into amino-acid degradation, which depletion is linked with the HIV infection.
Plasma metabolomic profile is near-normal in people with HIV on long-term suppressive antiretroviral therapy

Ana Virseda-Berdices,Rubén Martín-Escolano,Juan Berenguer,Juan González-García,Oscar Brochado-Kith,David Rojo,Amanda Fernández-Rodríguez,Leire Pérez-Latorre,Victor Hontañón,Coral Barbas,Salvador Resino,María Ángeles Jiménez-Sousa

DOI: https://doi.org/10.3389/fcimb.2024.1340610

IF: 6.073

2024-03-15

Frontiers in Cellular and Infection Microbiology

Abstract:Background: Combination antiretroviral therapy (ART) has transformed human immunodeficiency virus (HIV) infection in people with HIV (PWH). However, a chronic state of immune activation and inflammation is maintained despite achieving HIV suppression and satisfactory immunological recovery. We aimed to determine whether the plasma metabolomic profile of PWH on long-term suppressive ART and immunologically recovered approximates the normality by comparison with healthy controls with similar age and gender. Methods: We carried out a cross-sectional study in 17 PWH on long-term ART (HIV-RNA <50 copies/mL, CD4 + ≥500 cells/mm 3 , and CD4 + /CD8 + ≥1) and 19 healthy controls with similar age and gender. Metabolomics analysis was performed by gas chromatography-mass spectrometry (GC-MS) and liquid chromatography-mass spectrometry (LC-MS). The statistical association analysis was performed by principal component analysis (PCA), partial least squares discriminant analysis (PLS-DA), and Generalized Linear Models (GLM) with a gamma distribution (log-link). Significance levels (p-value) were corrected for multiple testing (q-value). Results: PCA and PLS-DA analyses found no relevant differences between groups. Adjusted GLM showed 14 significant features (q-value<0.20), of which only three could be identified: lysophosphatidylcholine (LysoPC) (22:6) (q-value=0.148), lysophosphatidylethanolamine (LysoPE) (22:6) (q-value=0.050) and hydroperoxy-octadecatrienoic acid (HpOTrE)/dihydroperoxy-octadecatrienoic acid (DiHOTrE)/epoxy-octadecadienoic acid (EpODE) (q-value=0.136). These significant identified metabolites were directly correlated to plasma inflammatory biomarkers in PWH and negatively correlated in healthy controls. Conclusion: PWH on long-term ART have a metabolomic profile that is almost normal compared to healthy controls. Nevertheless, residual metabolic alterations linked to inflammatory biomarkers persist, which could favor the development of age-related comorbidities among this population.

immunology,microbiology
An Observational Study on Metabolic Derangements in People Living with HIV

Pallab Sinha,Nandini Chatterjee,Souvik Ghatak,Pranab Maity,Krisanko Das,Sourin Mukherjee,Avishek Guin,Shantasil Pain,Jyotirmoy Pal

DOI: https://doi.org/10.5005/japi-11001-0109

Abstract:Background: HIV infection is a global pandemic. The adult HIV prevalence in India is 0.22%. Successful therapy is transforming HIV into a chronic medical condition, and there are many metabolic complications. This study aimed to evaluate the metabolic abnormalities in people living with HIV (PLHIV) who were on antiretroviral therapy (ART) for at least 2 years and compare it with ART-naïve patients as well as the effect of protease inhibitor-based (PI-based) and non-protease inhibitor-based (non-PI-based) ART was assessed. Methodology: Adult HIV-positive patients both ART-naïve and on ART for more than 2 years were included. Detailed history and clinical examination, including blood pressure and anthropometric measurements were done. This was followed by investigations like lipid profile including total cholesterol, triglyceride, high-density lipoprotein-cholesterol (HDL-C), low-density lipoprotein-cholesterol (LDL-C), fasting plasma glucose, and hemoglobin A1c (HbA1C) estimation. Standard statistical tools were utilized to assess derangements and association to therapy. Results: The study was conducted for 1.5 years in a tertiary care hospital. A total of 70% of the study population was male with mean age of participants being 43.2 years, 40% were ART-naïve, 37% received non-PI-based ART, and 23% PI-based ART. The mean total cholesterol level and mean triglyceride value were significantly higher in the PI-based ART group than in the therapy-naïve group. The ART-naïve group was seen to have more subjects with abnormally low HDL-C values. The PI-based ART study subjects were found to have a greater number of cases of glucose intolerance in relation to the rest of the two groups significantly (p-value <0.001). The LDL-C systolic blood pressure (SBP), diastolic blood pressure (DBP), body mass index (BMI), and waist circumference had no association with the different ART regimens or with the HIV infection itself. CD4 T cell count at diagnosis in the three study groups was compared with all the variables of metabolic syndrome and no association was found. Conclusion: Total cholesterol, triglycerides, and glucose levels are the main parameters found to be affected in PLHIV on therapy.
Muscle and liver lactate metabolism in HAART-treated and naive HIV-infected patients: the MITOVIR study

Jade Ghosn,Marguerite Guiguet,Claude Jardel,Rabah Benyaou,Valérie Zeller,Anne Simon,Marc-Antoine Valantin,Bahia Amellal,Lambert Assoumo,Jean-Yves Hogrel,Dominique Costagliola,Christine Katlama,Anne Lombès

Abstract:Objective: To assess the impact of nucleoside analogue reverse transcriptase inhibitor (NRTI) combination therapy on muscle and liver lactate metabolism in HIV-infected patients. Methods: This cross-sectional study involved HIV-infected patients who were either antiretroviral-naive (Group 1) or were receiving either a stable triple-drug combination including at least one d-drug (zidovudine, zalcitabine, stavudine, didanosine; Group 2) or a backbone of abacavir and lamivudine (Group 3). Lactataemia was measured at rest. Muscle lactate metabolism was assessed during a standardized exercise test and liver lactate metabolism during intravenous lactate infusion. Mitochondrial DNA was quantified in peripheral blood mononuclear cells. Results: A total of 65 patients were enrolled (16, 31 and 18 patients in Group 1, Group 2 and Group 3, respectively). None of the patients had symptoms of hyperlactataemia. Patients in Group 3 had received d-drugs for a median of seven years before switching to abacavir and lamivudine. Median baseline lactataemia, although within the normal range, was significantly higher in both treatment groups than in the naive patients (Group 2: 1.4, Group 3: 1.5, and Group 1: 1.0 mmol/l, P = 0.005). Muscle lactate clearance was significantly lower in both treatment groups than in naive patients (Group 2: 1.6, Group 3: 1.8, and Group 1: 2.1, P = 0.01). Lactate liver metabolism and mitochondrial DNA levels did not differ among the three groups. Conclusions: In HIV-infected patients without symptomatic hyperlactataemia, all NRTI-containing HAART regimens appear to cause muscle mitochondrial damage but to spare the liver. Absence of difference between Group 2 and Group 3 raises questions about the potential reversibility of muscle mitochondrial dysfunction, and/or the ability of abacavir and lamivudine to induce such mitochondrial damage.
High-throughput proteomic analysis reveals systemic dysregulation in virally suppressed people living with HIV

Nadira Vadaq,Yue Zhang,Wilhelm A.J.W. Vos,Albert L. Groenendijk,Martinus J.T. Blaauw,Louise E. van Eekeren,Maartje C.P. Jacobs-Cleophas,Lisa Van de Wijer,Jéssica Cristina dos Santos,Muhammad Hussein Gasem,Leo A.B. Joosten,Mihai G. Netea,Quirijn de Mast,Jingyuan Fu,André J.A.M. van der Ven,Vasiliki Matzaraki

DOI: https://doi.org/10.1172/jci.insight.166166

IF: 9.4958

2023-04-20

JCI Insight

Abstract:BACKGROUND: People living with HIV (PLHIV) on antiretroviral therapy (ART) exhibit persistent immune dysregulation and microbial dysbiosis, leading to the development of cardiovascular diseases (CVD). We initially compared plasma proteomic profiles between 205 PLHIV and 120 healthy controls (HCs) and validated the results in an independent cohort of 639 PLHIV and 99 HCs. Differentially expressed proteins (DEPs) were then associated to microbiome data. Finally, we assessed which proteins were linked with CVD development in PLHIV.METHOD: Proximity extension assay technology was utilized to measure 1472 plasma proteins. Markers of systemic inflammation (CRP, D-Dimer, IL6, sCD14, and sCD163) and microbial translocation (IFABP) were measured by ELISA, and gut bacterial species were identified using shotgun metagenomic sequencing. Baseline CVD data were available for all PLHIV, and 205 PLHIV were recorded for the development of CVD during a 5-year follow-up.RESULTS: PLHIV on ART displayed systemic dysregulation of protein concentrations compared to HCs. Most of the DEPs originated from the intestine and lymphoid tissues, while they enriched in immune- and lipid metabolism-related pathways. Furthermore, we observed that DEPs originating from the intestine were associated with specific gut bacterial species. Finally, we identified upregulated proteins in PLHIV (GDF15, PLAUR, RELT, NEFL, COL6A3, and EDA2R), unlike most markers of systemic inflammation, associated with the presence and risk of developing CVD in 5-year follow-up.CONCLUSIONS: Our findings suggest a systemic dysregulation of protein concentrations in PLHIV, of which some proteins were associated with CVD development. Most of DEPs originated from the gut and were related to specific gut bacterial species.TRIAL REGISTRATION: Cohorts included in this study are part of the Human Functional Genomics Project (HFGP) (www.humanfunctionalgenomics.org). The 2000HIV Human Functional Genomics Partnership Program is registered at ClinicalTrials.gov: (ID: NCT03994835).FUNDING: The 200HIV and 2000HIV studies are supported by the AIDS-fonds (#P-29001, Netherlands) and a ViiV healthcare grant (A18-1052), respectively; The ViiV healthcare grant was awarded to A.V., M.G.N., L.A.B.J., and Q.d.M; The Spinoza Prize (NWO SPI94-212) and ERC Advanced grant (no. 833247) were awarded to M.G.N; The Indonesia Endowment Fund for Education (LPDP) given by the Ministry of Finance of the Republic of Indonesia was awarded to N.V.

medicine, research & experimental
Multi-omics analyses reveal that HIV-1 alters CD4+ T cell immunometabolism to fuel virus replication

Haitao Guo,Qi Wang,Khader Ghneim,Li Wang,Elena Rampanelli,Elizabeth Holley-Guthrie,Liang Cheng,Carolina Garrido,David M. Margolis,Leigh A. Eller,Merlin L. Robb,Rafick-Pierre Sekaly,Xian Chen,Lishan Su,Jenny P.-Y. Ting

DOI: https://doi.org/10.1038/s41590-021-00898-1

IF: 30.5

2021-03-25

Nature Immunology

Abstract:Individuals infected with human immunodeficiency virus type-1 (HIV-1) show metabolic alterations of CD4+ T cells through unclear mechanisms with undefined consequences. We analyzed the transcriptome of CD4+ T cells from patients with HIV-1 and revealed that the elevated oxidative phosphorylation (OXPHOS) pathway is associated with poor outcomes. Inhibition of OXPHOS by the US Food and Drug Administration–approved drug metformin, which targets mitochondrial respiratory chain complex-I, suppresses HIV-1 replication in human CD4+ T cells and humanized mice. In patients, HIV-1 peak viremia positively correlates with the expression of NLRX1, a mitochondrial innate immune receptor. Quantitative proteomics and metabolic analyses reveal that NLRX1 enhances OXPHOS and glycolysis during HIV-1-infection of CD4+ T cells to promote viral replication. At the mechanistic level, HIV infection induces the association of NLRX1 with the mitochondrial protein FASTKD5 to promote expression of mitochondrial respiratory complex components. This study uncovers the OXPHOS pathway in CD4+ T cells as a target for HIV-1 therapy.

immunology
Plasma metabolic changes in Chinese HIV-infected patients receiving lopinavir/ritonavir based treatment: Implications for HIV precision therapy

Xiaolin Li,Tong Wu,Yongjun Jiang,Zining Zhang,Xiaoxu Han,Wenqing Geng,Haibo Ding,Jing Kang,Qi Wang,Hong Shang

DOI: https://doi.org/10.1016/j.cyto.2018.05.001

IF: 3.926

Cytokine

Abstract:Objectives: The goal of this study is to profile the metabolic changes in the plasma of HIV patients receiving lopinavir/ritonavir (LPV/r)-based highly active antiretroviral therapy (HAART) relative to their treatment-naïve phase, aimed to identify precision therapy for HIV for improving prognosis and predicting dyslipidemia caused by LPV/r. Methods: 38 longitudinal plasma samples were collected from 19 HIV-infected patients both before and after antiretroviral therapy, and 18 samples from healthy individuals were used as controls. Untargeted metabolomics profiling of these plasma samples was performed using liquid chromatography-mass spectrometry (LC-MS) and gas chromatography-mass spectrometry (GC-MS). Results: A total of 331 compounds of known identity were detected among these metabolites, a 67-metabolite signature mainly mapping to tryptophan, histidine, acyl carnitine, ketone bodies and fatty acid metabolism distinguished HIV patients from healthy controls. The levels of 19 out of the 67 altered metabolites including histidine, kynurenine, and 3-hydroxybutyrate (BHBA), recovered after LPV/r-based antiretroviral therapy, and histidine was positively correlated with the presence of CD4 + T lymphocytes. Furthermore, using receiver operating characteristic (ROC) analyses, we discovered that butyrylcarnitine in combination with myristic acid from plasma in treatment-naïve patients could predict dyslipidemia caused by LPV/r with 87% accuracy. Conclusions: Metabolites alterations in treatment-naïve HIV patients may indicate an inflammatory, oxidative state and mitochondrial dysfunction that is permissive for disease progression. Histidine may provide a specific protective function for HIV patients. Besides, elevated fatty acids levels including butyrylcarnitine and myristic acid after infection may indicate patients at risk of suffering from dyslipidemia after LPV/r-based HAART.
Amino acid metabolism dysregulation associated with inflammation and insulin resistance in HIV-infected individuals with metabolic disorders

Jing Zhang,Yanfang Chen,Mingli Wang,Liuting Zhong,Linghua Li,Zhongwen Yuan,Shangrong Zou

DOI: https://doi.org/10.1007/s00726-023-03325-x

IF: 3.7891

Amino Acids

Abstract:Amino acid metabolic profile, particularly its association with clinical characteristics, remains unclear in patients with human immunodeficiency virus (HIV) infection and acquired immune deficiency syndrome (AIDS) combined with metabolic disorders. In this study, we performed targeted metabolomic analyses on 64 patients with HIV/AIDS and 21 healthy controls. Twenty-four amino acids and selected intermediate metabolites in the serum were quantitatively detected using high-performance liquid chromatography-tandem mass spectrometry, and characteristic changes and metabolic pathways were analyzed in HIV-infected patients with different degrees of abnormal glucose and lipid metabolism. Spearman's partial correlation was used to analyze the association between amino acids, biochemical parameters, and inflammatory cytokines. The results showed that the main metabolic pathways of the eighteen differential metabolites involved were arginine biosynthesis and metabolism, methionine cycle, and tryptophan metabolism. Fourteen differential amino acid metabolites were positively correlated with nine inflammatory cytokines, including TNF-α, C-reactive protein, IL-1β, and galectin-3 (FDR < 0.1). Kynurenine, ornithine, and homocysteine were positively correlated with fasting blood glucose and insulin resistance index (FDR < 0.1). Our study revealed a multi-pathway imbalance in amino acid metabolism in patients with HIV/AIDS, which was significantly correlated with inflammation and insulin resistance.

Consequences of Intraspecific Predation: A Stage Structured Population Model Approach

Increased Microbial Translocation is a Prognostic Biomarker of Different Immune Responses to ART in People Living with HIV

Altered plasma metabolites and inflammatory networks in HIV-1 infected patients with different immunological responses after long-term antiretroviral therapy

Temporal Changes in Plasma Metabolic Signatures to Predict Immune Response of Antiretroviral Therapy among People Living with HIV.

Metabolic and mitochondrial dysregulation in CD4+ T cells from HIV-positive women on combination anti-retroviral therapy

Plasma metabolomics by nuclear magnetic resonance reveals biomarkers and metabolic pathways associated with the control of HIV-1 infection/progression

Trans cohort metabolic reprogramming towards glutaminolysis in long-term successfully treated HIV-infection

Metabolic reprogramming of immune cells in HIV infection and treatment

Comprehensive Metabolomics Profiling Reveals Common Metabolic Alterations Underlying the Four Major Non-Communicable Diseases in Treated HIV Infection

Systems Analysis of Gut Microbiome Influence on Metabolic Disease in HIV-Positive and High-Risk Populations

Oxidative phosphorylation in HIV-1 infection: impacts on cellular metabolism and immune function

Mitochondrial DNA Profiling in A Cohort of Antiretroviral Treated HIV Patients in Lagos, Nigeria: Assessment of Long-Term Effects of cART on Life Quality of PLWH

Studying the Changes in Physical Functioning and Oxidative Stress-Related Molecules in People Living with HIV after Switching from Triple to Dual Therapy

Major depletion of insulin sensitivity-associated taxa in the gut microbiome of persons living with HIV controlled by antiretroviral drugs

Plasma metabolomic profile is near-normal in people with HIV on long-term suppressive antiretroviral therapy

An Observational Study on Metabolic Derangements in People Living with HIV

Muscle and liver lactate metabolism in HAART-treated and naive HIV-infected patients: the MITOVIR study

High-throughput proteomic analysis reveals systemic dysregulation in virally suppressed people living with HIV

Multi-omics analyses reveal that HIV-1 alters CD4+ T cell immunometabolism to fuel virus replication

Plasma metabolic changes in Chinese HIV-infected patients receiving lopinavir/ritonavir based treatment: Implications for HIV precision therapy

Amino acid metabolism dysregulation associated with inflammation and insulin resistance in HIV-infected individuals with metabolic disorders