Adsorption and deposition-assisted anodic stripping voltammetry for determination of antimony(III) in presence of hematoxylin on glassy carbon electrode.

Hanife Vardar Sezgin,Y. Dilgin,H. Gökçel

DOI: https://doi.org/10.1016/j.talanta.2016.10.103

2017-03-01

Abstract:

What problem does this paper attempt to address?

A nuclear localization for Avr2 from Fusarium oxysporum is required to activate the tomato resistance protein I-2

Lisong Ma,Ben J C Cornelissen,Frank L W Takken

DOI: https://doi.org/10.3389/fpls.2013.00094

2013-04-11

Abstract:Plant pathogens secrete effector proteins to promote host colonization. During infection of tomato xylem vessels, Fusarium oxysporum f. sp. lycopersici (Fol) secretes the Avr2 effector protein. Besides being a virulence factor, Avr2 is recognized intracellularly by the tomato I-2 resistance protein, resulting in the induction of host defenses. Here, we show that AVR2 is highly expressed in root- and xylem-colonizing hyphae three days post inoculation of roots. Co-expression of I-2 with AVR2 deletion constructs using agroinfiltration in Nicotiana benthamiana leaves revealed that, except for the N-terminal 17 amino acids, the entire AVR2 protein is required to trigger I-2-mediated cell death. The truncated Avr2 variants are still able to form homo-dimers, showing that the central region of Avr2 is required for dimerization. Simultaneous production of I-2 and Avr2 chimeras carrying various subcellular localization signals in N. benthamiana leaves revealed that a nuclear localization of Avr2 is required to trigger I-2-dependent cell death. Nuclear exclusion of Avr2 prevented its activation of I-2, suggesting that Avr2 is recognized by I-2 in the nucleus.
Contribution of twin studies to psychiatric nosology.

S. Torgersen

Abstract:
[Pathological study on Vater's papilla].

F. Barboni,G. Cavalli

1954-04-01

Abstract:
Suppression of plant resistance gene-based immunity by a fungal effector

Petra M Houterman,Ben J C Cornelissen,Martijn Rep

DOI: https://doi.org/10.1371/journal.ppat.1000061

2008-05-09

Abstract:The innate immune system of plants consists of two layers. The first layer, called basal resistance, governs recognition of conserved microbial molecules and fends off most attempted invasions. The second layer is based on Resistance (R) genes that mediate recognition of effectors, proteins secreted by pathogens to suppress or evade basal resistance. Here, we show that a plant-pathogenic fungus secretes an effector that can both trigger and suppress R gene-based immunity. This effector, Avr1, is secreted by the xylem-invading fungus Fusarium oxysporum f.sp. lycopersici (Fol) and triggers disease resistance when the host plant, tomato, carries a matching R gene (I or I-1). At the same time, Avr1 suppresses the protective effect of two other R genes, I-2 and I-3. Based on these observations, we tentatively reconstruct the evolutionary arms race that has taken place between tomato R genes and effectors of Fol. This molecular analysis has revealed a hitherto unpredicted strategy for durable disease control based on resistance gene combinations.
Difference in Infrared Spectra from Cultured Cells Dependent on Cell-Harvesting Method

N. Fujioka,Y. Morimoto,K. Takeuchi,M. Yoshioka,M. Kikuchi

DOI: https://doi.org/10.1366/000370203321535187

2003-02-01

Applied Spectroscopy

Abstract:Fourier transform infrared (FT-IR) spectroscopy has been used extensively on various human tissues including cancers to study the structural changes at the molecular level. Several studies1,2 have successfully shown how to segregate cancer cells from normal cells using FT-IR, which reveals the spectral difference in infrared (IR) between cancer and normal cells. This method has a great advantage in rapid characterization of sample with simple preparation processes, usually including harvesting cells, centrifugation, and occasionally xation.1,2 Although the preparation processes are not complicated, IR spectra may be affected because these processes potentially degrade the cells at the molecular level. One stage in the processing, the harvesting of cells, is most likely to damage cells since it may cause eventual injury to the cell membrane, cell–cell bonds, and cell–culture plate adherence.3,4 This implies that comparison of identical cells that are harvested by different methods potentially show different IR spectra, resulting in a bias due to the method employed. Thus, the comparison of identical cells that are harvested by different methods may lead to misinterpretation of the obtained IR spectra. Therefore, the purpose of the present study was to determine whether the method of harvesting the cells affected their IR spectra. The IR spectra of the cells harvested by three different methods were studied to determine whether differences in IR spectra arose according to the methods. In addition, the carrier solution of the harvested cells was also examined to determine whether the type of solution affects the IR spectra.
Molecular Mechanism of Interaction Between Tomato and Leaf Mold Pathogen Cladosporium Fulvum

WANG Chang-chun,CAI Xin-zhong,XU You-ping

DOI: https://doi.org/10.3321/j.issn:0412-0914.2006.05.001

2006-01-01

Abstract:The pathosystem of tomato and leaf mold fungal pathogen Cladosporium fulvum is a model system to study molecular mechanism of interaction between plant and pathogen.Four C.fulvum avirulence(Avr) genes have been cloned.All the Avr genes encode small molecular weight proteins with even numbers of cysteines,and their existence and variance are different in the virulent strains.Avr4 is of chitin-binding activity,while Avr9 might be involved in nitrogen regulation in the fungus.Seven functional tomato resistance(R) genes to C.fulvum have been cloned.They are clustered with nonfunctional homologues in complex loci and named as Hcr(homologues of C.fulvum resistance gene Cf) genes.The Cf proteins,which are anchored at plasma membrane with the main body outside,mainly consist of a leucine-rich repeat(LRR) and a transmembrane domain.Recognition of an Avr by the complementary Cf complies with the "guard" hypothesis.In re-(cognition) complex of Avr2 by Cf-2,the guarded protein is protease Rcr3.Avr recognition by a Cf rapidly eli-(cits) downstream signaling and defense responses,including occurrence of hypersensitive response(HR) and oxidative burst,activation of K~+ ion channel,a variety of protein kinases,SGT1,thioredoxin and phosphati-(dic) acid signaling pathway.Environmental conditions,including temperature,humidity and light,significantly affect Cf-dependent HR and resistance.Different Cf/Avr interactions might be distinct in Avr recognition and downstream signal transduction pathways.
The determinants of sexuality among adolescent school girls in Kenya.

V. Lema

1990-03-01

East African Medical Journal

Abstract:One thousand seven hundred and fifty one Secondary school girls aged 12 to 19 years were interviewed by means of a self-administered questionnaire. 416 (23.8%), of them reported to have been sexually experienced at the time of the study. 4.1% of the sexually experienced girls had started sex below the age of 10 years, some of whom had been raped. The low and middle class private schools in the city centre had higher incidence of sexually experienced girls. The same was observed in those girls staying away from their parents. Majority of the sexually experienced girls had started coitus within one to two years of attaining menarche or having a boyfriend. Some of these girls may have been forced to indulge in sex by the men/boys or circumstances. Lack of factual knowledge, parental guidance and lust for material gains are some of the factors the girls felt may be responsible for the upsurge in adolescent sexual behaviour. The role played by these factors in adolescent sexuality is discussed, and possible remedial measures are suggested.
Specific Recognition of AVR4 and AVR9 Results in Distinct Patterns of Hypersensitive Cell Death in Tomato, but Similar Patterns of Defence-Related Gene Expression.

Xinzhong Cai,Frank L. W. Takken,Matthieu H. A. J. Joosten,Pierre J. G. M. De Wit

DOI: https://doi.org/10.1046/j.1364-3703.2001.00053.x

IF: 4.9

2001-01-01

Molecular Plant Pathology

Abstract:Summary Hypersensitive cell death occurs in tomato seedlings that are derived from a cross between plants that express a resistance (Cf) gene against the pathogenic fungus Cladosporium fulvum and plants that contain the matching avirulence (Avr) gene originating from this fungus. The pattern of Cf-9/Avr9- and Cf-4/Avr4-induced necrosis in these F(1) seedlings was found to differ significantly. Macroscopic observation revealed that in F(1) tomato seedlings containing both Cf-9 and Avr9, numerous necrotic spots developed that were scattered over the entire cotyledon, while the midvein and primary veins remained unaffected. In seedlings containing both Cf-4 and Avr4, however, initially only one or a few necrotic spots developed on each cotyledon, in most cases in the midvein and occasionally in primary veins. Subsequently, these spots turned rapidly into lesions that enlarged along the midvein and primary veins, eventually causing the cotyledons to wilt and abscise. These observations were confirmed by detailed histological studies. Production of the AVR proteins in adult tomato plants carrying the matching Cf gene, employing potato virus X, resulted in similar patterns of necrosis. RNA gel blot analysis demonstrated that both Avr4 and Avr9, controlled by the CaMV 35S promoter, were highly expressed in seedlings already at one day post-emergence, indicating that the distinct necrotic patterns are not due to differences in Avr expression levels. We have analysed the expression of many genes involved in defence signalling pathways and the defence response itself, during the onset of the Cf/Avr-initiated hypersensitive response (HR). Although most of the genes were expressed stronger and faster in Cf-4/Avr4 seedlings than in Cf-9/Avr9 seedlings at the onset of HR, no significant qualitative differences in the expression of genes involved in downstream signalling were observed when Cf-4/Avr4- and Cf-9/Avr9-induced defence responses were compared.
Attenuation of Cf-mediated defense responses at elevated temperatures correlates with a decrease in elicitor-binding sites.

Camiel F. de Jong,Frank L. W. Takken,Xinzhong Cai,Pierre J. G. M. de Wit,Matthieu H. A. J. Joosten

DOI: https://doi.org/10.1094/MPMI.2002.15.10.1040

IF: 3.4218

2007-01-01

Molecular Plant-Microbe Interactions

Abstract:The interaction between the fungal pathogen Cladosporium fulvum and its only host, tomato, is a well-described gene-for-gene system and several resistance (Cf) genes of tomato and matching fungal avirulence (Avr) genes have been characterized. Transgenic tobacco suspension cells expressing Cf genes respond to matching elicitors with typical defense responses, such as medium alkalization and an oxidative burst. We found that this response is attenuated at elevated ambient temperatures. Tomato seedlings expressing both a Cf and the matching Avr gene rapidly die as a result of systemic necrosis at normal temperatures, but are rescued at 33degreesC. We demonstrate that, at 33degreesC, the Cf/Avr-mediated induction of defense-related genes is reversibly suppressed. Furthermore, in cell suspensions, the AVR-induced medium alkalization response is slowly suppressed upon incubation at 33degreesC, but is quickly restored after transfer to lower temperatures. A high-affinity binding site (HABS) for AVR9 is present on plasma membranes isolated from solanaceous plants and has been suggested to act as a co-receptor for AVR9. The amount of AVR9-HABS is 80% reduced in tobacco cell suspensions incubated at 33degreesC, as compared with cell suspensions incubated at 20degreesC. Our data suggest that the temperature sensitivity of Cf-mediated defense responses resides at the level of perception of the fungal avirulence factors.
Fungal effector protein AVR2 targets diversifying defense-related cys proteases of tomato

Mohammed Shabab,Takayuki Shindo,Christian Gu,Farnusch Kaschani,Twinkal Pansuriya,Raju Chintha,Anne Harzen,Tom Colby,Sophien Kamoun,Renier A L van der Hoorn

DOI: https://doi.org/10.1105/tpc.107.056325

Abstract:The interaction between the fungal pathogen Cladosporium fulvum and its host tomato (Solanum lycopersicum) is an ideal model to study suppression of extracellular host defenses by pathogens. Secretion of protease inhibitor AVR2 by C. fulvum during infection suggests that tomato papain-like cysteine proteases (PLCPs) are part of the tomato defense response. We show that the tomato apoplast contains a remarkable diversity of PLCP activities with seven PLCPs that fall into four different subfamilies. Of these PLCPs, transcription of only PIP1 and RCR3 is induced by treatment with benzothiadiazole, which triggers the salicylic acid-regulated defense pathway. Sequencing of PLCP alleles of tomato relatives revealed that only PIP1 and RCR3 are under strong diversifying selection, resulting in variant residues around the substrate binding groove. The doubled number of variant residues in RCR3 suggests that RCR3 is under additional adaptive selection, probably to prevent autoimmune responses. AVR2 selectively inhibits only PIP1 and RCR3, and one of the naturally occurring variant residues in RCR3 affects AVR2 inhibition. The higher accumulation of PIP1 protein levels compared with RCR3 indicates that PIP1 might be the real virulence target of AVR2 and that RCR3 acts as a decoy for AVR2 perception in plants carrying the Cf-2 resistance gene.
Avr/Cf Interaction Induce the Expression of Ptis, Genes Encoding Pto-interactors

XZ Cai,YP Xu

IF: 9.106

2002-01-01

Journal of Integrative Plant Biology

Abstract:Products of plant resistance (R) genes Pto and Cf contain distinct domains, and have different cellular localization. It is intriguing to compare the development mechanisms of resistance conferred by the two R genes. In the present report, two hypersensitive response (HR) initiation systems were employed to study the time-course expression induced by Avr/Cf interaction of the genes encoding Pti4, Pti5 and Pti6 which interact directly with Pto: (1) Seeds of tomato (Lycopersicon esculentum Mill.) containing complementary gene pairs Avr4/Cf-4 and Avr9/Cf-9 were obtained through crossing. Their seedlings developed HR under room temperature. (2) Avr/Cf seedlings grew normally at 33 degreesC. When the temperature was shifted down to 25 degreesC, HR occurred within hours in the seedlings. Results of both experiment,, showed that expression of Pti4, Pti5 and Pti6 was induced upon development of hypersensitive necrosis in Avr/Cf seedlings. However, die expression levels and patterns of these Ptis differed. This Finding indicated that these Ptis function complementarily, and might be involved in regulation of both Pto and Cf-conferred resistance.
Transcriptional and Posttranscriptional Regulation of the Tomato Leaf Mould Disease Resistance Gene Cf-9.

Wen Li,You-Ping Xu,Xin-Zhong Cai

DOI: https://doi.org/10.1016/j.bbrc.2016.01.015

IF: 3.1

2016-01-01

Biochemical and Biophysical Research Communications

Abstract:Plant disease resistance (R) genes confer effector-triggered immunity (ETI) to pathogens carrying complementary effector/avirulence (Avr) genes. They are traditionally recognized to function at translational and/or posttranslational levels. In this study, however, transcriptional and posttranscriptional regulation of Cf-9, a tomato R gene conferring resistance to leaf mould fungal pathogen carrying Avr9, was demonstrated. Expression of the Cf-9 gene was 10.8-54.7 folds higher in the Cf-9/Avr9 tomato lines than in the Cf-9 lines depending on the seedling age, indicating that the Cf-9 gene expression was strongly induced by Avr9. Moreover, expression of the Cf-9 gene in the 5-day-old Cf-9/Avr9 seedlings at 33 degrees C was approximately 80 folds lower than that at 25 degrees C, and was enhanced by 23.4 folds at only 4 h post temperature shift from 33 degrees C to 25 degrees C, demonstrating that the Avr9-mediated induction of the Cf-9 gene expression is reversibly repressed by high temperature. Expression of the Cf-9 gene in the Cf-9 seedlings was similarly affected by temperature as in the Cf-9/Avr9 seedlings, implying that the genetic control of temperature sensitivity of the Cf-9 gene expression is epistasis to its Avr9-mediated induction. Additionally, a miRNA sly-miR6022, TGGAAGGGAGAATATCCAGGA, targeting the leucine-rich repeat (LRR) domain spanning LRR13-LRR14 of the Cf-9 gene transcript was predicted. Over-expression of this miRNA resulted in over 88% reduction of the Cf-9 gene transcripts in both Nicotiana benthamiana and tomato, and thus verifying the function of sly-miR6022 in degrading the Cf-9 gene transcripts. Collectively, our results reveal that the tomato R gene Cf-9 is strongly regulated at transcriptional level by pathogen Avr9 in a temperature-sensitive manner and is also regulated at posttranscriptional level by a miRNA sly-miR6022. (C) 2016 Elsevier Inc. All rights reserved.
[Avirulence Genes of Plant Pathogens].

Xin-Zhong Cai,You-Ping Xu,Zhong Zheng

DOI: https://doi.org/10.3321/j.issn:1000-3061.2002.01.002

2002-01-01

Abstract:One type of important plant disease resistance, gene-for-gene resistance, is resulted from the interactions between products of the pathogen avirulence (Avr) genes and their matching plant resistance (R) genes. Avr genes have been cloned from a variety of pathogens including fungi, bacteria, viruses and oomycetes. No significant homology is found between sequences of the most cloned Avr genes and those of known proteins or between those of themselves. However, significant homology has been found between sequences of the cloned R genes and those of known proteins or between those of themselves. R proteins consist of similar domains. It has been reported that hypersensitive cell death and resistance, which are induced by interactions between products of different Avr/R gene pairs consisting of similar R genes but different Avr genes, are distinct in development speed, strength, and organ and tissue specificity. Avr genes have dual functions: Pathogens containing Avr genes are avirulent to plants carrying the matching R genes, while they are virulent in race, strain, pathovar or species-specific way to plants without carrying the matching R genes.
The Cladosporium fulvum virulence protein Avr2 inhibits host proteases required for basal defense

H Peter van Esse,John W Van't Klooster,Melvin D Bolton,Koste A Yadeta,Peter van Baarlen,Sjef Boeren,Jacques Vervoort,Pierre J G M de Wit,Bart P H J Thomma

DOI: https://doi.org/10.1105/tpc.108.059394

Abstract:Cladosporium fulvum (syn. Passalora fulva) is a biotrophic fungal pathogen that causes leaf mold of tomato (Solanum lycopersicum). During growth in the apoplast, the fungus establishes disease by secreting effector proteins, 10 of which have been characterized. We have previously shown that the Avr2 effector interacts with the apoplastic tomato Cys protease Rcr3, which is required for Cf-2-mediated immunity. We now show that Avr2 is a genuine virulence factor of C. fulvum. Heterologous expression of Avr2 in Arabidopsis thaliana causes enhanced susceptibility toward extracellular fungal pathogens, including Botrytis cinerea and Verticillium dahliae, and microarray analysis showed that Avr2 expression triggers a global transcriptome reflecting pathogen challenge. Cys protease activity profiling showed that Avr2 inhibits multiple extracellular Arabidopsis Cys proteases. In tomato, Avr2 expression caused enhanced susceptibility toward Avr2-defective C. fulvum strains and also toward B. cinerea and V. dahliae. Cys protease activity profiling in tomato revealed that, in this plant also, Avr2 inhibits multiple extracellular Cys proteases, including Rcr3 and its close relative Pip1. Finally, silencing of Avr2 significantly compromised C. fulvum virulence on tomato. We conclude that Avr2 is a genuine virulence factor of C. fulvum that inhibits several Cys proteases required for plant basal defense.
Apoplastic effectors secreted by two unrelated eukaryotic plant pathogens target the tomato defense protease Rcr3

Jing Song,Joe Win,Miaoying Tian,Sebastian Schornack,Farnusch Kaschani,Muhammad Ilyas,Renier A L van der Hoorn,Sophien Kamoun

DOI: https://doi.org/10.1073/pnas.0809201106

2009-02-03

Abstract:Current models of plant-pathogen interactions stipulate that pathogens secrete effector proteins that disable plant defense components known as virulence targets. Occasionally, the perturbations caused by these effectors trigger innate immunity via plant disease resistance proteins as described by the "guard hypothesis." This model is nicely illustrated by the interaction between the fungal plant pathogen Cladosporium fulvum and tomato. C. fulvum secretes a protease inhibitor Avr2 that targets the tomato cysteine protease Rcr3(pim). In plants that carry the resistance protein Cf2, Rcr3(pim) is required for resistance to C. fulvum strains expressing Avr2, thus fulfilling one of the predictions of the guard hypothesis. Another prediction of the guard hypothesis has not yet been tested. Considering that virulence targets are important components of defense, different effectors from unrelated pathogens are expected to evolve to disable the same host target. In this study we confirm this prediction using a different pathogen of tomato, the oomycete Phytophthora infestans that is distantly related to fungi such as C. fulvum. This pathogen secretes an array of protease inhibitors including EPIC1 and EPIC2B that inhibit tomato cysteine proteases. Here we show that, similar to Avr2, EPIC1 and EPIC2B bind and inhibit Rcr3(pim). However, unlike Avr2, EPIC1 and EPIC2B do not trigger hypersensitive cell death or defenses on Cf-2/Rcr3(pim) tomato. We also found that the rcr3-3 mutant of tomato that carries a premature stop codon in the Rcr3 gene exhibits enhanced susceptibility to P. infestans, suggesting a role for Rcr3(pim) in defense. In conclusion, our findings fulfill a key prediction of the guard hypothesis and suggest that the effectors Avr2, EPIC1, and EPIC2B secreted by two unrelated pathogens of tomato target the same defense protease Rcr3(pim). In contrast to C. fulvum, P. infestans appears to have evolved stealthy effectors that carry inhibitory activity without triggering plant innate immunity.
A highly polymorphic effector protein promotes fungal virulence through suppression of plant-associated Actinobacteria

Nick C Snelders,Jordi C Boshoven,Yin Song,Natalie Schmitz,Gabriel L Fiorin,Hanna Rovenich,Grardy C M van den Berg,David E Torres,Gabriella C Petti,Zoe Prockl,Luigi Faino,Michael F Seidl,Bart P H J Thomma

DOI: https://doi.org/10.1111/nph.18576

Abstract:Plant pathogens secrete effector proteins to support host colonization through a wide range of molecular mechanisms, while plant immune systems evolved receptors to recognize effectors or their activities to mount immune responses to halt pathogens. Importantly, plants do not act as single organisms, but rather as holobionts that actively shape their microbiota as a determinant of health. The soil-borne fungal pathogen Verticillium dahliae was recently demonstrated to exploit the VdAve1 effector to manipulate the host microbiota to promote vascular wilt disease in the absence of the corresponding immune receptor Ve1. We identify a multiallelic V. dahliae gene displaying c. 65% sequence similarity to VdAve1, named VdAve1-like (VdAve1L), which shows extreme sequence variation, including alleles that encode dysfunctional proteins, indicative of selection pressure to overcome host recognition. We show that the orphan cell surface receptor Ve2, encoded at the Ve locus, does not recognize VdAve1L. Additionally, we demonstrate that the full-length variant VdAve1L2 possesses antimicrobial activity, like VdAve1, yet with a divergent activity spectrum, that is exploited by V. dahliae to mediate tomato colonization through the direct suppression of antagonistic Actinobacteria in the host microbiota. Our findings open up strategies for more targeted biocontrol against microbial plant pathogens.
Protection to Tomato Wilt Disease Conferred by the Nonpathogen Fusarium oxysporum Fo47 is More Effective Than that Conferred by Avirulent Strains

Francisco J de Lamo,Staf B Spijkers,Frank L W Takken

DOI: https://doi.org/10.1094/PHYTO-04-20-0133-R

Phytopathology

Abstract:Although the vascular pathogen Fusarium oxysporum is notorious for being the causal agent of Fusarium wilt disease, the vast majority of F. oxysporum strains are harmless soil and root colonizers. The latter F. oxysporum's are often endophytes colonizing roots intracellularly without negatively affecting plant fitness. Actually, most of them, like Fo47, are beneficial providing biological control to various root pathogens. Interestingly, also pathogenic F. oxysporum inoculated on a resistant host (i.e., avirulent F. oxysporum f. sp. lycopersici) can reduce susceptibility to virulent F. oxysporum strains via a mechanism called "cross protection." It has been hypothesized that cross protection is based on activation of a resistance protein of the host upon recognition of a cognate avirulence (Avr) protein of the pathogen. Currently, it is unknown whether the biocontrol activity of F. oxysporum endophytes utilizes similar mechanisms as cross protection conferred by avirulent pathogens, and whether both provide a quantitative similar level of protection. Here, we show that in tomato biocontrol activity of the Fo47 endophyte to the pathogen F. oxysporum f. sp. lycopersici is more effective than cross protection induced by avirulent F. oxysporum f. sp. lycopersici strains activating either I, I-2, or both resistance proteins upon recognition of Avr1 or the Avr2/Six5 pair, respectively. These findings imply that cross protection and biological control utilize different mechanisms to reduce susceptibility of the host to subsequent infections.
Stretch receptors in urodele limb muscles

Q. Bone,R. Ridge,K. Ryan

DOI: https://doi.org/10.1007/BF00226663

1976-01-26

Cell and Tissue Research

Abstract:
Estimation of the bioaccessibility of metallic elements in chocolate drink powder using an in vitro digestion method and spectrometric techniques

R. Peixoto,E. A. M. Mazon,S. Cadore

DOI: https://doi.org/10.5935/0103-5053.20130111

2013-05-01

Abstract:As fracoes bioacessiveis de Al, Ba, Cd, Cr, Cu, Mg, Mn e P em amostras de achocolatado foram estimadas usando um metodo de digestao in vitro e tecnicas espectrometricas de analise. Como metodo de digestao in vitro foi utilizado um procedimento de tres etapas, nas quais sao simulados os processos digestivos que ocorrem na boca, no estomago e no intestino com a preparacao de fluidos digestivos sinteticos. Para o tratamento da amostra e do quimo (porcao soluvel) obtido no metodo de digestao in vitro, utilizou-se mineralizacao assistida por radiacao micro-ondas, considerando os altos teores de materia orgânica. Os teores de Al, Ba, Cu, Mg, Mn e P foram quantificados por espectrometria de emissao optica com plasma indutivamente acoplado, enquanto os teores de Cd e Cr foram quantificados por espectrometria de absorcao atomica com forno de grafite. Considerando os teores totais dos elementos estudados, as fracoes bioacessiveis obtidas foram: 5 ± 3% para Al, 9 ± 2% para Ba, 13 ± 3% para Cd, 5 ± 2% para Cr, 29 ± 4% para Cu, 54 ± 3% para Mg, 11 ± 3% para Mn e 31 ± 6% para P. De uma maneira geral, elementos que desempenham funcoes essenciais no organismo humano apresentaram maior bioacessibilidade quando comparados aos elementos potencialmente toxicos em niveis tracos. The bioaccessible fractions of Al, Ba, Cd, Cr, Cu, Mg, Mn and P in chocolate drink powder were estimated using an in vitro digestion method and spectrometric techniques. A three-step procedure was used as an in vitro digestion method, in which the digestive process occurring in the mouth, stomach and intestine are simulated with the preparation of synthetic digestive fluids. Mineralization assisted by microwave radiation was used for the treatment of the sample and the chyme (soluble portion) obtained in the in vitro digestion method, considering their high organic content. Aluminum, Ba, Cu, Mg, Mn and P were quantified by inductively coupled plasma optical emission spectrometry, whereas Cd and Cr were quantified by graphite furnace atomic absorption spectrometry. Considering the total content of these elements in chocolate drink powder, the bioaccessible fractions found were 5 ± 3% for Al, 9 ± 2% for Ba, 13 ± 3% for Cd, 5 ± 2% for Cr, 29 ± 4% for Cu, 54 ± 3% for Mg, 11 ± 3% for Mn and 31 ± 6% for P. In general, elements that perform essential functions in the human organism presented higher bioaccessibility when compared with potentially toxic elements at trace levels.
Endotoxin is a component in the pathogenesis of chronic viral diseases

I. Anikhovskaya,A. Kubatiev,G. Khasanova,M. Yakovlev

DOI: https://doi.org/10.1134/S0362119715030020

2015-05-01

Human Physiology

Abstract:

Adsorption and deposition-assisted anodic stripping voltammetry for determination of antimony(III) in presence of hematoxylin on glassy carbon electrode.

A nuclear localization for Avr2 from Fusarium oxysporum is required to activate the tomato resistance protein I-2

Contribution of twin studies to psychiatric nosology.

[Pathological study on Vater's papilla].

Suppression of plant resistance gene-based immunity by a fungal effector

Difference in Infrared Spectra from Cultured Cells Dependent on Cell-Harvesting Method

Molecular Mechanism of Interaction Between Tomato and Leaf Mold Pathogen Cladosporium Fulvum

The determinants of sexuality among adolescent school girls in Kenya.

Specific Recognition of AVR4 and AVR9 Results in Distinct Patterns of Hypersensitive Cell Death in Tomato, but Similar Patterns of Defence-Related Gene Expression.

Attenuation of Cf-mediated defense responses at elevated temperatures correlates with a decrease in elicitor-binding sites.

Fungal effector protein AVR2 targets diversifying defense-related cys proteases of tomato

Avr/Cf Interaction Induce the Expression of Ptis, Genes Encoding Pto-interactors

Transcriptional and Posttranscriptional Regulation of the Tomato Leaf Mould Disease Resistance Gene Cf-9.

[Avirulence Genes of Plant Pathogens].

The Cladosporium fulvum virulence protein Avr2 inhibits host proteases required for basal defense

Apoplastic effectors secreted by two unrelated eukaryotic plant pathogens target the tomato defense protease Rcr3

A highly polymorphic effector protein promotes fungal virulence through suppression of plant-associated Actinobacteria

Protection to Tomato Wilt Disease Conferred by the Nonpathogen Fusarium oxysporum Fo47 is More Effective Than that Conferred by Avirulent Strains

Stretch receptors in urodele limb muscles

Estimation of the bioaccessibility of metallic elements in chocolate drink powder using an in vitro digestion method and spectrometric techniques

Endotoxin is a component in the pathogenesis of chronic viral diseases