Abstract:Grapevine asteroid mosaic associated virus (GAMaV) is a member of the genus Marafivirus, family Tymoviridae. GAMaV was initially found to infect grapevine (Vitis vinifera) in California and was also reported in Japan, Canada, Uruguay, France, Hungary and Italy (Nakaune et al. 2008; Vargas-Asencio et al. 2017; Candresse et al. 2017; Porceddu et al. 2018). In July 2019 a grapevine sample from cv. Tempranillo (TS1), collected in a random survey from a vineyard in a Spanish grapevine growing area (D.O. Utiel-Requena), showing chlorotic mottling and leaf deformations, was analyzed by high throughput sequencing (HTS). Total RNA extracted from leaves was sequenced after ribo-depletion (Ribo-Zero Plant kit, Illumina) using TrueSeq Illumina technology (150 nt pair-end reads). Data analysis was performed by CLC Genomics Workbench 10.1.1. After quality control and host genome subtraction 2,410,654 reads were used for de novo assembly. BLAST analysis of the 13,303 contigs obtained revealed the presence of four contigs (2736, 1448, 1285 and 954 nt in size) related to GAMaV, indicating the presence of this virus in TS1 sample. Contigs related to other viruses/viroids were also found, in particular Grapevine rupestris stem pitting-associated virus, Grapevine leafroll-associated virus 3, Grapevine virus A, Grapevine fleck virus, Grapevine red globe virus, Grapevine rupestris vein feathering virus and Hop stunt viroid. For the assembly of the full-length GAMaV genome, contigs were extended by mapping the reads against the contigs using Geneious Prime 2020 software. This mapping step allowed the recovery of the GAMaV genomic sequence (635 reads, average coverage per nucleotide 10.0) with the exception of a small gap of 147 nt in the helicase region of the polyprotein. The gap in the genomic region was covered by RT-PCR using two newly designed primers overlapping the flanking regions (GAMaV-3755-F, 5'ATCCTCACCAACTCCC3' and GAMaV-3985-R, 5'GTTGGAAGTGGTGTG3'). Nearly complete sequence of the isolate TS1 (6,692 nt, MT459830) showed 87.7% nucleotide identity with the isolate 16GVP031 (MK253012) from France. The phylogenetic analysis performed on the available GAMaV full-length genomes showed that the Spanish isolate was positioned in a distinct clade (Supp. Fig. 1). The presence of GAMaV in Spain was further evaluated by reverse transcription-polymerase chain reaction (RT-PCR). Specific GAMaV primers, GAMaV-F3 and GAMaV-R3 previously reported by Candresse et al. (2017) were used without any success, due to primer mismatching. Based on TS1 sequence, two primers (GAMaV-6010F, 5'CCCTCCTCCTAGCGACGACC3' and GAMaV-6426R, 5'GGGTTGAGACGGCGGAGATC3') were designed and used to amplify a fragment of 417 nt in the CP region. Sanger sequencing of the obtained RT-PCR product confirmed the HTS recovered sequence. A total of 52 randomly collected samples from the same grapevine growing area were analyzed by RT-PCR using the newly designed primers. One sample bearing similar symptoms, TS7 (MT770919, cv. Tempranillo), and eight symptomless samples, MS1, MS2 and MS3 (MT770911, MT770917 and MT770918, cv. Macabeo), and TS2, TS3, TS4, TS5 and TS6 (MT770912, MT770913, MT770914, MT770915 and MT770916, cv. Tempranillo), tested positive for GAMaV, thus confirming its presence in Spanish vineyards. The nucleotide identity between these partial sequences and the homologous region of TS1 ranged from 94.7% to 98.8%, 0.04 being the mean diversity among isolates at the CP genomic region estimated by MEGA X software. To our knowledge, this is the first report of GAMaV in grapevine in Spain. The presence of other viruses/viroids in TS1 sample and the finding of asymptomatic GAMaV infected plants make difficult to associate this virus to the observed symptomatology. Other latent or semilatent GAMaV infections have been previously reported (Martelli 2014; Candresse et al. 2017).

Identification of a novel mitovirus in grapevine through high-throughput sequencing

Molecular Characterization and Genomic Function of Grapevine Geminivirus A

The complete genome sequence of a novel maize-associated totivirus

Identification and Characterization of a Maize-Associated Mastrevirus in China by Deep Sequencing Small RNA Populations

Characterization of a Novel Mitovirus Infecting Melanconiella theae Isolated From Tea Plants

Molecular Characterization and Pathogenicity of a Novel Monopartite Geminivirus Infecting Tobacco in China

The Identification of Viral Pathogens in a Physostegia Virginiana Plant Using High-Throughput RNA Sequencing

Complete genome sequence of a novel mitovirus identified in the phytopathogenic fungus Alternaria tenuissima

Complete genome sequence of grapevine yellow speckle viroid 3, a novel apscaviroid infecting grapevine, characterized by high-throughput sequencing

First reports of several viruses and a viroid including a novel vitivirus in Japan, found through virome analysis of bulk grape genetic resources

Molecular Characterization of an Isolate of Bean Common Mosaic Virus First Identified in Gardenia Using Metatranscriptome and Small RNA Sequencing

Grapevine Virology in the Third-Generation Sequencing Era: From Virus Detection to Viral Epitranscriptomics

Grapevine Virome of the Don Ampelographic Collection in Russia Has Concealed Five Novel Viruses

Multiple Infections with Viruses of the Family Tymoviridae in Czech Grapevines

Full-length genome characterization of a novel mitovirus isolated from the root rot fungus Armillaria mellea

Identification and molecular characterization of a novel monopartite geminivirus associated with mulberry mosaic dwarf disease.

Complete genome sequence of a novel mitovirus isolated from the fungus Fusarium oxysporum f. sp. ginseng causing ginseng root rot

First report of grapevine asteroid mosaic-associated virus in grapevines in China

First report of Grapevine asteroid mosaic associated virus in grapevine in Spain

Identification and Characterization of a Novel Emaravirus From Grapevine Showing Chlorotic Mottling Symptoms

Detection and molecular characterization of a novel mitovirus associated with Passiflora edulis Sims