Retrograde ejaculation associated spontaneous sperm cystolithiasis in four rhesus macaques (Macaca mulatta).

S. Gumber,C. Courtney,K. Strait,Prachi Sharma,Julie E Freebersyser,M. Crane

DOI: https://doi.org/10.1016/j.etp.2013.05.003

2013-11-01

Abstract:

What problem does this paper attempt to address?

Molecular Mechanism of Interaction Between Tomato and Leaf Mold Pathogen Cladosporium Fulvum

WANG Chang-chun,CAI Xin-zhong,XU You-ping

DOI: https://doi.org/10.3321/j.issn:0412-0914.2006.05.001

2006-01-01

Abstract:The pathosystem of tomato and leaf mold fungal pathogen Cladosporium fulvum is a model system to study molecular mechanism of interaction between plant and pathogen.Four C.fulvum avirulence(Avr) genes have been cloned.All the Avr genes encode small molecular weight proteins with even numbers of cysteines,and their existence and variance are different in the virulent strains.Avr4 is of chitin-binding activity,while Avr9 might be involved in nitrogen regulation in the fungus.Seven functional tomato resistance(R) genes to C.fulvum have been cloned.They are clustered with nonfunctional homologues in complex loci and named as Hcr(homologues of C.fulvum resistance gene Cf) genes.The Cf proteins,which are anchored at plasma membrane with the main body outside,mainly consist of a leucine-rich repeat(LRR) and a transmembrane domain.Recognition of an Avr by the complementary Cf complies with the "guard" hypothesis.In re-(cognition) complex of Avr2 by Cf-2,the guarded protein is protease Rcr3.Avr recognition by a Cf rapidly eli-(cits) downstream signaling and defense responses,including occurrence of hypersensitive response(HR) and oxidative burst,activation of K~+ ion channel,a variety of protein kinases,SGT1,thioredoxin and phosphati-(dic) acid signaling pathway.Environmental conditions,including temperature,humidity and light,significantly affect Cf-dependent HR and resistance.Different Cf/Avr interactions might be distinct in Avr recognition and downstream signal transduction pathways.
Specific Recognition of AVR4 and AVR9 Results in Distinct Patterns of Hypersensitive Cell Death in Tomato, but Similar Patterns of Defence-Related Gene Expression.

Xinzhong Cai,Frank L. W. Takken,Matthieu H. A. J. Joosten,Pierre J. G. M. De Wit

DOI: https://doi.org/10.1046/j.1364-3703.2001.00053.x

IF: 4.9

2001-01-01

Molecular Plant Pathology

Abstract:Summary Hypersensitive cell death occurs in tomato seedlings that are derived from a cross between plants that express a resistance (Cf) gene against the pathogenic fungus Cladosporium fulvum and plants that contain the matching avirulence (Avr) gene originating from this fungus. The pattern of Cf-9/Avr9- and Cf-4/Avr4-induced necrosis in these F(1) seedlings was found to differ significantly. Macroscopic observation revealed that in F(1) tomato seedlings containing both Cf-9 and Avr9, numerous necrotic spots developed that were scattered over the entire cotyledon, while the midvein and primary veins remained unaffected. In seedlings containing both Cf-4 and Avr4, however, initially only one or a few necrotic spots developed on each cotyledon, in most cases in the midvein and occasionally in primary veins. Subsequently, these spots turned rapidly into lesions that enlarged along the midvein and primary veins, eventually causing the cotyledons to wilt and abscise. These observations were confirmed by detailed histological studies. Production of the AVR proteins in adult tomato plants carrying the matching Cf gene, employing potato virus X, resulted in similar patterns of necrosis. RNA gel blot analysis demonstrated that both Avr4 and Avr9, controlled by the CaMV 35S promoter, were highly expressed in seedlings already at one day post-emergence, indicating that the distinct necrotic patterns are not due to differences in Avr expression levels. We have analysed the expression of many genes involved in defence signalling pathways and the defence response itself, during the onset of the Cf/Avr-initiated hypersensitive response (HR). Although most of the genes were expressed stronger and faster in Cf-4/Avr4 seedlings than in Cf-9/Avr9 seedlings at the onset of HR, no significant qualitative differences in the expression of genes involved in downstream signalling were observed when Cf-4/Avr4- and Cf-9/Avr9-induced defence responses were compared.
Attenuation of Cf-mediated defense responses at elevated temperatures correlates with a decrease in elicitor-binding sites.

Camiel F. de Jong,Frank L. W. Takken,Xinzhong Cai,Pierre J. G. M. de Wit,Matthieu H. A. J. Joosten

DOI: https://doi.org/10.1094/MPMI.2002.15.10.1040

IF: 3.4218

2007-01-01

Molecular Plant-Microbe Interactions

Abstract:The interaction between the fungal pathogen Cladosporium fulvum and its only host, tomato, is a well-described gene-for-gene system and several resistance (Cf) genes of tomato and matching fungal avirulence (Avr) genes have been characterized. Transgenic tobacco suspension cells expressing Cf genes respond to matching elicitors with typical defense responses, such as medium alkalization and an oxidative burst. We found that this response is attenuated at elevated ambient temperatures. Tomato seedlings expressing both a Cf and the matching Avr gene rapidly die as a result of systemic necrosis at normal temperatures, but are rescued at 33degreesC. We demonstrate that, at 33degreesC, the Cf/Avr-mediated induction of defense-related genes is reversibly suppressed. Furthermore, in cell suspensions, the AVR-induced medium alkalization response is slowly suppressed upon incubation at 33degreesC, but is quickly restored after transfer to lower temperatures. A high-affinity binding site (HABS) for AVR9 is present on plasma membranes isolated from solanaceous plants and has been suggested to act as a co-receptor for AVR9. The amount of AVR9-HABS is 80% reduced in tobacco cell suspensions incubated at 33degreesC, as compared with cell suspensions incubated at 20degreesC. Our data suggest that the temperature sensitivity of Cf-mediated defense responses resides at the level of perception of the fungal avirulence factors.
Genetic and molecular analysis of tomato Cf genes for resistance to Cladosporium fulvum

C M Thomas,M S Dixon,M Parniske,C Golstein,J D Jones

DOI: https://doi.org/10.1098/rstb.1998.0296

1998-09-29

Abstract:In many plant-pathogen interactions resistance to disease is controlled by the interaction of plant-encoded resistance (R) genes and pathogen-encoded avirulence (Avr) genes. The interaction between tomato and the leaf mould pathogen Cladosporium fulvum is an ideal system to study the molecular basis of pathogen perception by plants. A total of four tomato genes for resistance to C. fulvum (Cf-2, Cf-4, Cf-5 and Cf-9) have been isolated from two genetically complex chromosomal loci. Their gene products recognize specific C. fulvum-encoded avirulence gene products (Avr2, Avr4, Avr5 and Avr9) by an unknown molecular mechanism. Cf genes encode extracellular membrane-anchored glycoproteins comprised predominantly of 24 amino acid leucine-rich repeats (LRRs). Cf genes from the same locus encode proteins which are more than 90% identical. Most of the amino-acid sequence differences correspond to the solvent-exposed residues within a beta-strand/beta-turn structural motif which is highly conserved in LRR proteins. Sequence variability within this motif is predicted to affect the specificity of ligand binding. Our analysis of Cf gene loci at the molecular level has shown they comprise tandemly duplicated homologous genes, and suggests a molecular mechanism for the generation of sequence diversity at these loci. Our analysis provides further insight into the molecular basis of pathogen perception by plants and the organization and evolution of R gene loci.
Sequential breakdown of the Cf‐9 leaf mould resistance locus in tomato by Fulvia fulva

Silvia de la Rosa,Christiaan R. Schol,Ángeles Ramos Peregrina,David J. Winter,Anne M. Hilgers,Kazuya Maeda,Yuichiro Iida,Mariana Tarallo,Ruifang Jia,Henriek G. Beenen,Mercedes Rocafort,Pierre J. G. M. de Wit,Joanna K. Bowen,Rosie E. Bradshaw,Matthieu H. A. J. Joosten,Yuling Bai,Carl H. Mesarich

DOI: https://doi.org/10.1111/nph.19925

IF: 9.4

2024-06-25

New Phytologist

Abstract:Summary Leaf mould, caused by Fulvia fulva, is a devastating disease of tomato plants. In many commercial tomato cultivars, resistance to this disease is governed by the Cf‐9 locus, which encodes five paralogous receptor‐like proteins. Two of these proteins confer resistance: Cf‐9C recognises the previously identified F. fulva effector Avr9 and provides resistance during all plant growth stages, while Cf‐9B recognises the yet‐unidentified F. fulva effector Avr9B and provides mature plant resistance only. In recent years, F. fulva strains have emerged that can overcome the Cf‐9 locus, with Cf‐9C circumvented through Avr9 deletion. To understand how Cf‐9B is circumvented, we set out to identify Avr9B. Comparative genomics, transient expression assays and gene complementation experiments were used to identify Avr9B, while gene sequencing was used to assess Avr9B allelic variation across a world‐wide strain collection. A strict correlation between Avr9 deletion and resistance‐breaking mutations in Avr9B was observed in strains recently collected from Cf‐9 cultivars, whereas Avr9 deletion but no mutations in Avr9B were observed in older strains. This research showcases how F. fulva has evolved to sequentially break down the Cf‐9 locus and stresses the urgent need for commercial tomato cultivars that carry novel, stacked resistance genes active against this pathogen.

plant sciences
High humidity represses Cf-4/Avr4- and Cf-9/Avr9 -dependent hypersensitive cell death and defense gene expression

Changchun Wang,Xinzhong Cai,Zhong Zheng

DOI: https://doi.org/10.1007/s00425-005-0036-8

IF: 4.54

2005-01-01

Planta

Abstract:Gene-for-gene resistance is a well-known type of plant disease resistance. It is governed by plant resistance ( R ) genes and their matching pathogen avirulence ( Avr ) genes. This resistance is characterized by a hypersensitive response (HR) resulting from the interaction between products of a complementary R and Avr gene pair. The pathosystem of tomato ( Lycopersicon esculentum Mill.) and its leaf mold fungal pathogen Cladosporium fulvum is a model system to study gene-for-gene resistance. HR occurs in tomato seedlings carrying a tomato Cf resistance gene and a matching C. fulvum Avr gene, including, for example, Cf-4/Avr4 and Cf-9/Avr9 . Employing Cf/Avr tomato seedlings that both express a Cf gene and the matching Avr gene, here we report that both Cf-4/Avr4- and Cf-9/Avr9 -dependent HR is delayed and reduced under high humidity (95%), and that Cf-9/Avr9 -dependent HR is more sensitive to high humidity when compared to Cf-4/Avr4 -dependent HR. Furthermore, high humidity acts synergistically with high temperature on HR suppression, resulting in complete blocking of the HR. The transcript profile of over 60 genes, related to HR, signaling and defense, in Cf/Avr seedlings grown under high humidity and thus showing no HR, significantly differed from that of the same seedlings grown under normal humidity and thus showing HR. These results demonstrate that high humidity probably acts at a very early point of the Cf downstream signaling pathway, or alternatively influences the interaction between the Cf and the Avr proteins.
Transcript Profiling for Avr4/Cf-4- and Avr9/Cf-9-dependent Defence Gene Expression

Jin-Wen Zhu,You-Ping Xu,Zhi-Xin Zhang,Wen-Yuan Cao,Xin-Zhong Cai

DOI: https://doi.org/10.1007/s10658-008-9294-1

2008-01-01

European Journal of Plant Pathology

Abstract:Tomato Cf genes confer resistance to the leaf mold pathogen Cladosporium fulvum. The Avr4/Cf-4- and Avr9/Cf-9-dependent hypersensitive responses (HRs) are distinct in cell death pattern, intensity, and sensitivity to environmental conditions. To understand the mechanism resulting in these differences, comparative transcript profiling for Avr4/Cf-4- and Avr9/Cf-9-dependent defence gene expression by cDNA-AFLP was performed previously. 367 ACE (Avr/Cf-elicited) transcript-derived fragments (TDFs) were identified, among which 189 were cloned and sequenced. In this study, we report another 89 ACE fragments. These ACE genes were associated with: defence, signal transduction, HR and cell death, transcriptional regulation, metabolism, protein synthesis, photosynthesis, membrane fusion, secretion and trafficking, miscellaneous biological processes, and genes with unknown function or with no significant similarity to known sequences. Among these sequences 43 (potentially encoding 36 types of proteins) were identified for the first time as genes differentially expressed during the development of Avr/Cf-dependent HR. Sequence and expression data from this study further support that transcription is reprogrammed to promote defence response and HR and repress photosynthesis in the Avr/Cf HR+ seedlings.
Progress of Infecting and Resistant Mechanism in Tomato Leaf Mould

王晓艳,汪炳良

DOI: https://doi.org/10.3865/j.issn.1001-3547.2008.14.001

2008-01-01

Abstract:Tomato leaf mould is a worldwide disease,which is caused by Cladosporim fulvum (Cook) Ciferrd.Since 1980s, with the development of tomato production under protected condition,tomato leaf mould has become the most extensive leaf disease.Leaf mould has such bad effects on tomato that it seriously affects tomato production and quality.This article mainly summarizes infecting mechanism of tomato leaf mould,the differentiation of physiological races,and resistance mechanism of tomato leaf mould.
Allelic variation in the effector genes of the tomato pathogen Cladosporium fulvum reveals different modes of adaptive evolution

Ioannis Stergiopoulos,Maarten J D De Kock,Pim Lindhout,Pierre J G M De Wit

DOI: https://doi.org/10.1094/MPMI-20-10-1271

Abstract:The allelic variation in four avirulence (Avr) and four extracellular protein (Ecp)-encoding genes of the tomato pathogen Cladosporium fulvum was analyzed for a worldwide collection of strains. The majority of polymorphisms observed in the Avr genes are deletions, point mutations, or insertions of transposon-like elements that are associated with transitions from avirulence to virulence, indicating adaptive evolution of the Avr genes to the cognate C. fulvum resistance genes that are deployed in commercial tomato lines. Large differences in types of polymorphisms between the Avr genes were observed, especially between Avr2 (indels) and Avr4 (amino-acid substitutions), indicating that selection pressure favors different types of adaptation. In contrast, only a limited number of polymorphisms were observed in the Ecp genes, which mostly involved synonymous modifications. A haplotype network based on the polymorphisms observed in the effector genes revealed a complex pattern of evolution marked by reticulations that suggests the occurrence of genetic recombination in this presumed asexual fungus. This, as well as the identification of strains with identical polymorphisms in Avr and Ecp genes but with opposite mating-type genes, suggests that development of complex races can be the combined result of positive selection and genetic recombination.
Three years of experience in biomanipulating a small eutrophic lake: Lago di Candia (Northern Italy)

G. Giussani,R. D. Bernardi,T. Ruffoni

DOI: https://doi.org/10.1007/BF02530353

IF: 2.822

1990-08-01

Hydrobiologia

Abstract:
The molecular basis of co-evolution between Cladosporium fulvum and tomato

Pierre J G M de Wit,B F Brandwagt,H A van den Burg,X Cai,R A L van der Hoorn,C F de Jong,J van Klooster,M J D de Kock,M Kruijt,W H Lindhout,R Luderer,F L W Takken,N Westerink,J J M Vervoort,M H A J Joosten

DOI: https://doi.org/10.1023/a:1020553120889

Antonie van Leeuwenhoek

Abstract:Cladosporiumfulvum is a semi-biotrophic pathogen, which causes leaf mold of tomato (Lycopersicon spp.). In our laboratory this pathosystem serves as a model to study gene-for-gene interactions between plants and pathogenic fungi (Joosten & De Wit 1999). Many avirulence (Avr) genes and matching resistance (CQ) genes have been cloned and we are now beginning to understand how their products can induce an array of plant defense responses, including the classic hypersensitive response (HR). Here, we will discuss the latest results of our molecular studies on this interaction. These include the isolation of: (i) two new Avr genes, Avr2 and Avr4E, (ii) the determination of the specificity determinants within the Cf-4 and Cf-9 genes by artificial domain swaps and introduction of point mutations, (iii) the analysis of polymorphism occurring in AVR9-responsive Cf genes occurring in natural populations of L. pimpinellifolium, and finally (iv) the description of an efficient method to identify early HR-related genes.
Unilateral multilevel interlaminar fenestration instead of laminectomy or hemilaminectomy: an alternative surgical approach to intraspinal space-occupying lesions. Technical note.

Dorothee Koch-Wiewrodt,W. Wagner,A. Perneczky

DOI: https://doi.org/10.3171/SPI.2007.6.5.485

2007-09-12

Abstract:Laminectomy is the most conventional dorsal approach to intraspinal space-occupying lesions and may result in gradually increasing instability or deformity of the vertebral column. Less invasive procedures such as hemilaminectomy and osteoplastic laminotomy have been described by other authors, but an approach that interferes with spinal stability to an even lesser extent seems desirable. In an attempt to further reduce the need for bone removal, the authors used interlaminar fenestration (mostly unilateral) at one or more spinal levels to remove intramedullary, extramedullary, or extradural lesions, and even some lesions that extended over several spine segments. The authors present their experiences with this surgical approach in 78 patients harboring different intraspinal lesions. Up to 16 segments were fenestrated in one patient. Complete removal of the lesion was possible in most patients, and no postoperative spinal instabilities were observed in up to 8 years of follow up. Multilevel interlaminar fenestration, also called "multiple spinal keyhole surgery," is a feasible, safe, and effective approach to intraspinal lesions.
Cladosporium fulvum overcomes Cf-2-mediated resistance by producing truncated AVR2 elicitor proteins

Rianne Luderer,Frank L W Takken,Pierre J G M de Wit,Matthieu H A J Joosten

DOI: https://doi.org/10.1046/j.1365-2958.2002.03060.x

Abstract:The Cf-2 gene of tomato confers resistance to strains of the biotrophic pathogenic fungus Cladosporium fulvum carrying avirulence gene Avr2. To allow dissection of the biochemical mechanism of perception of AVR2 by Cf-2, we set out to clone the Avr2 gene. Here, we report the functional cloning of Avr2 cDNA, based on the induction of a hypersensitive response (HR) by the encoded AVR2 protein in Cf2 tomato plants. Analysis of strains of C. fulvum that are virulent on Cf2 tomato lines revealed various independent frameshift mutations in the Avr2 open reading frame (ORF) and a point mutation resulting in a premature stop codon. All modifications result in the production of truncated AVR2 proteins. Interestingly, an additional modification involves the insertion of a LINE-like element, Cfl1, in the Avr2 ORF. Cfl1 is the first LINE-like element identified in C. fulvum and provides the first example of loss of avirulence of a plant pathogen caused by insertion of a retrotransposable element in an Avr gene. Rcr3 represents an additional plant protein that is specifically required for Cf-2-mediated resistance. Analysis of two different rcr3 mutant Cf2 tomato plants revealed that their ability to respond to AVR2 with a HR correlates with their degree of resistance to AVR2-producing strains of C. fulvum. These data support a role for Rcr3 in the perception of AVR2 by Cf-2.
Mapping of the Cladosporium fulvum resistance gene Cf-16, a major gene involved in leaf mold disease in tomato

Dongye Zhang,Huijia Li,Guan Liu,Libo Xie,Guojun Feng,Xiangyang Xu

DOI: https://doi.org/10.3389/fgene.2023.1219898

IF: 3.7

2023-07-28

Frontiers in Genetics

Abstract:Tomato ( Solanum lycopersicum ) is widely cultivated and consumed worldwide. Tomato leaf mold, caused by Cladosporium fulvum , is one of the most devastating diseases in tomato production. At present, some tomato leaf mold resistance ( Cf series) genes used in production gradually lose resistance due to the continuous and rapid differentiation of C. fulvum physiological races. The Cf-16 gene derived from the "Ontario7816" tomato cultivar has shown effective resistance in field trials for many years, but few studies have reported on the mapping of the Cf-16 gene, which has not been cloned, limiting its utilization in tomato breeding. Here, we mapped Cf-16 using a novel comprehensive strategy including bulk segregation analysis (BSA), genome resequencing and SSR molecular markers. A genetic analysis revealed that Cf-16 resistance in "Ontario7816" is controlled by one major dominant locus. The Cf-16 gene was mapped in a region of 2.6 cM at chromosome 6 between two markers, namely, TGS447 and TES312, by using an F 2 population from a cross between the resistant cultivar "Ontario7816" and susceptible line "Moneymaker." Two nucleotide-binding-site-leucine-rich repeat (NBS-LRR) resistance genes, namely, XM_004240667.3 and XM_010323727.1, were identified in this interval. They are strong candidates for the Cf-16 gene. The mapping of Cf-16 may speed up its utilization for breeding resistant tomato varieties and represents an important step forward in our understanding of the mechanism underlying resistance to tomato leaf mold.

genetics & heredity
Fungal effector protein AVR2 targets diversifying defense-related cys proteases of tomato

Mohammed Shabab,Takayuki Shindo,Christian Gu,Farnusch Kaschani,Twinkal Pansuriya,Raju Chintha,Anne Harzen,Tom Colby,Sophien Kamoun,Renier A L van der Hoorn

DOI: https://doi.org/10.1105/tpc.107.056325

Abstract:The interaction between the fungal pathogen Cladosporium fulvum and its host tomato (Solanum lycopersicum) is an ideal model to study suppression of extracellular host defenses by pathogens. Secretion of protease inhibitor AVR2 by C. fulvum during infection suggests that tomato papain-like cysteine proteases (PLCPs) are part of the tomato defense response. We show that the tomato apoplast contains a remarkable diversity of PLCP activities with seven PLCPs that fall into four different subfamilies. Of these PLCPs, transcription of only PIP1 and RCR3 is induced by treatment with benzothiadiazole, which triggers the salicylic acid-regulated defense pathway. Sequencing of PLCP alleles of tomato relatives revealed that only PIP1 and RCR3 are under strong diversifying selection, resulting in variant residues around the substrate binding groove. The doubled number of variant residues in RCR3 suggests that RCR3 is under additional adaptive selection, probably to prevent autoimmune responses. AVR2 selectively inhibits only PIP1 and RCR3, and one of the naturally occurring variant residues in RCR3 affects AVR2 inhibition. The higher accumulation of PIP1 protein levels compared with RCR3 indicates that PIP1 might be the real virulence target of AVR2 and that RCR3 acts as a decoy for AVR2 perception in plants carrying the Cf-2 resistance gene.
Transcriptional and Posttranscriptional Regulation of the Tomato Leaf Mould Disease Resistance Gene Cf-9.

Wen Li,You-Ping Xu,Xin-Zhong Cai

DOI: https://doi.org/10.1016/j.bbrc.2016.01.015

IF: 3.1

2016-01-01

Biochemical and Biophysical Research Communications

Abstract:Plant disease resistance (R) genes confer effector-triggered immunity (ETI) to pathogens carrying complementary effector/avirulence (Avr) genes. They are traditionally recognized to function at translational and/or posttranslational levels. In this study, however, transcriptional and posttranscriptional regulation of Cf-9, a tomato R gene conferring resistance to leaf mould fungal pathogen carrying Avr9, was demonstrated. Expression of the Cf-9 gene was 10.8-54.7 folds higher in the Cf-9/Avr9 tomato lines than in the Cf-9 lines depending on the seedling age, indicating that the Cf-9 gene expression was strongly induced by Avr9. Moreover, expression of the Cf-9 gene in the 5-day-old Cf-9/Avr9 seedlings at 33 degrees C was approximately 80 folds lower than that at 25 degrees C, and was enhanced by 23.4 folds at only 4 h post temperature shift from 33 degrees C to 25 degrees C, demonstrating that the Avr9-mediated induction of the Cf-9 gene expression is reversibly repressed by high temperature. Expression of the Cf-9 gene in the Cf-9 seedlings was similarly affected by temperature as in the Cf-9/Avr9 seedlings, implying that the genetic control of temperature sensitivity of the Cf-9 gene expression is epistasis to its Avr9-mediated induction. Additionally, a miRNA sly-miR6022, TGGAAGGGAGAATATCCAGGA, targeting the leucine-rich repeat (LRR) domain spanning LRR13-LRR14 of the Cf-9 gene transcript was predicted. Over-expression of this miRNA resulted in over 88% reduction of the Cf-9 gene transcripts in both Nicotiana benthamiana and tomato, and thus verifying the function of sly-miR6022 in degrading the Cf-9 gene transcripts. Collectively, our results reveal that the tomato R gene Cf-9 is strongly regulated at transcriptional level by pathogen Avr9 in a temperature-sensitive manner and is also regulated at posttranscriptional level by a miRNA sly-miR6022. (C) 2016 Elsevier Inc. All rights reserved.
Clinical and genetic patterns in osteogenesis imperfecta.

R. Wynne‐Davies,J. Gormley

DOI: https://doi.org/10.1097/00003086-198109000-00005

IF: 4.755

1981-09-01

Clinical Orthopaedics and Related Research

Abstract:
Variable leucine-rich repeats of tomato disease resistance genes Cf-2 and Cf-5 determine specificity.

M. Dixon,P. Seear

DOI: https://doi.org/10.1046/j.1364-3703.2003.00162.x

IF: 4.9

2003-05-01

Molecular Plant Pathology

Abstract:SUMMARY The tomato Cf-2 and Cf-5 genes confer race specific resistance to infection by the leaf mould pathogen Cladosporium fulvum. The encoded proteins induce a defence response upon recognition of the fungal Avr2 and Avr5 determinants, respectively. Each resistance protein is comprised largely of leucine-rich repeats (LRRs) and the specificity of recognition is thought to occur through a particular domain. We have investigated this further using domain swaps between Cf-2 and Cf-5. Engineered chimeric genes containing portions of Cf-2 and Cf-5 were expressed and shown to be functional. The results clearly show that the specificity for the particular avirulence determinant is restricted to a region of each gene that encodes a subset of LRRs containing the highest level of intergenic variability. In addition, two non-functional mutants of Cf-5 were characterized and their significance discussed.

Medicine,Biology,Environmental Science
Breeding for Resistance to Fusarium Wilt of Tomato: A Review

Jessica Chitwood-Brown,Gary E Vallad,Tong Geon Lee,Samuel F Hutton

DOI: https://doi.org/10.3390/genes12111673

2021-10-23

Abstract:For over a century, breeders have worked to develop tomato (Solanum lycopersicum) cultivars with resistance to Fusarium wilt (Fol) caused by the soilborne fungus Fusarium oxysporum f. sp. lycopersici. Host resistance is the most effective strategy for the management of this disease. For each of the three Fol races, resistance has been introgressed from wild tomato species, predominately in the form of R genes. The I, I-2, I-3, and I-7 R genes have each been identified, as well as the corresponding Avr effectors in the fungus with the exception of Avr7. The mechanisms by which the R gene protein products recognize these effectors, however, has not been elucidated. Extensive genetic mapping, gene cloning, and genome sequencing efforts support the development of tightly-linked molecular markers, which greatly expedite tomato breeding and the development of elite, Fol resistant cultivars. These resources also provide important tools for pyramiding resistance genes and should support the durability of host resistance.
Analysis of five near-complete genome assemblies of the tomato pathogen Cladosporium fulvum uncovers additional accessory chromosomes and structural variations induced by transposable elements effecting the loss of avirulence genes

Alex Z. Zaccaron,Ioannis Stergiopoulos

DOI: https://doi.org/10.1186/s12915-024-01818-z

IF: 7.364

2024-01-30

BMC Biology

Abstract:Fungal plant pathogens have dynamic genomes that allow them to rapidly adapt to adverse conditions and overcome host resistance. One way by which this dynamic genome plasticity is expressed is through effector gene loss, which enables plant pathogens to overcome recognition by cognate resistance genes in the host. However, the exact nature of these loses remains elusive in many fungi. This includes the tomato pathogen Cladosporium fulvum , which is the first fungal plant pathogen from which avirulence ( Avr ) genes were ever cloned and in which loss of Avr genes is often reported as a means of overcoming recognition by cognate tomato Cf resistance genes. A recent near-complete reference genome assembly of C. fulvum isolate Race 5 revealed a compartmentalized genome architecture and the presence of an accessory chromosome, thereby creating a basis for studying genome plasticity in fungal plant pathogens and its impact on avirulence genes.

biology

Retrograde ejaculation associated spontaneous sperm cystolithiasis in four rhesus macaques (Macaca mulatta).

Molecular Mechanism of Interaction Between Tomato and Leaf Mold Pathogen Cladosporium Fulvum

Specific Recognition of AVR4 and AVR9 Results in Distinct Patterns of Hypersensitive Cell Death in Tomato, but Similar Patterns of Defence-Related Gene Expression.

Attenuation of Cf-mediated defense responses at elevated temperatures correlates with a decrease in elicitor-binding sites.

Genetic and molecular analysis of tomato Cf genes for resistance to Cladosporium fulvum

Sequential breakdown of the Cf‐9 leaf mould resistance locus in tomato by Fulvia fulva

High humidity represses Cf-4/Avr4- and Cf-9/Avr9 -dependent hypersensitive cell death and defense gene expression

Transcript Profiling for Avr4/Cf-4- and Avr9/Cf-9-dependent Defence Gene Expression

Progress of Infecting and Resistant Mechanism in Tomato Leaf Mould

Allelic variation in the effector genes of the tomato pathogen Cladosporium fulvum reveals different modes of adaptive evolution

Three years of experience in biomanipulating a small eutrophic lake: Lago di Candia (Northern Italy)

The molecular basis of co-evolution between Cladosporium fulvum and tomato

Unilateral multilevel interlaminar fenestration instead of laminectomy or hemilaminectomy: an alternative surgical approach to intraspinal space-occupying lesions. Technical note.

Cladosporium fulvum overcomes Cf-2-mediated resistance by producing truncated AVR2 elicitor proteins

Mapping of the Cladosporium fulvum resistance gene Cf-16, a major gene involved in leaf mold disease in tomato

Fungal effector protein AVR2 targets diversifying defense-related cys proteases of tomato

Transcriptional and Posttranscriptional Regulation of the Tomato Leaf Mould Disease Resistance Gene Cf-9.

Clinical and genetic patterns in osteogenesis imperfecta.

Variable leucine-rich repeats of tomato disease resistance genes Cf-2 and Cf-5 determine specificity.

Breeding for Resistance to Fusarium Wilt of Tomato: A Review

Analysis of five near-complete genome assemblies of the tomato pathogen Cladosporium fulvum uncovers additional accessory chromosomes and structural variations induced by transposable elements effecting the loss of avirulence genes