Abstract:HomePlant DiseaseVol. 103, No. 10First Report of Citrus Vein Enation Virus from Citrus Cultivar Huangguogan in Sichuan Province, China PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Citrus Vein Enation Virus from Citrus Cultivar Huangguogan in Sichuan Province, ChinaJiaxing Wu, Qiyan Liu, Yuanjian Qiu, Song Zhang, Zhongan Li, Ruhui Li, Changyong Zhou, and Mengji CaoJiaxing WuNational Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University, Beibei, Chongqing 400712, ChinaSearch for more papers by this author, Qiyan LiuNational Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University, Beibei, Chongqing 400712, ChinaSearch for more papers by this author, Yuanjian QiuNational Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University, Beibei, Chongqing 400712, ChinaSearch for more papers by this author, Song ZhangNational Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University, Beibei, Chongqing 400712, ChinaSearch for more papers by this author, Zhongan LiNational Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University, Beibei, Chongqing 400712, ChinaSearch for more papers by this author, Ruhui Lihttp://orcid.org/0000-0002-9271-4208USDA-ARS, National Germplasm Resources Laboratory, Beltsville, MD 20705, U.S.A.Search for more papers by this author, Changyong ZhouNational Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University, Beibei, Chongqing 400712, ChinaSearch for more papers by this author, and Mengji Cao†Corresponding author: M. Cao; E-mail Address: caomengji@cric.cnhttp://orcid.org/0000-0003-0396-262XNational Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University, Beibei, Chongqing 400712, ChinaSearch for more papers by this authorAffiliationsAuthors and Affiliations Jiaxing Wu1 Qiyan Liu1 Yuanjian Qiu1 Song Zhang1 Zhongan Li1 Ruhui Li2 Changyong Zhou1 Mengji Cao1 † 1National Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University, Beibei, Chongqing 400712, China 2USDA-ARS, National Germplasm Resources Laboratory, Beltsville, MD 20705, U.S.A. Published Online:7 Aug 2019https://doi.org/10.1094/PDIS-03-19-0461-PDNAboutSectionsSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Citrus fruit production in Sichuan, the third citrus producing province in China, increased dramatically, from 4 million acres in 2014 to 6 million acres in 2017. However, the yield and quality of citrus fruits are greatly affected by various diseases, including viral diseases. Citrus vein enation virus (CVEV), a member of the genus Enamovirus in the family Luteoviridae, is the causal agent of citrus vein enation disease (Vives et al. 2013). In 2016, symptoms of tree decline, fruit dysplasia, and superficial necrotic spots were observed on Huangguogan (Citrus sinensis × C. reticulata) trees in Shimian county, Sichuan province, China. To identify viral and virus-like pathogens in the symptomatic trees, total RNA was extracted from the leaf tissues of one symptomatic tree and subjected to ribosomal RNA depletion. A cDNA library was constructed using a TruSeq RNA Sample Prep kit (Illumina, San Diego, CA), and sequencing was conducted with an Illumina HiSeq X-ten platform (Mega Genomics, Beijing, China). A total of 15,216,605 clean nonhost reads were assembled de novo by CLC Genomics Workbench 9.5 (Qiagen). BLAST searches of the resulting contigs revealed the presence of only one virus contig of 5,958 nt nearly identical (99.13%) to CVEV isolates from Zhejiang province, China (Huang et al. 2015). To obtain the whole genome sequence of the CVEV isolate, sequences of six known CVEV isolates (CVEV-PCJ: LC_433634; CVEV-STM-1: LC_089853; CVEV-YM1: LC_089850; CVEV-VE-1: HF_679486; CVEV-IBK: LC_089852, and CVEV-PTC: LC_433635) and the CVEV contig obtained in this study were aligned, and primers pairs were designed to generate overlapping amplicons. Reverse transcription PCR (RT-PCR) and 5′/3′ rapid amplification of cDNA ends (RACE) assays were conducted using OneStep RT-PCR (Takara Bio) and RACE (ThermoFisher Scientific Corp.) kits, respectively. The complete genomic sequence of the Huangguogan-SM isolate of CVEV, designated as CVEV-SM (accession no. KY303624), was determined to be 5,983 nt, which shared the highest nucleotide sequence identity of 97.4% with that of a Korean isolate CVEV-PCJ. Buds collected from the diseased trees were graft inoculated onto Mexican lime (C. aurantifolia) seedlings, and the grafted plants were maintained in a screenhouse. Six months after inoculation, small papillae were observed on leaf veins of the lower surface on the five Mexican lime trees, and the CVEV infection was confirmed by RT-PCR using virus-specific primers (JC-F1: GGAATGCCTTGCTACCAT; JC-R1: GAGAGGTGAATAACGCACAG). To investigate the incidence of CVEV in the orchards, samples were collected from 65 Huangguogan trees with or without symptoms from four orchards in Shimian county and tested by RT-PCR. Results showed that 52 of 55 symptomatic samples and six of the 10 asymptomatic samples were virus infected, suggesting that CVEV is widespread in the region. To our knowledge, this is the first report of CVEV in Sichuan province, China, which expands our knowledge on its distribution and genetic variation. Moreover, CVEV can be transmitted by propagation and by several species of aphids, and thus the virus can be a serious threat to the cultivation of citrus in Sichuan province.The author(s) declare no conflict of interest.References:Huang, A. J., et al. 2015. J. Integr. Agric. 14:598. https://doi.org/10.1016/S2095-3119(14)60903-5 Crossref, ISI, Google ScholarVives, M. C., et al. 2013. Phytopathology 103:1077. https://doi.org/10.1094/PHYTO-03-13-0068-R Link, ISI, Google ScholarThe author(s) declare no conflict of interest.Funding: This research was supported by the Intergovernmental International Science, Technology and Innovation (STI) Collaboration Key Project of China’s National Key R&D Programme (NKP) (2017YFE0110900), Fundamental Research Funds for the Central Universities (XDJK2018AA002), Chongqing Research Program of Basic Research and Frontier Technology (cstc2017jcyjBX0016), and Overseas Expertise Introduction Project for Discipline Innovation (111 Center) (B18044).DetailsFiguresLiterature CitedRelated Vol. 103, No. 10 October 2019SubscribeISSN:0191-2917e-ISSN:1943-7692 DownloadCaptionBell pepper cv. Bomby infected with zucchini yellow mosaic virus along with cucumber mosaic virus, pepper mild mottle virus, and tobacco mosaic virus (Verma et al.). Photo credit: S. Tripathi. Severe stunting, leaf chlorosis, and horizontal head growth of sunflower infected with Plasmopara halstedii, causal agent of downy mildew (Humann et al.). Photo credit: S. Markell. Metrics Article History Issue Date: 3 Oct 2019Published: 7 Aug 2019First Look: 14 Jun 2019Accepted: 12 Jun 2019 Pages: 2701-2701 Information© 2019 The American Phytopathological SocietyFundingIntergovernmental International Science, Technology and Innovation (STI) Collaboration Key Project of China’s National Key R&D Programme (NKP)Grant/Award Number: 2017YFE0110900Fundamental Research Funds for the Central UniversitiesGrant/Award Number: XDJK2018AA002Chongqing Research Program of Basic Research and Frontier TechnologyGrant/Award Number: cstc2017jcyjBX0016Overseas Expertise Introduction Project for Discipline Innovation (111 Center)Grant/Award Number: B18044Keywordsviruses and viroidstree fruitspathogen detectionThe author(s) declare no conflict of interest.Cited byMolecular Variation and Genomic Function of Citrus Vein Enation Virus27 December 2022 | International Journal of Molecular Sciences, Vol. 24, No. 1

Abstract:HomePlant DiseaseVol. 100, No. 2First Molecular Evidence of Citrus yellow vein clearing virus from Citrus in Punjab, Pakistan PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Molecular Evidence of Citrus yellow vein clearing virus from Citrus in Punjab, PakistanM. J. Cao, Q. Wu, S. Atta, H. N. Su, Y. Q. Yu, H. M. Chen, and C. Y. ZhouM. J. Cao, Q. Wu, S. Atta, H. N. Su, Y. Q. Yu, H. M. Chen, and C. Y. ZhouAffiliationsAuthors and Affiliations M. J. Cao , National Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University/Chinese Academy of Agricultural Sciences, Beibei, Chongqing 400712, China Q. Wu , College of Plant Protection, Southwest University, Beibei, Chongqing 400715, China S. Atta , Faculty of Agricultural Sciences, Ghazi University Dera Ghazi Khan, Dera Ghazi Khan, Punjab 32200, Pakistan H. N. Su , National Navel Orange Engineering and Technology Research Center, Gannan Normal University, Ganzhou, China Y. Q. Yu , College of Plant Protection, Southwest University, Beibei, Chongqing 400715, China H. M. Chen C. Y. Zhou , National Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University/Chinese Academy of Agricultural Sciences, Beibei, Chongqing 400712, China. Published Online:7 Jan 2016https://doi.org/10.1094/PDIS-05-15-0609-PDNAboutSectionsSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Yellow vein clearing disease was first observed on lemon and sour orange trees in Pakistan in 1988 (Catara et al. 1993). It was an important vector-transmitted disease (Önelge et al. 2011) that was then found in India, Turkey, and China. Recently, a putative new member of the genus Mandarivirus, Citrus yellow vein clearing virus (CYVCV), was identified as the putative causal agent of this disease (Loconsole et al. 2012) in Turkey and then in China. However, so far, no data on a virus associated with this disease were available from Pakistan, even though the disease was originally described there. In 2009, a survey was performed to evaluate the occurrence and distribution of citrus viruses and virus-like diseases in Punjab, Pakistan. Field symptoms of distinct yellow vein clearing and leaf distortion were observed on two lemon trees in Faisalabad District. Infected budwood from one symptomatic Eureka lemon (Citrus limon) tree was grafted onto lemons budded on rough lemon rootstock as indicator plants kept in the greenhouse of Citrus Research Institute in China. Six months later, typical yellow vein clearing disease symptoms were visible on lemon seedlings. Total RNA was extracted from symptomatic lemon seedlings using Trizol. One pair of primers, CYV-627F (5′-CAAACAACCAAGCCGCTA-3′) and CYV-1254R (5′-GCCGAACTCTTTCTTTCCG-3′), was used to amplify a ∼600-bp CYVCV specific product by one-step RT-PCR (Invitrogen). The presence of CYVCV was confirmed through sequencing of the 600-bp fragment. Based on the sequences of CYVCV-Turkey, eight primer pairs were designed to amplify overlapping cDNA fragments spanning the CYVCV RNA genome. The 5′ and 3′ termini were determined using the 5′/3′ RACE kit. Each cDNA fragment was cloned with pGEM-T Easy kit and a minimum of five recombinant clones were sequenced. The sequence of the whole genome of CYVCV-Pakistan isolate (KP313241) obtained was 7,529 bp and had 97% identity to the reference sequence from Turkey. CYVCV-Pakistan had the same six open reading frames as CYVCV reported from Turkey. To confirm the virus is still in the field, samples from these two symptomatic trees in Faisalabad District and eight other symptomatic lemon trees with YVC in Sahiwal District were collected in March 2015. RT-PCR tests with primers CYV-627F and CYV-1254R confirmed CYVCV presence in all these samples. To our knowledge, this is the first molecular evidence of CYVCV occurrence in Pakistan, which confirms the strict association of CYVCV infections with lemon trees exhibiting yellow vein clearing disease, as previously reported from Turkey and China. Our finding emphasizes the need for CYVCV indexing in production and distribution of pathogen-free citrus plants in Pakistan.References:Catara, A., et al. Proc. 12th Conf. IOCV, 364, 1993. Google ScholarLoconsole, G., et al. 2012. Phytopathology 102:1168. https://doi.org/10.1094/PHYTO-06-12-0140-R Link, ISI, Google ScholarÖnelge, N., et al. Proc. 18th Conf. IOCV, 2011. Google ScholarDetailsFiguresLiterature CitedRelated Vol. 100, No. 2 February 2016SubscribeISSN:0191-2917e-ISSN:1943-7692 Metrics Article History Issue Date: 15 Feb 2016Published: 7 Jan 2016First Look: 30 Sep 2015Accepted: 18 Sep 2015 Pages: 540-540 Information© 2016 The American Phytopathological SocietyCited byAgroinoculation of a full-length cDNA clone of citrus yellow vein clearing virus results in systemic infection in Nicotiana benthamiana and induces disturbances of subcellular structure2 February 2023 | European Journal of Plant Pathology, Vol. 56Citrus yellow vein clearing virusCABI Compendium, Vol. CABI CompendiumExotic and Emergent Citrus Viruses Relevant to the Mediterranean Region31 August 2021 | Agriculture, Vol. 11, No. 9Complete genome sequence of a novel citrus virus with characteristics of members of the family Tymoviridae5 May 2021 | Archives of Virology, Vol. 166, No. 7Is There a "Biological Desert" With the Discovery of New Plant Viruses? A Retrospective Analysis for New Fruit Tree Viruses19 November 2020 | Frontiers in Microbiology, Vol. 11Recent Advances on Citrus yellow vein clearing virus in CitrusHorticultural Plant Journal, Vol. 6, No. 4Discovery and Survey of a New Mandarivirus Associated with Leaf Yellow Mottle Disease of Citrus in PakistanJiaxing Wu, Song Zhang, Sagheer Atta, Caixia Yang, Yan Zhou, Francesco Di Serio, Changyong Zhou, and Mengji Cao1 May 2020 | Plant Disease, Vol. 104, No. 6Genomic, Morphological and Biological Traits of the Viruses Infecting Major Fruit Trees4 June 2019 | Viruses, Vol. 11, No. 6The Coat Protein of Citrus Yellow Vein Clearing Virus Interacts with Viral Movement Proteins and Serves as an RNA Silencing Suppressor5 April 2019 | Viruses, Vol. 11, No. 4Citrus spp. (Citrus aurantifolia; C. aurantium; C. clementina; C. decumana; C. grandis; C. jambhiri; C. limon; C. medica; C. paradisi; C. reticulata; C. sinensis; C. unshia; C. volkameriana)6 June 2020Development of Infectious cDNA Clones of Citrus Yellow Vein Clearing Virus Using a Novel and Rapid StrategyTiantian Cui, Yu Bin, Jianhong Yan, Pengying Mei, Zhongan Li, Changyong Zhou, and Zhen Song20 August 2018 | Phytopathology®, Vol. 108, No. 10Small RNA deep sequencing reveals full-length genome of Citrus yellow vein clearing virus in Chongqing, ChinaJournal of Integrative Agriculture, Vol. 16, No. 2Occurrence, Distribution, and Molecular Characterization of Citrus yellow vein clearing virus in ChinaY. Zhou, H. M. Chen, M. J. Cao, X. F. Wang, X. Jin, K. H. Liu, and C. Y. Zhou18 October 2016 | Plant Disease, Vol. 101, No. 1

Citrus yellow vein clearing virus infection triggers phloem remobilization of iron- and zinc-nicotianamine in citrus

The Titer of Citrus Yellow Vein Clearing Virus Is Positively Associated with the Severity of Symptoms in Infected Citrus Seedlings

Recent Advances on Citrus Yellow Vein Clearing Virus in Citrus

Transcriptomic Analysis Reveals the Defense Mechanisms of Citrus Infested with Diaphorina Citri

Agroinoculation of a Full-Length Cdna Clone of Citrus Yellow Vein Clearing Virus Results in Systemic Infection in Nicotiana Benthamiana and Induces Disturbances of Subcellular Structure

Identification of Dialeurodes Citri As a Vector of Citrus Yellow Vein Clearing Virus in China

Progress in study of new Citrus viruses and viroids diseases in China

Monoclonal Antibody-Based Serological Detection of Citrus Yellow Vein Clearing Virus in Citrus Groves

Citrus tristeza virus-host interactions

Transmissibility of Citrus Yellow Vein Clearing Virus by Contaminated Tools

Pathogen infection drives patterns of nutrient resorption in citrus plants

A Plant Virus Causes Symptoms Through the Deployment of a Host-Mimicking Protein Domain to Attract the Insect Vector

Co-Infection of Sweet Orange with Severe and Mild Strains of Citrus Tristeza Virus is Overwhelmingly Dominated by the Severe Strain on Both the Transcriptional and Biological Levels

Lack of Evidence for Seed Transmission of Citrus Yellow Vein Clearing Virus Despite Its Frequent Detection in Seed Tissues

Lemon zinc finger protein ClSUP induces the accumulation of reactive oxygen species and inhibits citrus yellow vein-clearing virus infection via interactions with ClDOF3.4

First Report of Citrus Vein Enation Virus from Citrus Cultivar Huangguogan in Sichuan Province, China

The Coat Protein of Citrus Yellow Vein Clearing Virus Directly Targets the Ascorbate Peroxidase 1 in Lemon (clapx1) to Facilitate Virus Accumulation

Development of infectious cDNA clones of citrus yellow vein clearing virus using a novel and rapid strategy.

First Molecular Evidence of Citrus Yellow Vein Clearing Virus from Citrus in Punjab, Pakistan.

Transcriptome analysis of Citrus limon infected with Citrus yellow vein clearing virus

The interaction between the lemon ribosomal protein ClRPS9‐2 and citrus yellow vein clearing virus coat protein affects viral infection and gene silencing suppressor activity