Abstract:Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in -proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by -galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven -gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.

Lipoic acid attachment to proteins: stimulating new developments

Identification of a novel lipoic acid biosynthesis pathway reveals the complex evolution of lipoate assembly in prokaryotes

Investigation of Protein Post-Translational Modifications with Site-Specifically Incorporated Non-Canonical Amino Acids

Global Landscape of Lysine Acylomes in Bacillus Subtilis

Characterization of Protein Lysine Propionylation in Escherichia Coli: Global Profiling, Dynamic Change, and Enzymatic Regulation.

A New Regulatory Mechanism for Bacterial Lipoic Acid Synthesis

Characterization of the Lysine Acylomes and the Substrates Regulated by Protein Acyltransferase in Mycobacterium Smegmatis

The role of the Saccharomyces cerevisiae lipoate protein ligase homologue, Lip3, in lipoic acid synthesis

A hub for regulation of mitochondrial metabolism: Fatty acid and lipoic acid biosynthesis

Global Profiling of Protein Lysine Malonylation in Escherichia Coli Reveals Its Role in Energy Metabolism.

Lipoic Acid Metabolism as a Potential Chemotherapeutic Target Against Plasmodium falciparum and Staphylococcus aureus

Protein lipidation in health and disease: molecular basis, physiological function and pathological implication

Bacterial lipoate protein ligases rescue lipoylation and respiration deficiency in mammals

Protein Lipidation in Cell Signaling and Diseases: Function, Regulation, and Therapeutic Opportunities.

Conditional Knock-out of Lipoic Acid Protein Ligase 1 Reveals Redundancy Pathway for Lipoic Acid Metabolism in Plasmodium Berghei Malaria Parasite

Ubiquitylome study reveals the regulatory effect of α-lipoic acid on ubiquitination of key proteins in tryptophan metabolism pathway of pig liver

Activation and competition of lipoylation of H protein and its hydrolysis in a reaction cascade catalyzed by the multifunctional enzyme lipoate-protein ligase A

Characterization of a Dehydratase and Methyltransferase in the Biosynthesis of Ribosomally Synthesized and Post-translationally Modified Peptides in Lachnospiraceae

Post-translational Protein Acetylation: An Elegant Mechanism for Bacteria to Dynamically Regulate Metabolic Functions

New insights into the functions of ACBD4/5-like proteins using a combined phylogenetic and experimental approach across model organisms

Quantitative Site-Specific Chemoproteomic Profiling of Protein Lipoylation.