Correction to “MicroRNA-596 acts as a tumor suppressor in gastric cancer and is upregulated by promotor demethylation”

Zhen Zhang,Dong-Qiu Dai

DOI: https://doi.org/10.3748/wjg.v28.i43.6203

IF: 5.374

2022-11-21

World Journal of Gastroenterology

Abstract:[This corrects the article on p. 1224 in vol. 25, PMID: 30886505.].

gastroenterology & hepatology

What problem does this paper attempt to address?

Correction To: MiRNA-195-5p Functions As a Tumor Suppressor and a Predictive of Poor Prognosis in Non-small Cell Lung Cancer by Directly Targeting CIAPIN1

Jing Zheng,Tao Xu,Feng Chen,Ying Zhang

DOI: https://doi.org/10.1007/s12253-020-00794-3

2020-01-01

Abstract:The original version of this article unfortunately contained an error in the affiliation section.
Corrigendum: DYNC1I1 Promotes the Proliferation and Migration of Gastric Cancer by Up-Regulating IL-6 Expression

Li-Bao Gong,Ti Wen,Zhi Li,Xing Xin,Xiao-Fang Che,Jin Wang,Yun-Peng Liu,Xiu-Juan Qu

DOI: https://doi.org/10.3389/fonc.2022.819244

IF: 4.7

2022-02-24

Frontiers in Oncology

Abstract:[This corrects the article DOI: 10.3389/fonc.2019.00491.].

oncology
[Corrected] miR‐590‐5p may regulate colorectal cancer cell viability and migration by targeting PDCD4

Ting Guo,Jun Wang,Guochang Cheng,He Huang

DOI: https://doi.org/10.3892/etm.2024.12392

IF: 2.7

2024-01-17

Experimental and Therapeutic Medicine

Abstract:[This corrects the article DOI: 10.3892/etm.2020.9183.].

medicine, research & experimental
Correction to: The role of microRNA-133b and its target gene FSCN1 in gastric cancer

Lihua Guo,Hua Bai,Dongling Zou,Tao Hong,Jie Liu,Jiaqiang Huang,Pengfei He,Qi Zhou,Jinsheng He

DOI: https://doi.org/10.1186/s13046-020-01716-6

2020-10-20

Abstract:An amendment to this paper has been published and can be accessed via the original article.

oncology
Corrigendum: Downregulation of miR-135b-5p Suppresses Progression of Esophageal Cancer and Contributes to the Effect of Cisplatin

Yuzhu Di,Yanan Jiang,Xiuyun Shen,Jing Liu,Yang Gao,Huimin Cai,Xiaoli Sun,Dandan Ning,Bing Liu,Jiaji Lei,Shizhu Jin

DOI: https://doi.org/10.3389/fonc.2021.785363

IF: 4.7

2021-11-15

Frontiers in Oncology

Abstract:[This corrects the article DOI: 10.3389/fonc.2021.679348.].

oncology
Corrigendum to “ARMCX Family Gene Expression Analysis and Potential Prognostic Biomarkers for Prediction of Clinical Outcome in Patients with Gastric Carcinoma”

TingAn Wang,HuaGe Zhong,YuZhou Qin,WeiYuan Wei,Zhao Li,MingWei Huang,XiaoLing Luo

DOI: https://doi.org/10.1155/2021/3179693

2021-02-09

BioMed Research International

Abstract:[This corrects the article DOI: 10.1155/2020/3575038.].

biotechnology & applied microbiology,medicine, research & experimental
[Corrigendum] miR‐199b‐5p serves as a tumor suppressor in renal cell carcinoma

Yulin Lai,Jing Quan,Canbin Lin,Hang Li,Jia Hu,Peijie Chen,Jinling Xu,Xin Guan,Weijie Xu,Yongqing Lai,Liangchao Ni

DOI: https://doi.org/10.3892/etm.2024.12422

IF: 2.7

2024-02-09

Experimental and Therapeutic Medicine

Abstract:[This corrects the article DOI: 10.3892/etm.2018.6151.].

medicine, research & experimental
Correction to: The m6A eraser FTO facilitates proliferation and migration of human cervical cancer cells

Dongling Zou,Lei Dong,Chenying Li,Zhe Yin,Shuan Rao,Qi Zhou

DOI: https://doi.org/10.1186/s12935-020-01473-8

2020-08-30

Abstract:[This corrects the article DOI: 10.1186/s12935-019-1045-1.].
Correction: ZFPM2-AS1, a Novel Lncrna, Attenuates the P53 Pathway and Promotes Gastric Carcinogenesis by Stabilizing MIF.

Fanyang Kong,Xuan Deng,Xiangyu Kong,Yiqi Du,Lei Li,Huiyun Zhu,Yuxin Wang,Dacheng Xie,Shivani Guha,Zhaoshen Li,Ming Guan,Keping Xie

DOI: https://doi.org/10.1038/s41388-018-0412-z

IF: 8.756

2018-01-01

Oncogene

Abstract:Since the online publication of the above article, the authors have noted errors in the affiliations. The authors apologise for any inconvenience caused by this error. The html and online pdf versions have now been rectified and carry the corrected paper.
Corrigendum: Anticancer applications of phytochemicals in gastric cancer: effects and molecular mechanism

Zhaofeng Liang,Yumeng Xu,Yue Zhang,Xinyi Zhang,Jiajia Song,Hui Qian,Jianhua Jin

DOI: https://doi.org/10.3389/fphar.2024.1405513

2024-08-19

Abstract:[This corrects the article DOI: 10.3389/fphar.2022.1078090.].
Correction To: MiR-139-5p Inhibits Migration and Invasion of Colorectal Cancer by Downregulating AMFR and NOTCH1

Mingxu Song,Yuan Yin,Jiwei Zhang,Binbin Zhang,Zehua Bian,Chao Quan,Leyuan Zhou,Yaling Hu,Qifeng Wang,Shujuan Ni,Bojian Fei,Weili Wang,Xiang Du,Hua Dong,Zhaohui Huang

DOI: https://doi.org/10.1007/s13238-021-00826-x

2021-01-01

Protein & Cell

Abstract:In the original publication the display of Fig. 1 is incorrect. The correct figure is available in this correction.
[Corrigendum] Knockdown of circ_0067934 inhibits gastric cancer cell proliferation, migration and invasion via the miR‑1301‑3p/KIF23 axis

Jin Xu,Nan Sang,Junning Zhao,Wei He,Nannan Zhang,Xueliang Li

DOI: https://doi.org/10.3892/mmr.2024.13307

Abstract:Following the publication of the above article, an interested reader drew to our attention the fact that the forward primer reported in Table I on p. 3 for miR‑545‑3p (5'‑TGGCTCAGTTCAGCAGGAAC‑3') was actually for miR‑24‑3p (5'‑UGGCUCAGUUCAGCAGGAACAG‑3'). Upon performing an independent analysis of the primer sequences in the Editorial Office, the sequence presented for miR‑670‑5p also appeared to have potentially been written incorrectly. After having drawn these matters to the attention of the authors, they realized that these sequences had indeed been written incorrectly in Table I. The corrected version of Table I, featuring the correct forward and reverse primer sequences for both miR‑670‑5p and miR‑545‑3p, is shown opposite. The authors wish to thank the interested reader for drawing this error to their attention, and are grateful to the Editor of Molecular Medicine Reports for allowing them this opportunity to publish a Corrigendum. They also apologize to the readership for any inconvenience caused. [Molecular Medicine Reports 25: 202, 2022; DOI: 10.3892/mmr.2022.12718].
Corrigendum: MicroRNA-608 Promotes Apoptosis in Non-Small Cell Lung Cancer Cells Treated With Doxorubicin Through the Inhibition of TFAP4

Yi-Fei Wang,Xiang Ao,Ying Liu,Dan Ding,Wen-Jie Jiao,Zhuang Yu,Wen-Xin Zhai,Sheng-Hua Dong,Yu-Qi He,Hang Guo,Jian-Xun Wang

DOI: https://doi.org/10.3389/fgene.2021.649586

IF: 3.7

2021-03-30

Frontiers in Genetics

Abstract:[This corrects the article DOI: 10.3389/fgene.2019.00809.].

genetics & heredity
Corrigendum: Gut microbiome alterations during gastric cancer: evidence assessment of case–control studies

Ruimin Zhang,Yingxin Wu,Wantao Ju,Senlin Wang,Yanjun Liu,Hongmei Zhu

DOI: https://doi.org/10.3389/fmicb.2024.1448265

IF: 5.2

2024-06-25

Frontiers in Microbiology

Abstract:This article is a correction to: Gut microbiome alterations during gastric cancer: evidence assessment of case–control studies

microbiology
Correction: Up-Regulation of 91H Promotes Tumor Metastasis and Predicts Poor Prognosis for Patients with Colorectal Cancer.

Qiwen Deng,Bangshun He,Tianyi Gao,Yuqin Pan,Huiling Sun,Yeqiong Xu,Rui Li,Houqun Ying,Feng Wang,Xian Liu,Jie Chen,Shukui Wang

DOI: https://doi.org/10.1371/journal.pone.0304249

IF: 3.7

2024-01-01

PLoS ONE

Abstract:[This corrects the article DOI: 10.1371/journal.pone.0103022.].
Corrigendum: Regulation of microrna-497-targeting AKT2 influences tumor growth and chemoresistance to cisplatin in lung cancer

Lin Wang,Xiang-Bo Ji,Li-Hong Wang,Jian-Ge Qiu,Feng-Mei Zhou,Wen-Jing Liu,Di-di Wan,Marie Chai-mi Lin,Ling-Zhi Liu,Jian-Ying Zhang,Bing-Hua Jiang

DOI: https://doi.org/10.3389/fcell.2022.1008088

IF: 5.5

2022-09-23

Frontiers in Cell and Developmental Biology

Abstract:[This corrects the article DOI: 10.3389/fcell.2020.00840.].

cell biology,developmental biology
Correction to: Zinc-finger protein 471 suppresses gastric cancer through transcriptionally repressing downstream oncogenic PLS3 and TFAP2A

Lei Cao,Shiyan Wang,Yanquan Zhang,Ka-Chun Wong,Geicho Nakatsu,Xiaohong Wang,Sunny Wong,Jiafu Ji,Jun Yu

DOI: https://doi.org/10.1038/s41388-022-02216-x

IF: 8.756

2022-04-29

Oncogene

Abstract:Oncogene, Published online: 28 April 2022; doi:10.1038/s41388-022-02216-x Correction to: Zinc-finger protein 471 suppresses gastric cancer through transcriptionally repressing downstream oncogenic PLS3 and TFAP2A

oncology,genetics & heredity,biochemistry & molecular biology,cell biology
[Corrigendum] miR‐146b‐5p inhibits tumorigenesis and metastasis of gallbladder cancer by targeting Toll‐like receptor 4 via the nuclear factor‐κB pathway

Bin Ouyang,Ningfeng Pan,Haifeng Zhang,Chuanming Xing,Wu Ji

DOI: https://doi.org/10.3892/or.2024.8699

2024-01-10

Oncology Reports

Abstract:Following the publication of the article, the authors drew to the Editor's attention that, in Fig. 4D on p. 7, the data correctly shown to represent the E‐cadherin bands for the "NOZ" experiment had inadvertently been used to show the Vimentin bands. However, the authors retained their original data, and the corrected version of Fig. 4, now showing the correct data for the Vimentin bands in Fig. 4D for the "NOZ" experiment, is shown on the next page. Note that this error did not grossly affect either the results or the conclusions reported in this work. All the authors agree with the publication of this Corrigendum, and are grateful to the Editor of Oncology Reports for granting them the opportunity to correct the error that was made during the assembly of this figure. Lastly, the authors apologize to the readership for any inconvenience this error may have caused. [Oncology Reports 45: 15, 2021; DOI: 10.3892/or.2021.7966]

oncology
Transcriptional Downregulation of miR-4306 serves as a New Therapeutic Target for Triple Negative Breast Cancer: Erratum

Zitong Zhao,Lin Li,Peina Du,Liying Ma,Weimin Zhang,Leilei Zheng,Bo Lan,Bailin Zhang,Fei Ma,Bo Xu,Qimin Zhan,Yongmei Song

DOI: https://doi.org/10.7150/thno.82636

IF: 11.6

2023-01-01

Theranostics

Abstract:[This corrects the article DOI: 10.7150/thno.30701.].

medicine, research & experimental
Erratum: [Corrigendum] miR‑216a‑5p acts as an oncogene in renal cell carcinoma.

Peijie Chen,Jing Quan,Lu Jin,Canbin Lin,Weijie Xu,Jinling Xu,Xin Guan,Zebo Chen,Liangchao Ni,Shangqi Yang,Yun Chen,Yongqing Lai

DOI: https://doi.org/10.3892/etm.2024.12443

IF: 2.7

2024-01-01

Experimental and Therapeutic Medicine

Abstract:[This corrects the article DOI: 10.3892/etm.2018.5881.].

Correction to “MicroRNA-596 acts as a tumor suppressor in gastric cancer and is upregulated by promotor demethylation”

Correction To: MiRNA-195-5p Functions As a Tumor Suppressor and a Predictive of Poor Prognosis in Non-small Cell Lung Cancer by Directly Targeting CIAPIN1

Corrigendum: DYNC1I1 Promotes the Proliferation and Migration of Gastric Cancer by Up-Regulating IL-6 Expression

[Corrected] miR‐590‐5p may regulate colorectal cancer cell viability and migration by targeting PDCD4

Correction to: The role of microRNA-133b and its target gene FSCN1 in gastric cancer

Corrigendum: Downregulation of miR-135b-5p Suppresses Progression of Esophageal Cancer and Contributes to the Effect of Cisplatin

Corrigendum to “ARMCX Family Gene Expression Analysis and Potential Prognostic Biomarkers for Prediction of Clinical Outcome in Patients with Gastric Carcinoma”

[Corrigendum] miR‐199b‐5p serves as a tumor suppressor in renal cell carcinoma

Correction to: The m6A eraser FTO facilitates proliferation and migration of human cervical cancer cells

Correction: ZFPM2-AS1, a Novel Lncrna, Attenuates the P53 Pathway and Promotes Gastric Carcinogenesis by Stabilizing MIF.

Corrigendum: Anticancer applications of phytochemicals in gastric cancer: effects and molecular mechanism

Correction To: MiR-139-5p Inhibits Migration and Invasion of Colorectal Cancer by Downregulating AMFR and NOTCH1

[Corrigendum] Knockdown of circ_0067934 inhibits gastric cancer cell proliferation, migration and invasion via the miR‑1301‑3p/KIF23 axis

Corrigendum: MicroRNA-608 Promotes Apoptosis in Non-Small Cell Lung Cancer Cells Treated With Doxorubicin Through the Inhibition of TFAP4

Corrigendum: Gut microbiome alterations during gastric cancer: evidence assessment of case–control studies

Correction: Up-Regulation of 91H Promotes Tumor Metastasis and Predicts Poor Prognosis for Patients with Colorectal Cancer.

Corrigendum: Regulation of microrna-497-targeting AKT2 influences tumor growth and chemoresistance to cisplatin in lung cancer

Correction to: Zinc-finger protein 471 suppresses gastric cancer through transcriptionally repressing downstream oncogenic PLS3 and TFAP2A

[Corrigendum] miR‐146b‐5p inhibits tumorigenesis and metastasis of gallbladder cancer by targeting Toll‐like receptor 4 via the nuclear factor‐κB pathway

Transcriptional Downregulation of miR-4306 serves as a New Therapeutic Target for Triple Negative Breast Cancer: Erratum

Erratum: [Corrigendum] miR‑216a‑5p acts as an oncogene in renal cell carcinoma.