Abstract:Introduction: Dendritic cells (DCs) constitute a distinct type of immune cell found within tumors, serving a central role in mediating tumor antigen-specific immunity against cancer cells. Frequently, DC functions are dysregulated by the immunosuppressive signals present within the tumor microenvironment (TME). Consequently, DC manipulation holds great potential to enhance the cytotoxic T cell response against cancer diseases. The Fms-like tyrosine kinase receptor 3 ligand (Flt3L) is a pluripotent growth factor that regulates the maturation and differentiation of DCs in hematopoiesis. The in vivo administration of Flt3L itself is limited by its short serum half-life. To overcome this major drawback, our group developed a novel fusion protein albumin-Flt3L (alb-Flt3L), which is the conjugation of albumin to Flt3L. Our hypothesis is that the Flt3L, which has extended bioavailability, is a feasible therapeutic strategy to overcome these treatment limitations. Method: A novel alb-Flt3L DNA, a plasmid encoding the alb-Flt3L protein, was administrated for its anti-tumor effect on TC-1 tumor-bearing C57BL/6 mice. For the generation of pcDNA3-albFlt3L, mouse Flt3 ligand was amplified by PCR using cDNA template of pcDNA3-Flt3L1 and a set of primers, 5′- TTTGAATTCGGGACACCTGACTGTTACTTC-3′ and 5′- AAACTTAAGCTACTGCCTGGGCCGAGGCTCTGG -3′. alb-Flt3L DNA (10ug), Flt3L DNA (10ug) or vehicle control was injected intratumorally followed by electroporation for a total of three times in 5-day intervals. Peripheral blood mononuclear cells and tumor-infiltrated immune cells were isolated after treatment. Flow cytometry was performed for immune cell analysis. Results: In this current study, the electroporation-mediated delivery of alb-Flt3L DNA demonstrated the ability to induce an anti-tumor immune response. This albumin fusion construct possesses more persistent bioactivity in targeted organs. Furthermore, mice receiving alb-Flt3L DNA treatment presented better tumor control and superior survival. Cellular analysis revealed that alb-Flt3L DNA administration displayed greater systemic DC population. In addition, robust cDC1 expansion, which is associated with superior antigen cross-presentation and cellular immunity against tumors, developed extensively in the tumor, lymph node, and blood. In addition, increased levels of IFN-γ-secreting CD8+ lymphocytes and tumor-infiltrated immune cells were found in correlation to greater cDC1 population. Conclusion: Our data showcases a novel DC-based immunotherapy using electroporation to administer alb-Flt3L DNA. The treatment effect is revealed by a controlled tumor response, characterized by enhanced DC mobilization and accumulation in both the lymph nodes and TME, coupled with an increase in the expansion of cDC1 subsets and a heightened level of CD8+ T cell activation. Citation Format: Ming-Hung Hu, Tzyy-Choou Wu, Chien-Fu Hung. Electroporation-mediated novel albumin-fused Flt3L DNA delivery promotes cDC1-associated anticancer immunity [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular s); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl) nr 2476.

Enhanced anti-tumor efficacy of electroporation (EP)-mediated DNA vaccine boosted by allogeneic lymphocytes in pre-established tumor models

More efficient induction of antitumor T cell immunity by exosomes from CD40L gene-modified lung tumor cells.

Active Antitumor Immunity Elicited by Vaccine Based on Recombinant Form of Epidermal Growth Factor Receptor

Combination of GNRs-PEI/cGAMP-laden Macrophages-Based Photothermal Induced in Situ Tumor Vaccines and Immune Checkpoint Blockade for Synergistic Anti-Tumor Immunotherapy.

Immunogene therapy of tumors with vaccine based on xenogeneic epidermal growth factor receptor.

Vaccination with Xenogeneic Tumor Endothelial Proteins Isolated in Situ Inhibits Tumor Angiogenesis and Spontaneous Metastasis

Transdermal microarrayed electroporation for enhanced cancer immunotherapy based on DNA vaccination

Abstract 2476: Electroporation-mediated novel albumin-fused Flt3L DNA delivery promotes cDC1-associated anticancer immunity

Enhancement of DNA vaccine efficacy by targeting the xenogeneic human chorionic gonadotropin, survivin and vascular endothelial growth factor receptor 2 combined tumor antigen to the major histocompatibility complex class II pathway.

Enhancedanti-tumor efficacy through a combination of intramuscularly expressed DNA vaccine and plasmid-encoded PD-1 antibody

Tumor Cell-associated Exosomes Robustly Elicit Anti-tumor Immune Responses through Modulating Dendritic Cell Vaccines in Lung Tumor

Engineering PEG10 assembled endogenous virus-like particles with genetically encoded neoantigen peptides for cancer vaccination

Synergistic tumor immunological strategy by combining tumor nanovaccine with gene-mediated extracellular matrix scavenger

Engineering PEG10assembled endogenous virus-like particles with genetically encoded neoantigen peptides for cancer vaccination

Modification of the tumor microenvironment enhances immunity with plasmid gene therapy

Allogeneic Dendritic Cells Induce Potent Antitumor Immunity by Activating KLRG1+CD8 T Cells

Dendritic Cells Pulsed With Gst-Egfr Fusion Protein: Effect In Antitumor Immunity Against Head And Neck Squamous Cell Carcinoma

Activation and Propagation of Tumor-Infiltrating Lymphocytes from Malignant Pleural Effusion and Ascites with Engineered Cells for Costimulatory Enhancement.

PD-L1 Antibodies-Armed Exosomal Vaccine for Enhanced Cancer Immunotherapy by Simultaneously in Situ Activating T Cells and Blocking PD-1/PD-L1 Axis

Co-delivery of Tumor-Derived Exosomes with Alpha-Galactosylceramide on Dendritic Cell-Based Immunotherapy for Glioblastoma

Enhanced Immunogenicity of Leukemia-Derived Exosomes Via Transfection with Lentiviral Vectors Encoding Costimulatory Molecules