Endotoxin is a component in the pathogenesis of chronic viral diseases

I. Anikhovskaya,A. Kubatiev,G. Khasanova,M. Yakovlev

DOI: https://doi.org/10.1134/S0362119715030020

2015-05-01

Human Physiology

Abstract:

What problem does this paper attempt to address?

Molecular Mechanism of Interaction Between Tomato and Leaf Mold Pathogen Cladosporium Fulvum

WANG Chang-chun,CAI Xin-zhong,XU You-ping

DOI: https://doi.org/10.3321/j.issn:0412-0914.2006.05.001

2006-01-01

Abstract:The pathosystem of tomato and leaf mold fungal pathogen Cladosporium fulvum is a model system to study molecular mechanism of interaction between plant and pathogen.Four C.fulvum avirulence(Avr) genes have been cloned.All the Avr genes encode small molecular weight proteins with even numbers of cysteines,and their existence and variance are different in the virulent strains.Avr4 is of chitin-binding activity,while Avr9 might be involved in nitrogen regulation in the fungus.Seven functional tomato resistance(R) genes to C.fulvum have been cloned.They are clustered with nonfunctional homologues in complex loci and named as Hcr(homologues of C.fulvum resistance gene Cf) genes.The Cf proteins,which are anchored at plasma membrane with the main body outside,mainly consist of a leucine-rich repeat(LRR) and a transmembrane domain.Recognition of an Avr by the complementary Cf complies with the "guard" hypothesis.In re-(cognition) complex of Avr2 by Cf-2,the guarded protein is protease Rcr3.Avr recognition by a Cf rapidly eli-(cits) downstream signaling and defense responses,including occurrence of hypersensitive response(HR) and oxidative burst,activation of K~+ ion channel,a variety of protein kinases,SGT1,thioredoxin and phosphati-(dic) acid signaling pathway.Environmental conditions,including temperature,humidity and light,significantly affect Cf-dependent HR and resistance.Different Cf/Avr interactions might be distinct in Avr recognition and downstream signal transduction pathways.
The Cladosporium fulvum virulence protein Avr2 inhibits host proteases required for basal defense

H Peter van Esse,John W Van't Klooster,Melvin D Bolton,Koste A Yadeta,Peter van Baarlen,Sjef Boeren,Jacques Vervoort,Pierre J G M de Wit,Bart P H J Thomma

DOI: https://doi.org/10.1105/tpc.108.059394

Abstract:Cladosporium fulvum (syn. Passalora fulva) is a biotrophic fungal pathogen that causes leaf mold of tomato (Solanum lycopersicum). During growth in the apoplast, the fungus establishes disease by secreting effector proteins, 10 of which have been characterized. We have previously shown that the Avr2 effector interacts with the apoplastic tomato Cys protease Rcr3, which is required for Cf-2-mediated immunity. We now show that Avr2 is a genuine virulence factor of C. fulvum. Heterologous expression of Avr2 in Arabidopsis thaliana causes enhanced susceptibility toward extracellular fungal pathogens, including Botrytis cinerea and Verticillium dahliae, and microarray analysis showed that Avr2 expression triggers a global transcriptome reflecting pathogen challenge. Cys protease activity profiling showed that Avr2 inhibits multiple extracellular Arabidopsis Cys proteases. In tomato, Avr2 expression caused enhanced susceptibility toward Avr2-defective C. fulvum strains and also toward B. cinerea and V. dahliae. Cys protease activity profiling in tomato revealed that, in this plant also, Avr2 inhibits multiple extracellular Cys proteases, including Rcr3 and its close relative Pip1. Finally, silencing of Avr2 significantly compromised C. fulvum virulence on tomato. We conclude that Avr2 is a genuine virulence factor of C. fulvum that inhibits several Cys proteases required for plant basal defense.
Cladosporium fulvum overcomes Cf-2-mediated resistance by producing truncated AVR2 elicitor proteins

Rianne Luderer,Frank L W Takken,Pierre J G M de Wit,Matthieu H A J Joosten

DOI: https://doi.org/10.1046/j.1365-2958.2002.03060.x

Abstract:The Cf-2 gene of tomato confers resistance to strains of the biotrophic pathogenic fungus Cladosporium fulvum carrying avirulence gene Avr2. To allow dissection of the biochemical mechanism of perception of AVR2 by Cf-2, we set out to clone the Avr2 gene. Here, we report the functional cloning of Avr2 cDNA, based on the induction of a hypersensitive response (HR) by the encoded AVR2 protein in Cf2 tomato plants. Analysis of strains of C. fulvum that are virulent on Cf2 tomato lines revealed various independent frameshift mutations in the Avr2 open reading frame (ORF) and a point mutation resulting in a premature stop codon. All modifications result in the production of truncated AVR2 proteins. Interestingly, an additional modification involves the insertion of a LINE-like element, Cfl1, in the Avr2 ORF. Cfl1 is the first LINE-like element identified in C. fulvum and provides the first example of loss of avirulence of a plant pathogen caused by insertion of a retrotransposable element in an Avr gene. Rcr3 represents an additional plant protein that is specifically required for Cf-2-mediated resistance. Analysis of two different rcr3 mutant Cf2 tomato plants revealed that their ability to respond to AVR2 with a HR correlates with their degree of resistance to AVR2-producing strains of C. fulvum. These data support a role for Rcr3 in the perception of AVR2 by Cf-2.
Attenuation of Cf-mediated defense responses at elevated temperatures correlates with a decrease in elicitor-binding sites.

Camiel F. de Jong,Frank L. W. Takken,Xinzhong Cai,Pierre J. G. M. de Wit,Matthieu H. A. J. Joosten

DOI: https://doi.org/10.1094/MPMI.2002.15.10.1040

IF: 3.4218

2007-01-01

Molecular Plant-Microbe Interactions

Abstract:The interaction between the fungal pathogen Cladosporium fulvum and its only host, tomato, is a well-described gene-for-gene system and several resistance (Cf) genes of tomato and matching fungal avirulence (Avr) genes have been characterized. Transgenic tobacco suspension cells expressing Cf genes respond to matching elicitors with typical defense responses, such as medium alkalization and an oxidative burst. We found that this response is attenuated at elevated ambient temperatures. Tomato seedlings expressing both a Cf and the matching Avr gene rapidly die as a result of systemic necrosis at normal temperatures, but are rescued at 33degreesC. We demonstrate that, at 33degreesC, the Cf/Avr-mediated induction of defense-related genes is reversibly suppressed. Furthermore, in cell suspensions, the AVR-induced medium alkalization response is slowly suppressed upon incubation at 33degreesC, but is quickly restored after transfer to lower temperatures. A high-affinity binding site (HABS) for AVR9 is present on plasma membranes isolated from solanaceous plants and has been suggested to act as a co-receptor for AVR9. The amount of AVR9-HABS is 80% reduced in tobacco cell suspensions incubated at 33degreesC, as compared with cell suspensions incubated at 20degreesC. Our data suggest that the temperature sensitivity of Cf-mediated defense responses resides at the level of perception of the fungal avirulence factors.
Fungal effector protein AVR2 targets diversifying defense-related cys proteases of tomato

Mohammed Shabab,Takayuki Shindo,Christian Gu,Farnusch Kaschani,Twinkal Pansuriya,Raju Chintha,Anne Harzen,Tom Colby,Sophien Kamoun,Renier A L van der Hoorn

DOI: https://doi.org/10.1105/tpc.107.056325

Abstract:The interaction between the fungal pathogen Cladosporium fulvum and its host tomato (Solanum lycopersicum) is an ideal model to study suppression of extracellular host defenses by pathogens. Secretion of protease inhibitor AVR2 by C. fulvum during infection suggests that tomato papain-like cysteine proteases (PLCPs) are part of the tomato defense response. We show that the tomato apoplast contains a remarkable diversity of PLCP activities with seven PLCPs that fall into four different subfamilies. Of these PLCPs, transcription of only PIP1 and RCR3 is induced by treatment with benzothiadiazole, which triggers the salicylic acid-regulated defense pathway. Sequencing of PLCP alleles of tomato relatives revealed that only PIP1 and RCR3 are under strong diversifying selection, resulting in variant residues around the substrate binding groove. The doubled number of variant residues in RCR3 suggests that RCR3 is under additional adaptive selection, probably to prevent autoimmune responses. AVR2 selectively inhibits only PIP1 and RCR3, and one of the naturally occurring variant residues in RCR3 affects AVR2 inhibition. The higher accumulation of PIP1 protein levels compared with RCR3 indicates that PIP1 might be the real virulence target of AVR2 and that RCR3 acts as a decoy for AVR2 perception in plants carrying the Cf-2 resistance gene.
Specific Recognition of AVR4 and AVR9 Results in Distinct Patterns of Hypersensitive Cell Death in Tomato, but Similar Patterns of Defence-Related Gene Expression.

Xinzhong Cai,Frank L. W. Takken,Matthieu H. A. J. Joosten,Pierre J. G. M. De Wit

DOI: https://doi.org/10.1046/j.1364-3703.2001.00053.x

IF: 4.9

2001-01-01

Molecular Plant Pathology

Abstract:Summary Hypersensitive cell death occurs in tomato seedlings that are derived from a cross between plants that express a resistance (Cf) gene against the pathogenic fungus Cladosporium fulvum and plants that contain the matching avirulence (Avr) gene originating from this fungus. The pattern of Cf-9/Avr9- and Cf-4/Avr4-induced necrosis in these F(1) seedlings was found to differ significantly. Macroscopic observation revealed that in F(1) tomato seedlings containing both Cf-9 and Avr9, numerous necrotic spots developed that were scattered over the entire cotyledon, while the midvein and primary veins remained unaffected. In seedlings containing both Cf-4 and Avr4, however, initially only one or a few necrotic spots developed on each cotyledon, in most cases in the midvein and occasionally in primary veins. Subsequently, these spots turned rapidly into lesions that enlarged along the midvein and primary veins, eventually causing the cotyledons to wilt and abscise. These observations were confirmed by detailed histological studies. Production of the AVR proteins in adult tomato plants carrying the matching Cf gene, employing potato virus X, resulted in similar patterns of necrosis. RNA gel blot analysis demonstrated that both Avr4 and Avr9, controlled by the CaMV 35S promoter, were highly expressed in seedlings already at one day post-emergence, indicating that the distinct necrotic patterns are not due to differences in Avr expression levels. We have analysed the expression of many genes involved in defence signalling pathways and the defence response itself, during the onset of the Cf/Avr-initiated hypersensitive response (HR). Although most of the genes were expressed stronger and faster in Cf-4/Avr4 seedlings than in Cf-9/Avr9 seedlings at the onset of HR, no significant qualitative differences in the expression of genes involved in downstream signalling were observed when Cf-4/Avr4- and Cf-9/Avr9-induced defence responses were compared.
the European Commission under the Programme of Community Action in the field of Public Health 2008 – 2013 Grant Agreement n ° 2008 13 05

F. Lozano,J. Sánchez-Fernández,J. A. Santos,J. Garcia-Aloviob,R. Mateosa,J. González-Porras,I. Alberca,M. Sawhney,James Paul,D. Leiman

Abstract:
High humidity represses Cf-4/Avr4- and Cf-9/Avr9 -dependent hypersensitive cell death and defense gene expression

Changchun Wang,Xinzhong Cai,Zhong Zheng

DOI: https://doi.org/10.1007/s00425-005-0036-8

IF: 4.54

2005-01-01

Planta

Abstract:Gene-for-gene resistance is a well-known type of plant disease resistance. It is governed by plant resistance ( R ) genes and their matching pathogen avirulence ( Avr ) genes. This resistance is characterized by a hypersensitive response (HR) resulting from the interaction between products of a complementary R and Avr gene pair. The pathosystem of tomato ( Lycopersicon esculentum Mill.) and its leaf mold fungal pathogen Cladosporium fulvum is a model system to study gene-for-gene resistance. HR occurs in tomato seedlings carrying a tomato Cf resistance gene and a matching C. fulvum Avr gene, including, for example, Cf-4/Avr4 and Cf-9/Avr9 . Employing Cf/Avr tomato seedlings that both express a Cf gene and the matching Avr gene, here we report that both Cf-4/Avr4- and Cf-9/Avr9 -dependent HR is delayed and reduced under high humidity (95%), and that Cf-9/Avr9 -dependent HR is more sensitive to high humidity when compared to Cf-4/Avr4 -dependent HR. Furthermore, high humidity acts synergistically with high temperature on HR suppression, resulting in complete blocking of the HR. The transcript profile of over 60 genes, related to HR, signaling and defense, in Cf/Avr seedlings grown under high humidity and thus showing no HR, significantly differed from that of the same seedlings grown under normal humidity and thus showing HR. These results demonstrate that high humidity probably acts at a very early point of the Cf downstream signaling pathway, or alternatively influences the interaction between the Cf and the Avr proteins.
Transcript Profiling for Avr4/Cf-4- and Avr9/Cf-9-dependent Defence Gene Expression

Jin-Wen Zhu,You-Ping Xu,Zhi-Xin Zhang,Wen-Yuan Cao,Xin-Zhong Cai

DOI: https://doi.org/10.1007/s10658-008-9294-1

2008-01-01

European Journal of Plant Pathology

Abstract:Tomato Cf genes confer resistance to the leaf mold pathogen Cladosporium fulvum. The Avr4/Cf-4- and Avr9/Cf-9-dependent hypersensitive responses (HRs) are distinct in cell death pattern, intensity, and sensitivity to environmental conditions. To understand the mechanism resulting in these differences, comparative transcript profiling for Avr4/Cf-4- and Avr9/Cf-9-dependent defence gene expression by cDNA-AFLP was performed previously. 367 ACE (Avr/Cf-elicited) transcript-derived fragments (TDFs) were identified, among which 189 were cloned and sequenced. In this study, we report another 89 ACE fragments. These ACE genes were associated with: defence, signal transduction, HR and cell death, transcriptional regulation, metabolism, protein synthesis, photosynthesis, membrane fusion, secretion and trafficking, miscellaneous biological processes, and genes with unknown function or with no significant similarity to known sequences. Among these sequences 43 (potentially encoding 36 types of proteins) were identified for the first time as genes differentially expressed during the development of Avr/Cf-dependent HR. Sequence and expression data from this study further support that transcription is reprogrammed to promote defence response and HR and repress photosynthesis in the Avr/Cf HR+ seedlings.
Avr/Cf Interaction Induce the Expression of Ptis, Genes Encoding Pto-interactors

XZ Cai,YP Xu

IF: 9.106

2002-01-01

Journal of Integrative Plant Biology

Abstract:Products of plant resistance (R) genes Pto and Cf contain distinct domains, and have different cellular localization. It is intriguing to compare the development mechanisms of resistance conferred by the two R genes. In the present report, two hypersensitive response (HR) initiation systems were employed to study the time-course expression induced by Avr/Cf interaction of the genes encoding Pti4, Pti5 and Pti6 which interact directly with Pto: (1) Seeds of tomato (Lycopersicon esculentum Mill.) containing complementary gene pairs Avr4/Cf-4 and Avr9/Cf-9 were obtained through crossing. Their seedlings developed HR under room temperature. (2) Avr/Cf seedlings grew normally at 33 degreesC. When the temperature was shifted down to 25 degreesC, HR occurred within hours in the seedlings. Results of both experiment,, showed that expression of Pti4, Pti5 and Pti6 was induced upon development of hypersensitive necrosis in Avr/Cf seedlings. However, die expression levels and patterns of these Ptis differed. This Finding indicated that these Ptis function complementarily, and might be involved in regulation of both Pto and Cf-conferred resistance.
Genetic and molecular analysis of tomato Cf genes for resistance to Cladosporium fulvum

C M Thomas,M S Dixon,M Parniske,C Golstein,J D Jones

DOI: https://doi.org/10.1098/rstb.1998.0296

1998-09-29

Abstract:In many plant-pathogen interactions resistance to disease is controlled by the interaction of plant-encoded resistance (R) genes and pathogen-encoded avirulence (Avr) genes. The interaction between tomato and the leaf mould pathogen Cladosporium fulvum is an ideal system to study the molecular basis of pathogen perception by plants. A total of four tomato genes for resistance to C. fulvum (Cf-2, Cf-4, Cf-5 and Cf-9) have been isolated from two genetically complex chromosomal loci. Their gene products recognize specific C. fulvum-encoded avirulence gene products (Avr2, Avr4, Avr5 and Avr9) by an unknown molecular mechanism. Cf genes encode extracellular membrane-anchored glycoproteins comprised predominantly of 24 amino acid leucine-rich repeats (LRRs). Cf genes from the same locus encode proteins which are more than 90% identical. Most of the amino-acid sequence differences correspond to the solvent-exposed residues within a beta-strand/beta-turn structural motif which is highly conserved in LRR proteins. Sequence variability within this motif is predicted to affect the specificity of ligand binding. Our analysis of Cf gene loci at the molecular level has shown they comprise tandemly duplicated homologous genes, and suggests a molecular mechanism for the generation of sequence diversity at these loci. Our analysis provides further insight into the molecular basis of pathogen perception by plants and the organization and evolution of R gene loci.
Apoplastic effectors secreted by two unrelated eukaryotic plant pathogens target the tomato defense protease Rcr3

Jing Song,Joe Win,Miaoying Tian,Sebastian Schornack,Farnusch Kaschani,Muhammad Ilyas,Renier A L van der Hoorn,Sophien Kamoun

DOI: https://doi.org/10.1073/pnas.0809201106

2009-02-03

Abstract:Current models of plant-pathogen interactions stipulate that pathogens secrete effector proteins that disable plant defense components known as virulence targets. Occasionally, the perturbations caused by these effectors trigger innate immunity via plant disease resistance proteins as described by the "guard hypothesis." This model is nicely illustrated by the interaction between the fungal plant pathogen Cladosporium fulvum and tomato. C. fulvum secretes a protease inhibitor Avr2 that targets the tomato cysteine protease Rcr3(pim). In plants that carry the resistance protein Cf2, Rcr3(pim) is required for resistance to C. fulvum strains expressing Avr2, thus fulfilling one of the predictions of the guard hypothesis. Another prediction of the guard hypothesis has not yet been tested. Considering that virulence targets are important components of defense, different effectors from unrelated pathogens are expected to evolve to disable the same host target. In this study we confirm this prediction using a different pathogen of tomato, the oomycete Phytophthora infestans that is distantly related to fungi such as C. fulvum. This pathogen secretes an array of protease inhibitors including EPIC1 and EPIC2B that inhibit tomato cysteine proteases. Here we show that, similar to Avr2, EPIC1 and EPIC2B bind and inhibit Rcr3(pim). However, unlike Avr2, EPIC1 and EPIC2B do not trigger hypersensitive cell death or defenses on Cf-2/Rcr3(pim) tomato. We also found that the rcr3-3 mutant of tomato that carries a premature stop codon in the Rcr3 gene exhibits enhanced susceptibility to P. infestans, suggesting a role for Rcr3(pim) in defense. In conclusion, our findings fulfill a key prediction of the guard hypothesis and suggest that the effectors Avr2, EPIC1, and EPIC2B secreted by two unrelated pathogens of tomato target the same defense protease Rcr3(pim). In contrast to C. fulvum, P. infestans appears to have evolved stealthy effectors that carry inhibitory activity without triggering plant innate immunity.
Cladosporium Fulvum CfHNNI1 Induces Hypersensitive Necrosis, Defence Gene Expression and Disease Resistance in Both Host and Nonhost Plants

Xin-Zhong Cai,Xin Zhou,You-Ping Xu,Matthieu H. A. J. Joosten,Pierre J. G. M. de Wit

DOI: https://doi.org/10.1007/s11103-007-9136-0

2007-01-01

Plant Molecular Biology

Abstract:Nonhost resistance as a durable and broad-spectrum defence strategy is of great potential for agricultural applications. We have previously isolated a cDNA showing homology with genes encoding bZIP transcription factors from tomato leaf mould pathogen Cladosporium fulvum. Upon expression, the cDNA results in necrosis in C. fulvum host tomato and nonhost tobacco plants and is thus named CfHNNI1 (for C . f ulvum host and nonhost plant necrosis inducer 1). In the present study we report the induction of necrosis in a variety of nonhost plant species belonging to three families by the transient in planta expression of CfHNNI1 using virus-based vectors. Additionally, transient expression of CfHNNI1 also induced expression of the HR marker gene LeHSR203 and greatly reduced the accumulation of recombinant Potato virus X. Stable CfHNNI1 transgenic tobacco plants were generated in which the expression of CfHNNI1 is under the control of the pathogen-inducible hsr203J promoter. When infected with the oomycetes pathogen Phytophthora parasitica var. nicotianae, these transgenic plants manifested enhanced expression of CfHNNI1 and subsequent accumulation of CfHNNI1 protein, resulting in high expression of the HSR203J and PR genes, and strong resistance to the pathogen. The CfHNNI1 transgenic plants also exhibited induced resistance to Pseudomonas syringae pv. tabaci and Tobacco mosaic virus. Furthermore, CfHNNI1 was highly expressed and the protein was translocated into plant cells during the incompatible interactions between C. fulvum and host and nonhost plants. Our results demonstrate that CfHNNI1 is a potential general elicitor of hypersensitive response and nonhost resistance.
Bioengineering secreted proteases converts divergent Rcr3 orthologs and paralogs into extracellular immune co-receptors

Jiorgos Kourelis,Mariana Schuster,Fatih Demir,Oliver Mattinson,Sonja Krauter,Parvinderdeep S. Kahlon,Ruby O'Grady,Samantha Royston,Ana Lucia Bravo-Cazar,Brian C. Mooney,Pitter F. Huesgen,Sophien Kamoun,Renier A. L. van der Hoorn

DOI: https://doi.org/10.1101/2024.02.14.580413

2024-05-23

Abstract:Secreted immune proteases Rcr3 and Pip1 of tomato are both inhibited by Avr2 from the fungal plant pathogen Cladosporium fulvum but only Rcr3 act as a decoy co-receptor that detects Avr2 in the presence of the Cf-2 immune receptor. Here, we identified crucial residues from tomato Rcr3 required for Cf-2-mediated signalling and bioengineered various proteases to trigger Avr2/Cf-2 dependent immunity. Despite substantial divergences in Rcr3 orthologs from eggplant and tobacco, only minimal alterations were sufficient to trigger Avr2/Cf-2-triggered immune signalling. Tomato Pip1, by contrast, was bioengineered with 16 Rcr3-specific residues to initiate Avr2/Cf-2-triggered immune signalling. These residues cluster on one side next to the substrate binding groove, indicating a potential Cf-2 interaction site. Our findings also revealed that Rcr3 and Pip1 have distinct substrate preferences determined by two variant residues and that both are suboptimal for binding Avr2. This study advances our understanding of Avr2 perception and opens avenues to bioengineer proteases to broaden pathogen recognition in other crops.

Plant Biology
Adsorption and deposition-assisted anodic stripping voltammetry for determination of antimony(III) in presence of hematoxylin on glassy carbon electrode.

Hanife Vardar Sezgin,Y. Dilgin,H. Gökçel

DOI: https://doi.org/10.1016/j.talanta.2016.10.103

2017-03-01

Abstract:
Transcriptional and Posttranscriptional Regulation of the Tomato Leaf Mould Disease Resistance Gene Cf-9.

Wen Li,You-Ping Xu,Xin-Zhong Cai

DOI: https://doi.org/10.1016/j.bbrc.2016.01.015

IF: 3.1

2016-01-01

Biochemical and Biophysical Research Communications

Abstract:Plant disease resistance (R) genes confer effector-triggered immunity (ETI) to pathogens carrying complementary effector/avirulence (Avr) genes. They are traditionally recognized to function at translational and/or posttranslational levels. In this study, however, transcriptional and posttranscriptional regulation of Cf-9, a tomato R gene conferring resistance to leaf mould fungal pathogen carrying Avr9, was demonstrated. Expression of the Cf-9 gene was 10.8-54.7 folds higher in the Cf-9/Avr9 tomato lines than in the Cf-9 lines depending on the seedling age, indicating that the Cf-9 gene expression was strongly induced by Avr9. Moreover, expression of the Cf-9 gene in the 5-day-old Cf-9/Avr9 seedlings at 33 degrees C was approximately 80 folds lower than that at 25 degrees C, and was enhanced by 23.4 folds at only 4 h post temperature shift from 33 degrees C to 25 degrees C, demonstrating that the Avr9-mediated induction of the Cf-9 gene expression is reversibly repressed by high temperature. Expression of the Cf-9 gene in the Cf-9 seedlings was similarly affected by temperature as in the Cf-9/Avr9 seedlings, implying that the genetic control of temperature sensitivity of the Cf-9 gene expression is epistasis to its Avr9-mediated induction. Additionally, a miRNA sly-miR6022, TGGAAGGGAGAATATCCAGGA, targeting the leucine-rich repeat (LRR) domain spanning LRR13-LRR14 of the Cf-9 gene transcript was predicted. Over-expression of this miRNA resulted in over 88% reduction of the Cf-9 gene transcripts in both Nicotiana benthamiana and tomato, and thus verifying the function of sly-miR6022 in degrading the Cf-9 gene transcripts. Collectively, our results reveal that the tomato R gene Cf-9 is strongly regulated at transcriptional level by pathogen Avr9 in a temperature-sensitive manner and is also regulated at posttranscriptional level by a miRNA sly-miR6022. (C) 2016 Elsevier Inc. All rights reserved.
The molecular basis of co-evolution between Cladosporium fulvum and tomato

Pierre J G M de Wit,B F Brandwagt,H A van den Burg,X Cai,R A L van der Hoorn,C F de Jong,J van Klooster,M J D de Kock,M Kruijt,W H Lindhout,R Luderer,F L W Takken,N Westerink,J J M Vervoort,M H A J Joosten

DOI: https://doi.org/10.1023/a:1020553120889

Antonie van Leeuwenhoek

Abstract:Cladosporiumfulvum is a semi-biotrophic pathogen, which causes leaf mold of tomato (Lycopersicon spp.). In our laboratory this pathosystem serves as a model to study gene-for-gene interactions between plants and pathogenic fungi (Joosten & De Wit 1999). Many avirulence (Avr) genes and matching resistance (CQ) genes have been cloned and we are now beginning to understand how their products can induce an array of plant defense responses, including the classic hypersensitive response (HR). Here, we will discuss the latest results of our molecular studies on this interaction. These include the isolation of: (i) two new Avr genes, Avr2 and Avr4E, (ii) the determination of the specificity determinants within the Cf-4 and Cf-9 genes by artificial domain swaps and introduction of point mutations, (iii) the analysis of polymorphism occurring in AVR9-responsive Cf genes occurring in natural populations of L. pimpinellifolium, and finally (iv) the description of an efficient method to identify early HR-related genes.
Stretch receptors in urodele limb muscles

Q. Bone,R. Ridge,K. Ryan

DOI: https://doi.org/10.1007/BF00226663

1976-01-26

Cell and Tissue Research

Abstract:
Variable leucine-rich repeats of tomato disease resistance genes Cf-2 and Cf-5 determine specificity.

M. Dixon,P. Seear

DOI: https://doi.org/10.1046/j.1364-3703.2003.00162.x

IF: 4.9

2003-05-01

Molecular Plant Pathology

Abstract:SUMMARY The tomato Cf-2 and Cf-5 genes confer race specific resistance to infection by the leaf mould pathogen Cladosporium fulvum. The encoded proteins induce a defence response upon recognition of the fungal Avr2 and Avr5 determinants, respectively. Each resistance protein is comprised largely of leucine-rich repeats (LRRs) and the specificity of recognition is thought to occur through a particular domain. We have investigated this further using domain swaps between Cf-2 and Cf-5. Engineered chimeric genes containing portions of Cf-2 and Cf-5 were expressed and shown to be functional. The results clearly show that the specificity for the particular avirulence determinant is restricted to a region of each gene that encodes a subset of LRRs containing the highest level of intergenic variability. In addition, two non-functional mutants of Cf-5 were characterized and their significance discussed.

Medicine,Biology,Environmental Science
A nuclear localization for Avr2 from Fusarium oxysporum is required to activate the tomato resistance protein I-2

Lisong Ma,Ben J C Cornelissen,Frank L W Takken

DOI: https://doi.org/10.3389/fpls.2013.00094

2013-04-11

Abstract:Plant pathogens secrete effector proteins to promote host colonization. During infection of tomato xylem vessels, Fusarium oxysporum f. sp. lycopersici (Fol) secretes the Avr2 effector protein. Besides being a virulence factor, Avr2 is recognized intracellularly by the tomato I-2 resistance protein, resulting in the induction of host defenses. Here, we show that AVR2 is highly expressed in root- and xylem-colonizing hyphae three days post inoculation of roots. Co-expression of I-2 with AVR2 deletion constructs using agroinfiltration in Nicotiana benthamiana leaves revealed that, except for the N-terminal 17 amino acids, the entire AVR2 protein is required to trigger I-2-mediated cell death. The truncated Avr2 variants are still able to form homo-dimers, showing that the central region of Avr2 is required for dimerization. Simultaneous production of I-2 and Avr2 chimeras carrying various subcellular localization signals in N. benthamiana leaves revealed that a nuclear localization of Avr2 is required to trigger I-2-dependent cell death. Nuclear exclusion of Avr2 prevented its activation of I-2, suggesting that Avr2 is recognized by I-2 in the nucleus.

Endotoxin is a component in the pathogenesis of chronic viral diseases

Molecular Mechanism of Interaction Between Tomato and Leaf Mold Pathogen Cladosporium Fulvum

The Cladosporium fulvum virulence protein Avr2 inhibits host proteases required for basal defense

Cladosporium fulvum overcomes Cf-2-mediated resistance by producing truncated AVR2 elicitor proteins

Attenuation of Cf-mediated defense responses at elevated temperatures correlates with a decrease in elicitor-binding sites.

Fungal effector protein AVR2 targets diversifying defense-related cys proteases of tomato

Specific Recognition of AVR4 and AVR9 Results in Distinct Patterns of Hypersensitive Cell Death in Tomato, but Similar Patterns of Defence-Related Gene Expression.

the European Commission under the Programme of Community Action in the field of Public Health 2008 – 2013 Grant Agreement n ° 2008 13 05

High humidity represses Cf-4/Avr4- and Cf-9/Avr9 -dependent hypersensitive cell death and defense gene expression

Transcript Profiling for Avr4/Cf-4- and Avr9/Cf-9-dependent Defence Gene Expression

Avr/Cf Interaction Induce the Expression of Ptis, Genes Encoding Pto-interactors

Genetic and molecular analysis of tomato Cf genes for resistance to Cladosporium fulvum

Apoplastic effectors secreted by two unrelated eukaryotic plant pathogens target the tomato defense protease Rcr3

Cladosporium Fulvum CfHNNI1 Induces Hypersensitive Necrosis, Defence Gene Expression and Disease Resistance in Both Host and Nonhost Plants

Bioengineering secreted proteases converts divergent Rcr3 orthologs and paralogs into extracellular immune co-receptors

Adsorption and deposition-assisted anodic stripping voltammetry for determination of antimony(III) in presence of hematoxylin on glassy carbon electrode.

Transcriptional and Posttranscriptional Regulation of the Tomato Leaf Mould Disease Resistance Gene Cf-9.

The molecular basis of co-evolution between Cladosporium fulvum and tomato

Stretch receptors in urodele limb muscles

Variable leucine-rich repeats of tomato disease resistance genes Cf-2 and Cf-5 determine specificity.

A nuclear localization for Avr2 from Fusarium oxysporum is required to activate the tomato resistance protein I-2