Drought stress-inducible synthetic promoters designed for poplar are functional in rice

Yongil Yang,Paolo Tagaloguin,Timothy A. Chaffin,Yuanhua Shao,Mitra Mazarei,Reginald J. Millwood,C. Neal Stewart

DOI: https://doi.org/10.1007/s00299-024-03141-x

IF: 6.2

2024-02-13

Plant Cell Reports

Abstract:Water deficit-inducible synthetic promoters, SD9-2 and SD18-1, designed for use in the dicot poplar, are functional in the monocot crop, rice.

plant sciences

What problem does this paper attempt to address?

Parallel Reaction Monitoring Revealed Tolerance to Drought Proteins in Weedy Rice (oryza Sativa F. Spontanea)

Bing Han,Xiaoding Ma,Di Cui,Leiyue Geng,Guilan Cao,Hui Zhang,Longzhi Han

DOI: https://doi.org/10.1038/s41598-020-69739-9

IF: 4.6

2020-01-01

Scientific Reports

Abstract:Drought is a complicated abiotic stress factor with severe effects on rice growth and production. Weedy rice is a valuable genetic resource that possesses a strong capacity for drought tolerance, cold tolerance, and salt tolerance, and is an excellent material for studying rice tolerance. Here, according to comprehensive tolerance to drought index D, accession WR16 was selected based on strong drought tolerance among 133 studied weedy red rice germplasms. WR16 was compared with Oryza sativa ssp. Japonica. cv. IAPAR-9, a reference genotype originating from Brazil. In addition, accession WR24 was classified as moderately tolerant to drought accessions. Transcriptomic and proteomic analyses were combined to identify 38 co-upregulated proteins related to drought tolerance, and targeted parallel reaction monitoring (PRM) was used to precisely quantify and verify nine proteins in the complex backgrounds. Result showed that six proteins were significantly (Fisher's exact P value<0.05) related to drought tolerance in accessions WR16 and WR24. Among them, OS09T0478300-01, OS09T0530300-01, and OS01T0800500-01 formed a combined defense system to respond to drought stress in weedy rice. Results of these studies provide comprehensive information for precisely identifying and verifying tolerance to drought proteins and lay a solid theoretical foundation for research on drought tolerance mechanisms.
Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Yongil Yang,Timothy A. Chaffin,Yuanhua Shao,Vimal K. Balasubramanian,Meng Markillie,Hugh Mitchell,Maria M. Rubio‐Wilhelmi,Amir H. Ahkami,Eduardo Blumwald,C. Neal Stewart

DOI: https://doi.org/10.1111/pbi.14289

IF: 13.8

2024-01-19

Plant Biotechnology Journal

Abstract:Summary Synthetic promoters may be designed using short cis‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar (Populus tremula × Populus alba), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA) and Syn3‐10b‐2 (3′: GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

biotechnology & applied microbiology,plant sciences
Genome-Wide Identification and Functional Prediction of Novel and Drought-Responsive Lincrnas in Populus Trichocarpa

Peng Shuai,Dan Liang,Sha Tang,Zhoujia Zhang,Chu-Yu Ye,Yanyan Su,Xinli Xia,Weilun Yin

DOI: https://doi.org/10.1093/jxb/eru256

IF: 6.9

2014-01-01

Journal of Experimental Botany

Abstract:Protein-coding genes are considered to be a dominant component of the eukaryotic transcriptome; however, many studies have shown that intergenic, non-coding transcripts also play an important role. Long intergenic non-coding RNAs (lincRNAs) were found to play a vital role in human and Arabidopsis. However, lincRNAs and their regulatory roles remain poorly characterized in woody plants, especially Populus trichocarpa (P. trichocarpa). A large set of Populus RNA-Seq data were examined with high sequencing depth under control and drought conditions and a total of 2542 lincRNA candidates were identified. In total, 51 lincRNAs and 20 lincRNAs were identified as putative targets and target mimics of known Populus miRNAs, respectively. A total of 504 lincRNAs were found to be drought responsive, eight of which were confirmed by RT-qPCR. These findings provide a comprehensive view of Populus lincRNAs, which will enable in-depth functional analysis.
Analysis of the Drought Stress-Responsive Transcriptome of Black Cottonwood ( Populus Trichocarpa ) Using Deep RNA Sequencing

Sha Tang,Yan Dong,Dan Liang,Zhoujia Zhang,Chu-Yu Ye,Peng Shuai,Xiao Han,Ying Zhao,Weilun Yin,Xinli Xia

DOI: https://doi.org/10.1007/s11105-014-0759-4

2014-01-01

Plant Molecular Biology Reporter

Abstract:The complete genome of Populus trichocarpa has been available for years, however, relatively little effort has been made to map and quantify the transcriptome for this important model organism. Here, we applied Illumina sequencing to systematically investigate the leaf transcriptomes derived from P. trichocarpa seedlings grown in normal condition and drought stress. On the basis of the available Populus genome, we defined gene structures and identified a number of novel transcripts and upstream open reading frames, which may be informative for understanding drought adaption of woody plants. We obtained 33,044 genes expressed in leaves covering ~80 % of the available P. trichocarpa gene models and 5689 genes were differentially expressed during drought stress. About 38.9 % of the expressed genes show alternative splicing (AS) patterns. Interestingly, the number of AS events and the expression of some AS genes increased when the plants were subjected to drought. At the physiological level, photosynthetic rates, stomatal conductance, and leaf water potential were significantly reduced after water stress. This was accompanied by strong transcriptional remodeling of energy metabolism, cell growth, carbohydrate metabolism, and cellular homeostasis in P. trichocarpa. In addition, genes involved in photosynthesis, cell wall organization, and osmoprotectants metabolism that may specially modulate the drought stress responses of P. trichocarpa are highlighted. Our analysis provides insight into the transcriptional responses of P. trichocarpa to drought stress and is expected to serve as valuable transcriptome resources for woody plants.
Integrated Omic Analysis Provides Insights into the Molecular Regulation of Stress Tolerance by Partial Root-Zone Drying in Rice

Minhua Zhao,Canghao Du,Jian Zeng,Zhihong Gao,Yongyong Zhu,Jinfei Wang,Yupeng Zhang,Zetao Zhu,Yaqiong Wang,Mingjie Chen,Yuesheng Wang,Junli Chang,Guangxiao Yang,Guangyuan He,Yin Li,Xiaoyuan Chen

DOI: https://doi.org/10.3389/fpls.2023.1156514

IF: 5.6

2023-01-01

Frontiers in Plant Science

Abstract:Partial root-zone drying (PRD) is an effective water-saving irrigation strategy that improves stress tolerance and facilitates efficient water use in several crops. It has long been considered that abscisic acid (ABA)-dependent drought resistance may be involved during partial root-zone drying. However, the molecular mechanisms underlying PRD-mediated stress tolerance remain unclear. It's hypothesized that other mechanisms might contribute to PRD-mediated drought tolerance. Here, rice seedlings were used as a research model and the complex transcriptomic and metabolic reprogramming processes were revealed during PRD, with several key genes involved in osmotic stress tolerance identified by using a combination of physiological, transcriptome, and metabolome analyses. Our results demonstrated that PRD induces transcriptomic alteration mainly in the roots but not in the leaves and adjusts several amino-acid and phytohormone metabolic pathways to maintain the balance between growth and stress response compared to the polyethylene glycol (PEG)-treated roots. Integrated analysis of the transcriptome and metabolome associated the co-expression modules with PRD-induced metabolic reprogramming. Several genes encoding the key transcription factors (TFs) were identified in these co-expression modules, highlighting several key TFs, including TCP19, WRI1a, ABF1, ABF2, DERF1, and TZF7, involved in nitrogen metabolism, lipid metabolism, ABA signaling, ethylene signaling, and stress regulation. Thus, our work presents the first evidence that molecular mechanisms other than ABA-mediated drought resistance are involved in PRD-mediated stress tolerance. Overall, our results provide new insights into PRD-mediated osmotic stress tolerance, clarify the molecular regulation induced by PRD, and identify genes useful for further improving water-use efficiency and/or stress tolerance in rice.
Modulation of transcription factor and metabolic pathway genes in response to water-deficit stress in rice

Swatismita Ray,Prasant K. Dansana,Jitender Giri,Priyanka Deveshwar,Rita Arora,Pinky Agarwal,Jitendra P. Khurana,Sanjay Kapoor,Akhilesh K. Tyagi

DOI: https://doi.org/10.1007/s10142-010-0187-y

2010-09-07

Abstract:Water-deficit stress is detrimental for rice growth, development, and yield. Transcriptome analysis of 1-week-old rice (Oryza sativa L. var. IR64) seedling under water-deficit stress condition using Affymetrix 57 K GeneChip® has revealed 1,563 and 1,746 genes to be up- and downregulated, respectively. In an effort to amalgamate data across laboratories, we identified 5,611 differentially expressing genes under varying extrinsic water-deficit stress conditions in six vegetative and one reproductive stage of development in rice. Transcription factors (TFs) involved in ABA-dependent and ABA-independent pathways have been found to be upregulated during water-deficit stress. Members of zinc-finger TFs namely, C2H2, C2C2, C3H, LIM, PHD, WRKY, ZF-HD, and ZIM, along with TF families like GeBP, jumonji, MBF1 and ULT express differentially under water-deficit conditions. NAC (NAM, ATAF and CUC) TF family emerges to be a potential key regulator of multiple abiotic stresses. Among the 12 TF genes that are co-upregulated under water-deficit, salt and cold stress conditions, five belong to the NAC TF family. We identified water-deficit stress-responsive genes encoding key enzymes involved in biosynthesis of osmoprotectants like polyols and sugars; amino acid and quaternary ammonium compounds; cell wall loosening and structural components; cholesterol and very long chain fatty acid; cytokinin and secondary metabolites. Comparison of genes responsive to water-deficit stress conditions with genes preferentially expressed during panicle and seed development revealed a significant overlap of transcriptome alteration and pathways.

genetics & heredity
OsPhyB-Mediating Novel Regulatory Pathway for Drought Tolerance in Rice Root Identified by a Global RNA-Seq Transcriptome Analysis of Rice Genes in Response to Water Deficiencies

Yo-Han Yoo,Anil K. Nalini Chandran,Jong-Chan Park,Yun-Shil Gho,Sang-Won Lee,Gynheung An,Ki-Hong Jung

DOI: https://doi.org/10.3389/fpls.2017.00580

IF: 5.6

2017-04-26

Frontiers in Plant Science

Abstract:Water deficiencies are one of the most serious challenges to crop productivity. To improve our understanding of soil moisture stress, we performed RNA-Seq analysis using roots from 4-week-old rice seedlings grown in soil that had been subjected to drought conditions for 2-3 d. In all, 1,098 genes were up-regulated in response to soil moisture stress for 3 d, which causes severe damage in root development after recovery, unlikely that of 2 d. Comparison with previous transcriptome data produced in drought condition indicated that more than 68% of our candidate genes were not previously identified, emphasizing the novelty of our transcriptome analysis for drought response in soil condition. We then validated the expression patterns of two candidate genes using a promoter-GUS reporter system in planta and monitored the stress response with novel molecular markers. An integrating omics tool, MapMan analysis, indicated that RING box E3 ligases in the ubiquitin-proteasome pathways are significantly stimulated by induced drought. We also analyzed the functions of 66 candidate genes that have been functionally investigated previously, suggesting the primary roles of our candidate genes in resistance or tolerance relating traits including drought tolerance (29 genes) through literature searches besides diverse regulatory roles of our candidate genes for morphological traits (15 genes) or physiological traits (22 genes). Of these, we used a T-DNA insertional mutant of rice phytochrome B (OsPhyB) that negatively regulates a plant's degree of tolerance to water deficiencies through the control of total leaf area and stomatal density based on previous finding. Unlike previous result, we found that OsPhyB represses the activity of ascorbate peroxidase and catalase mediating reactive oxygen species (ROS) processing machinery required for drought tolerance of roots in soil condition, suggesting the potential significance of remaining uncharacterized candidate genes for manipulating drought tolerance in rice.

plant sciences
Genome-wide temporal-spatial gene expression profiling of drought responsiveness in rice

Di Wang,Yajiao Pan,Xiuqin Zhao,Linghua Zhu,Binying Fu,Zhikang Li

DOI: https://doi.org/10.1186/1471-2164-12-149

IF: 4.547

2011-03-16

BMC Genomics

Abstract:Abstract Background Rice is highly sensitive to drought, and the effect of drought may vary with the different genotypes and development stages. Genome-wide gene expression profiling was used as the initial point to dissect molecular genetic mechanism of this complex trait and provide valuable information for the improvement of drought tolerance in rice. Affymetrix rice genome array containing 48,564 japonica and 1,260 indica sequences was used to analyze the gene expression pattern of rice exposed to drought stress. The transcriptome from leaf, root, and young panicle at three developmental stages was comparatively analyzed combined with bioinformatics exploring drought stress related cis -elements. Results There were 5,284 genes detected to be differentially expressed under drought stress. Most of these genes were tissue- or stage-specific regulated by drought. The tissue-specific down-regulated genes showed distinct function categories as photosynthesis-related genes prevalent in leaf, and the genes involved in cell membrane biogenesis and cell wall modification over-presented in root and young panicle. In a drought environment, several genes, such as GA2ox, SAP15 , and Chitinase III , were regulated in a reciprocal way in two tissues at the same development stage. A total of 261 transcription factor genes were detected to be differentially regulated by drought stress. Most of them were also regulated in a tissue- or stage-specific manner. A cis -element containing special CGCG box was identified to over-present in the upstream of 55 common induced genes, and it may be very important for rice plants responding to drought environment. Conclusions Genome-wide gene expression profiling revealed that most of the drought differentially expressed genes (DEGs) were under temporal and spatial regulation, suggesting a crosstalk between various development cues and environmental stimuli. The identification of the differentially regulated DEGs, including TF genes and unique candidate cis -element for drought responsiveness, is a very useful resource for the functional dissection of the molecular mechanism in rice responding to environment stress.

genetics & heredity,biotechnology & applied microbiology
Application of a novel strong promoter from Chinese fir (Cunninghamia lanceolate) in the CRISPR/Cas mediated genome editing of its protoplasts and transgenesis of rice and poplar

Shanwen Ye,Wensha Ding,Weiyuan Bai,Jiaao Lu,Linying Zhou,Xiangqing Ma,Qiang Zhu

DOI: https://doi.org/10.3389/fpls.2023.1179394

IF: 5.6

2023-04-21

Frontiers in Plant Science

Abstract:Novel constitutive promoters are essential for plant biotechnology. Although in angiosperms, a number of promoters were applied in monocots or dicots genetic engineering, only a few promoters were used in gymnosperm. Here we identified two strong promoters ( Cula11 and Cula08 ) from Chinese fir ( C. lanceolate ) by screening the transcriptomic data and preliminary promoter activity assays in tobacco. By using the newly established Chinese fir protoplast transient expression technology that enables in vivo molecular biology studies in its homologous system, we compared the activities of Cula11 and Cula08 with that of the commonly used promoters in genetic engineering of monocots or dicots, such as CaM35S , CmYLCV , and ZmUbi , and our results revealed that Cula11 and Cula08 promoters have stronger activities in Chinese fir protoplasts. Furthermore, the vector containing Cas gene driven by Cula11 promoter and sgRNA driven by the newly isolated CulaU6b polyIII promoters were introduced into Chinese fir protoplasts, and CRISPR/Cas mediated gene knock-out event was successfully achieved. More importantly, compared with the commonly used promoters in the genetic engineering in angiosperms, Cula11 promoter has much stronger activity than CaM35S promoter in transgenic poplar, and ZmUbi promoter in transgenic rice, respectively, indicating its potential application in poplar and rice genetic engineering. Overall, the novel putative constitutive gene promoters reported here will have great potential application in gymnosperm and angiosperm biotechnology, and the transient gene expression system established here will serve as a useful tool for the molecular and genetic analyses of Chinese fir genes.

plant sciences
Tinkering Cis Motifs Jigsaw Puzzle Led to Root-Specific Drought-Inducible Novel Synthetic Promoters

Aysha Jameel,Muhammad Noman,Weican Liu,Naveed Ahmad,Fawei Wang,Xiaowei Li,Haiyan Li

DOI: https://doi.org/10.3390/ijms21041357

IF: 5.6

2020-02-18

International Journal of Molecular Sciences

Abstract:Following an in-depth transcriptomics-based approach, we first screened out and analyzed (in silico) cis motifs in a group of 63 drought-inducible genes (in soybean). Six novel synthetic promoters (SynP14-SynP19) were designed by concatenating 11 cis motifs, ABF, ABRE, ABRE-Like, CBF, E2F-VARIANT, G-box, GCC-Box, MYB1, MYB4, RAV1-A, and RAV1-B (in multiple copies and various combination) with a minimal 35s core promoter and a 222 bp synthetic intron sequence. In order to validate their drought-inducibility and root-specificity, the designed synthetic assemblies were transformed in soybean hairy roots to drive GUS gene using pCAMBIA3301. Through GUS histochemical assay (after a 72 h 6% PEG6000 treatment), we noticed higher glucuronidase activity in transgenic hairy roots harboring SynP15, SynP16, and SynP18. Further screening through GUS fluorometric assay flaunted SynP16 as the most appropriate combination of efficient drought-responsive cis motifs. Afterwards, we stably transformed SynP15, SynP16, and SynP18 in Arabidopsis and carried out GUS staining as well as fluorometric assays of the transgenic plants treated with simulated drought stress. Consistently, SynP16 retained higher transcriptional activity in Arabidopsis roots in response to drought. Thus the root-specific drought-inducible synthetic promoters designed using stimulus-specific cis motifs in a definite fashion could be exploited in developing drought tolerance in soybean and other crops as well. Moreover, the rationale of design extends our knowledge of trial-and-error based cis engineering to construct synthetic promoters for transcriptional upgradation against other stresses.

biochemistry & molecular biology,chemistry, multidisciplinary
Homologous Drought-Induced 19 Proteins, PtDi19-2 and PtDi19-7, Enhance Drought Tolerance in Transgenic Plants

Caijuan Wu,Miao Lin,Feng Chen,Jun Chen,Shifan Liu,Hanwei Yan,Yan Xiang

DOI: https://doi.org/10.3390/ijms23063371

IF: 5.6

2022-01-01

International Journal of Molecular Sciences

Abstract:Drought-induced 19 (Di19) proteins play important roles in abiotic stress responses. Thus far, there are no reports about Di19 family in woody plants. Here, eight Di19 genes were identified in poplar. We analyzed phylogenetic tree, conserved protein domain, and gene structure of Di19 gene members in seven species. The results showed the Di19 gene family was very conservative in both dicotyledonous and monocotyledonous forms. On the basis of transcriptome data, the expression patterns of Di19s in poplar under abiotic stress and ABA treatment were further studied. Subsequently, homologous genes PtDi19-2 and PtDi19-7 with strong response to drought stress were identified. PtDi19-2 functions as a nuclear transcriptional activator with a transactivation domain at the C-terminus. PtDi19-7 is a nuclear and membrane localization protein. Additionally, PtDi19-2 and PtDi19-7 were able to interact with each other in yeast two-hybrid system. Overexpression of PtDi19-2 and PtDi19-7 in Arabidopsis was found. Phenotype identification and physiological parameter analysis showed that transgenic Arabidopsis increased ABA sensitivity and drought tolerance. PtDi19-7 was overexpressed in hybrid poplar 84K (Populus alba x Populus glandulosa). Under drought treatment, the phenotype and physiological parameters of transgenic poplar were consistent with those of transgenic Arabidopsis. In addition, exogenous ABA treatment induced lateral bud dormancy of transgenic poplar and stomatal closure of transgenic Arabidopsis. The expression of ABA/drought-related marker genes was upregulated under drought treatment. These results indicated that PtDi19-2 and PtDi19-7 might play a similar role in improving the drought tolerance of transgenic plants through ABA-dependent signaling pathways.
Stress-inducible expression of AtDREB1A transcription factor greatly improves drought stress tolerance in transgenic indica rice

G. Ravikumar,P. Manimaran,S. R. Voleti,D. Subrahmanyam,R. M. Sundaram,K. C. Bansal,B. C. Viraktamath,S. M. Balachandran

DOI: https://doi.org/10.1007/s11248-013-9776-6

2014-01-08

Transgenic Research

Abstract:AbstractThe cultivation of rice (Oryza sativa L.), a major food crop, requires ample water (30 % of the fresh water available worldwide), and its productivity is greatly affected by drought, the most significant environmental factor. Much research has focussed on identifying quantitative trait loci, stress-regulated genes and transcription factors that will contribute towards the development of climate-resilient/tolerant crop plants in general and rice in particular. The transcription factor DREB1A, identified from the model plant Arabidopsis thaliana, has been reported to enhance stress tolerance against drought stress. We developed transgenic rice plants with AtDREB1A in the background of indica rice cultivar Samba Mahsuri through Agrobacterium-mediated transformation. The AtDREB1A gene was stably inherited and expressed in T1 and T2 plants and in subsequent generations, as indicated by the results of PCR, Southern blot and RT-PCR analyses. Expression of AtDREB1A was induced by drought stress in transgenic rice lines, which were highly tolerant to severe water deficit stress in both the vegetative and reproductive stages without affecting their morphological or agronomic traits. The physiological studies revealed that the expression of AtDREB1A was associated with an increased accumulation of the osmotic substance proline, maintenance of chlorophyll, increased relative water content and decreased ion leakage under drought stress. Most of the homozygous lines were highly tolerant to drought stress and showed significantly a higher grain yield and spikelet fertility relative to the nontransgenic control plants under both stressed and unstressed conditions. The improvement in drought stress tolerance in combination with agronomic traits is very essential in high premium indica rice cultivars, such as Samba Mahsuri, so that farmers can benefit in times of seasonal droughts and water scarcity.

biochemistry & molecular biology,biochemical research methods,biotechnology & applied microbiology
Overexpression of the DREB1A gene under stress-inducible promoter delays leaf senescence and improves drought tolerance in rice

Farhan Ahmad,Safdar Hussain Shah,Asad Jan

DOI: https://doi.org/10.1007/s42976-023-00359-5

2023-02-18

Cereal Research Communications

Abstract:Rice ( Oryza sativa ) is the major source of food as over half of the world's population relies on rice as their major source of nutrition. Drought stress is the main factor negatively affecting rice growth and productivity worldwide. As DREB transcriptional factors are important for plant growth and abiotic stress responses, they are promising molecular plant breeding candidates. Overexpression of DREB1A gene in plants improves drought tolerance but also causes various growth abnormalities such as retarded growth, delay in flowering and reduced seed setting. In the present work, DREB1A gene under the control of inducible Oshox24 promoter was expressed in rice to study plant growth and abiotic stress tolerance. The inheritance of DREB1A in individual transgenic rice plants was confirmed using PCR analysis. The overexpression of POshox24; DREB1A indicated its positive role in delaying hormone-induced leaf senescence and chlorophyll breakdown induced by Methyl-Jasmonates (MeJA) Abscisic Acid (ABA), and Ethylene (ETH). The upper four leaves of POshox24:DREB1A-OX#2 and POshox24:DREB1A-OX#5 exhibited higher chlorophyll contents compared to control plants. Under drought stress treatment POshox24:DREB1A-OX#2 and POshox24:DREB1A-OX#5 exhibited 67% (27/40) and 63% (25/40) survival rate compared to control plants 35% (13/40). Our results suggest that stress-inducible expression of DREB1A under Oshox24 promoter produces no pleiotropic effects on plant growth and development and confers drought stress tolerance.

agronomy
Comprehensive genome-wide analyses of R2R3-MYB transcription factors and tolerance to drought stress in Populus davidiana × Populus bolleana

Xinxin Li,Minglong Yan,Shengxuan Wen,Zhiping Liu,Yucheng Wang,Huiyan Guo

DOI: https://doi.org/10.1007/s11295-024-01642-0

2024-03-03

Tree Genetics & Genomes

Abstract:The MYB family is one of the largest families of transcription factors, in which the R2R3-MYB subgroup plays a crucial role in various biological processes. R2R3-MYBs in Populus davidiana × Populus bolleana have, however, not been systematically investigated. Here, based on the gene annotation of P. davidiana × P. bolleana genome sequence, all PdbR2R3-MYB transcripts were identified. These PdbR2R3-MYBs were classified into 29 subgroups (C2 to C30) according to the phylogenetic analysis of Arabidopsis thaliana AtR2R3-MYBs. The analysis of gene structures and protein motifs showed the conservation and evolution of PdbR2R3-MYBs. The cis -acting elements in the promoters of PdbR2R3-MYB genes were predicted, and the results indicated an abundance of abscisic acid and defense- and stress-responsive elements. The results of qRT-PCR revealed that nine PdbR2R3-MYB genes were differentially expressed in various tissues and can be regulated by drought stress; thus, these genes may play key roles in the response of plants to drought stress. In addition, the expression of PdbMYB5 and PdbMYB102 was significantly higher than those of the other seven MYB genes; hence, PdbMYB5 and PdbMYB102 overexpressing (OE) and silenced (SE) poplar plants were generated to investigate drought stress tolerance. The PdbMYB5 and PdbMYB102 OE plants showed enhanced reactive oxygen species scavenging capability, less cell damage, and high expression levels of the SOD and POD genes, whereas the SE plants showed the opposite results, thus suggesting that PdbMYB5 and PdbMYB102 conferred enhanced drought tolerance to the plants. This study provided insights into gene characterization, structure, evolution, expression, and function of the PdbR2R3-MYB family in poplar plants.

genetics & heredity,forestry,horticulture
Dissociation of transcription factor MYB94 and histone deacetylases HDA907/908 alleviates oxidative damage in poplar

Xiangge Kong,Yao Chen,Huanhuan Li,Menghan Li,Xuejiao Liu,Linchao Xia,Sheng Zhang

DOI: https://doi.org/10.1093/plphys/kiae325

IF: 7.4

2024-06-10

PLANT PHYSIOLOGY

Abstract:Drought is one of the major threats to forest productivity. Oxidation stress is common in drought-stressed plants, and plants need to maintain normal life activities through complex reactive oxygen scavenging mechanisms. However, the molecular links between epigenetics, oxidation stress, and drought in poplar (Populus) remain poorly understood. Here, we found that Populus plants overexpressing PtrMYB94, which encodes a R2R3 MYB transcription factor that regulates the ABA signaling pathway, displayed increased tolerance to extreme drought stress via up-regulation of embryogenic cell phosphoprotein 44 (PtrECPP44) expression. Further investigation revealed that PtrMYB94 could recruit the histone deacetylases PtrHDA907/908 to the promoter of PtrECPP44 and decrease acetylation at lysine residues 9, 14 and 27 of histone H3, leading to relatively low transcriptional expression levels under normal conditions. Drought induced the expression of PtrMYB94 while preventing interaction of PtrMYB94 with PtrHDA907/908, which relaxed the chromatin structure and facilitated the binding of RNA polymerase II to the PtrECPP44 promoter. The upregulation of PtrECPP44 helped poplar alleviate oxidative damage and maintain normal cell activities. This study establishes a PtrMYB94-PtrECPP44 transcriptional regulatory module modified by PtrHDA907/908 in modulating drought-induced oxidative stress recovery. Therefore, our study reveals a oxidative regulatory mechanism in response to drought stress and provides insights into molecular breeding for stress resistance in poplar.

plant sciences
The Over-Expression of Two R2R3-MYB Genes, PdMYB2R089 and PdMYB2R151, Increases the Drought-Resistant Capacity of Transgenic Arabidopsis

Xueli Zhang,Haoran Wang,Ying Chen,Minren Huang,Sheng Zhu

DOI: https://doi.org/10.3390/ijms241713466

IF: 5.6

2023-08-31

International Journal of Molecular Sciences

Abstract:The R2R3-MYB genes in plants play an essential role in the drought-responsive signaling pathway. Plenty of R2R3-MYB S21 and S22 subgroup genes in Arabidopsis have been implicated in dehydration conditions, yet few have been covered in terms of the role of the S21 and S22 subgroup genes in poplar under drought. PdMYB2R089 and PdMYB2R151 genes, respectively belonging to the S21 and S22 subgroups of NL895 (Populus deltoides × P. euramericana cv. 'Nanlin895′), were selected based on the previous expression analysis of poplar R2R3-MYB genes that are responsive to dehydration. The regulatory functions of two target genes in plant responses to drought stress were studied and speculated through the genetic transformation of Arabidopsis thaliana. PdMYB2R089 and PdMYB2R151 could promote the closure of stomata in leaves, lessen the production of malondialdehyde (MDA), enhance the activity of the peroxidase (POD) enzyme, and shorten the life cycle of transgenic plants, in part owing to their similar conserved domains. Moreover, PdMYB2R089 could strengthen root length and lateral root growth. These results suggest that PdMYB2R089 and PdMYB2R151 genes might have the potential to improve drought adaptability in plants. In addition, PdMYB2R151 could significantly improve the seed germination rate of transgenic Arabidopsis, but PdMYB2R089 could not. This finding provides a clue for the subsequent functional dissection of S21 and S22 subgroup genes in poplar that is responsive to drought.

biochemistry & molecular biology,chemistry, multidisciplinary
Heterologous expression of the TaPI-PLC1-2B gene enhanced drought and salt tolerance in transgenic rice seedlings

Ahui Zhao,Chao Cui,Fang Li,Chenyang Li,Salman Naveed,Jian Dong,Xiang Gao,Sachin Rustgi,Shanshan Wen,Mingming Yang

DOI: https://doi.org/10.1038/s41437-022-00566-6

Abstract:Drought and salt stress are important factors that affect plant growth and development and cause crop yield reductions worldwide. Phospholipase C is a class of enzymes that can hydrolyze phospholipids, and it has been shown to play an important role in plant growth regulation and stress response. We used rice as a model to investigate the function of the wheat TaPI-PLC1-2B gene in salt and drought tolerance. For this purpose, we heterologously expressed the TaPI-PLC1-2B gene in rice and studied the transcriptional differences in transgenic and wide-type rice plants in the presence and absence of drought and salt stress. Our results showed that 2130 and 1759 genes expressed differentially in the TaPI-PLC1-2B overexpression rice line under salt and drought stress, respectively. Gene ontology enrichment results showed that differentially expressed genes (DEGs) were significantly enriched in cellular process, metabolic process, stimulus-response, cell, organelle, catalytic activity, and other functional processes under salt and drought stress. In addition, the Kyoto Encyclopedia of Genes and Genomes pathway analysis showed DEG enrichment in plant-pathogen interaction, phosphoinositol, plant hormones, and other signaling pathways under the two stress treatments. Furthermore, the chromosomal localization of salt and drought stress-responsive DEGs showed a clear distribution pattern on specific rice chromosomes. For instance, the greatest number of drought stress-responsive genes mapped to rice chromosomes 1 and 6. The current analysis has built the basis for future explorations to decipher the TaPI-PLC1-2B-mediated plant stress response mechanism in the relatively challenging wheat system.
ZFP37, C3H, NAC94, and bHLH148 transcription factors regulate cultivar-specific drought response by modulating r40C1 gene expression in rice

Salman Sahid,Chandan Roy,Dibyendu shee,Ranjana Shee,Riddhi Datta,Soumitra Paul

DOI: https://doi.org/10.1016/j.envexpbot.2023.105480

IF: 6.028

2023-08-23

Environmental and Experimental Botany

Abstract:Lectins are gradually gaining importance in regulating abiotic stress response in plants. Among them, the R40 family plays pivotal role in regulating drought response. The expression of the Osr40C1 positively correlates with the degree of drought tolerance in indica rice cultivars. Although the mechanism of Os r40C1-mediated drought tolerance is well characterized, the gene's regulation under drought remains obscure. Here, we demonstrate that the Osr40C1 promoter is activated under drought to induce its transcription. A number of single nucleotide variations in the Osr40C1 promoter of the drought-tolerant IR36 and sensitive MTU1010 cultivar are detected. However, promoter swapping analysis reveals that these variations in the promoter sequence do not explain the cultivar-specific expression pattern of this gene. Next, we identified the transcription factors that interact with the Osr40C1 promoter. Among these transcription factors, Os ZFP37, Os C3H, Os NAC94, and Os bHLH148 display significantly higher transcript abundance in IR36 compared with MTU1010. Furthermore, overexpression of each of these transcription factors confers drought tolerance, whereas their silencing leads to drought sensitivity. Interestingly, the Osr40C1 expression is significantly up-regulated in the transcription factor overexpression lines, while its expression is undetectable in the silencing lines. Together our study highlights how different transcription factors regulate the cultivar-specific expression pattern of Osr40C1 in rice.

plant sciences,environmental sciences
A Drought-Inducible Transcription Factor Delays Reproductive Timing in Rice.

Chunyu Zhang,Jun Liu,Tao Zhao,Adam Gomez,Cong Li,Chunsheng Yu,Hongyu Li,Jianzhong Lin,Yuanzhu Yang,Bin Liu,Chentao Lin

DOI: https://doi.org/10.1104/pp.16.01691

IF: 7.4

2016-01-01

PLANT PHYSIOLOGY

Abstract:The molecular mechanisms underlying photoperiod or temperature control of flowering time have been recently elucidated, but how plants regulate flowering time in response to other external factors, such as water availability, remains poorly understood. Using a large-scale Hybrid Transcription Factor approach, we identified a bZIP transcriptional factor, O. sativa ABA responsive element binding factor 1 (OsABF1), which acts as a suppressor of floral transition in a photoperiod-independent manner. Simultaneous knockdown of both OsABF1 and its closest homologous gene, OsbZIP40, in rice (Oryza sativa) by RNA interference results in a significantly earlier flowering phenotype. Molecular and genetic analyses demonstrate that a drought regime enhances expression of the OsABF1 gene, which indirectly suppresses expression of the Early heading date 1 (Ehd1) gene that encodes a key activator of rice flowering. Furthermore, we identified a drought-inducible gene named OsWRKY104 that is under the direct regulation of OsABF1 Overexpression of OsWRKY104 can suppress Ehd1 expression and confers a later flowering phenotype in rice. Together, these findings reveal a novel pathway by which rice modulates heading date in response to the change of ambient water availability.
Photosynthetic Carbon Fixation and Sucrose Metabolism Supplemented by Weighted Gene Co-expression Network Analysis in Response to Water Stress in Rice With Overlapping Growth Stages

Xinpeng Wang,Hualong Liu,Di Zhang,Detang Zou,Jingguo Wang,Hongliang Zheng,Yan Jia,Zhaojun Qu,Bin Sun,Hongwei Zhao

DOI: https://doi.org/10.3389/fpls.2022.864605

IF: 5.6

2022-04-21

Frontiers in Plant Science

Abstract:Drought stress at jointing and booting phases of plant development directly affects plant growth and productivity in rice. Limited by natural factors, the jointing and booting stages in rice varieties are known to overlap in high-latitude areas that are more sensitive to water deficit. However, the regulation of photosynthetic carbon fixation and sucrose metabolism in rice leaves under different degrees of drought stress remains unclear. In this study, rice plants were subjected to three degrees of drought stress (−10, −25, −and 40 kPa) for 15 days during the jointing-booting stage, we investigated photosynthetic carbon sequestration and sucrose metabolism pathways in rice leaves and analyzed key genes and regulatory networks using transcriptome sequencing in 2016. And we investigated the effects of drought stress on the growth periods of rice with overlapping growth periods in 2016 and 2017. The results showed that short-term drought stress promoted photosynthetic carbon fixation. However, ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisCO) activity significantly decreased, resulting in a significant decrease in photosynthetic rate. Drought stress increased the maximum activity of fructose-1,6-bisphosphate aldolase (FBA). FBA maintains the necessary photosynthetic rate during drought stress and provides a material base after the resumption of irrigation in the form of controlling the content of its reaction product triose phosphate. Drought stress significantly affected the activities of sucrose synthase (SuSase) and sucrose phosphate synthase (SPS). Vacuoles invertase (VIN) activity increased significantly, and the more severe the drought, the higher the VIN activity. Severe drought stress at the jointing-booting stage severely restricted the growth process of rice with overlapping growth stages and significantly delayed heading and anthesis stages. Transcriptome analysis showed that the number of differentially expressed genes was highest at 6–9 days after drought stress. Two invertase and four β-amylase genes with time-specific expression were involved in sucrose-starch metabolism in rice under drought stress. Combined with weighted gene co-expression network analysis, VIN and β-amylase genes up-regulated throughout drought stress were regulated by OsbZIP04 and OsWRKY62 transcription factors under drought stress. This study showed that any water deficit at the jointing-booting stage would have a serious effect on sucrose metabolism in leaves of rice with overlapping growth stages.

plant sciences

Drought stress-inducible synthetic promoters designed for poplar are functional in rice

Parallel Reaction Monitoring Revealed Tolerance to Drought Proteins in Weedy Rice (oryza Sativa F. Spontanea)

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Genome-Wide Identification and Functional Prediction of Novel and Drought-Responsive Lincrnas in Populus Trichocarpa

Analysis of the Drought Stress-Responsive Transcriptome of Black Cottonwood ( Populus Trichocarpa ) Using Deep RNA Sequencing

Integrated Omic Analysis Provides Insights into the Molecular Regulation of Stress Tolerance by Partial Root-Zone Drying in Rice

Modulation of transcription factor and metabolic pathway genes in response to water-deficit stress in rice

OsPhyB-Mediating Novel Regulatory Pathway for Drought Tolerance in Rice Root Identified by a Global RNA-Seq Transcriptome Analysis of Rice Genes in Response to Water Deficiencies

Genome-wide temporal-spatial gene expression profiling of drought responsiveness in rice

Application of a novel strong promoter from Chinese fir (Cunninghamia lanceolate) in the CRISPR/Cas mediated genome editing of its protoplasts and transgenesis of rice and poplar

Tinkering Cis Motifs Jigsaw Puzzle Led to Root-Specific Drought-Inducible Novel Synthetic Promoters

Homologous Drought-Induced 19 Proteins, PtDi19-2 and PtDi19-7, Enhance Drought Tolerance in Transgenic Plants

Stress-inducible expression of AtDREB1A transcription factor greatly improves drought stress tolerance in transgenic indica rice

Overexpression of the DREB1A gene under stress-inducible promoter delays leaf senescence and improves drought tolerance in rice

Comprehensive genome-wide analyses of R2R3-MYB transcription factors and tolerance to drought stress in Populus davidiana × Populus bolleana

Dissociation of transcription factor MYB94 and histone deacetylases HDA907/908 alleviates oxidative damage in poplar

The Over-Expression of Two R2R3-MYB Genes, PdMYB2R089 and PdMYB2R151, Increases the Drought-Resistant Capacity of Transgenic Arabidopsis

Heterologous expression of the TaPI-PLC1-2B gene enhanced drought and salt tolerance in transgenic rice seedlings

ZFP37, C3H, NAC94, and bHLH148 transcription factors regulate cultivar-specific drought response by modulating r40C1 gene expression in rice

A Drought-Inducible Transcription Factor Delays Reproductive Timing in Rice.

Photosynthetic Carbon Fixation and Sucrose Metabolism Supplemented by Weighted Gene Co-expression Network Analysis in Response to Water Stress in Rice With Overlapping Growth Stages