Abstract:Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in -proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by -galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven -gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.

Bacterial lipoate protein ligases rescue lipoylation and respiration deficiency in mammals

A Multi-Target Pharmacological Correction of a Lipoyltransferase LIPT1 Gene Mutation in Patient-Derived Cellular Models

Long-Term Correction of Murine Lipoprotein Lipase Deficiency with AAV1-Mediated Gene Transfer of the Naturally Occurring LPLS447XBeneficial Mutation

Abstract 14068: the Lipid Droplet-Associated Lncrna LIPTER Preserves Cardiac Lipid Metabolism of Human Cardiomyocytes

40. Correction of Dyslipidemia in Murine and Feline Models of Lipoprotein Lipase Deficiency by Intramuscular Administration of AAV1-LPLS447X

Deletion of a Previously Uncharacterized Lipoprotein Lirl Confers Resistance to an Inhibitor of Type II Signal Peptidase in Acinetobacter Baumannii

Functional Reconstitution of a Pyruvate Dehydrogenase in the Cytosol of Saccharomyces Cerevisiae Through Lipoylation Machinery Engineering

The role of the Saccharomyces cerevisiae lipoate protein ligase homologue, Lip3, in lipoic acid synthesis

ATGL-mediated lipolysis is essential for myocellular mitochondrial function and augments PPARδ-induced improvements in mitochondrial respiration

Complete Rescue of Lipoprotein Lipase–Deficient Mice by Somatic Gene Transfer of the Naturally Occurring LPLS447XBeneficial Mutation

A New Regulatory Mechanism for Bacterial Lipoic Acid Synthesis

Expanding the Scope of Genetically Encoded Lysine Post-Translational Modifications with Lactylation, -Hydroxybutyrylation and Lipoylation

Mitochondrial energetics is impaired in very long-chain acyl-CoA dehydrogenase deficiency and can be rescued by treatment with mitochondria-targeted electron scavengers

Rescue of Familial Lecithin:Cholesterol Acyltranferase Deficiency Mutations with an Allosteric Activator

Inactivating the lipid kinase activity of PI3KC2β is sufficient to rescue myotubular myopathy in mice

Expanding the Scope of Genetically Encoded Lysine PTMs with Lactylation, β‐Hydroxybutyrylation and Lipoylation

Rescue of lysosomal acid lipase deficiency in mice by rAAV8 liver gene transfer

Loss of TMEM55B modulates lipid metabolism through dysregulated lipophagy and mitochondrial function

Integrated Action of Autophagy and Adipose Tissue Triglyceride Lipase Ameliorates Diet-Induced Hepatic Steatosis in Liver-Specific PLIN2 Knockout Mice

Lipid droplet-associated lncRNA LIPTER preserves cardiac lipid metabolism

Compromised mitochondrial quality control triggers lipin1-related rhabdomyolysis