P007 Fumaric reductase analog regulates sensitivity of pyrvinium pamoate and voriconazoole against Exophiala Dermatiti dis
Xiaotong Li,Yutang Zhu,Jie Zhang,Yi Sun,Lujuan Gao
DOI: https://doi.org/10.1093/mmy/myac072.P007
IF: 3.747
2022-09-22
Medical Mycology
Abstract:Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectivesThe black yeast Exophiala dermatitidis is an opportunistic pathogen that causes phaeohyphomycosis in both immunocompetent individuals and immunosuppressed patients, resulting in localized cutaneous and subcutaneous infections to more severe systemic forms such as neurotropic infections. Besides, E. dermatitidis was frequently found as a colonizer of pulmonary of cystic fibrosis patients, which appears to be associated with more advanced disease. Infections of E. dermatitidis are often chronic and recalcitrant. Previously, we have demonstrated that pyrvinium pamoate (PP) exerted antifungal activity alone (MIC 2 μ g/ml) and favorable synergy with azoles against E. dermatitidis in vitro , which was confirmed in vivo via Galleria mellonella model. Further investigation revealed pyrvinium resulted in significant growth restriction of E. dermatitidis , reduction of biofilm formation, and significantly ( P <.05) decrease of the efflux of Rhodamine 6 G. However, the underlying mechanism and probable target of PP are still unknown. The aim of this study is to investigate the role of fumaric reductase analog in the effect of PP against E. dermatitidis .MethodsThe knockout strain named △Exfr was constituted via polyethyleneglycol (PEG)-mediated transformation of protoplasts. A gene replacement cassette was generated as described. E. dermatitidis wild-type strain ATCC34100 DNA was used for molecular cloning. The pan7-1 plasmid vector, which contained the genetic markers hygromycin B phosphotransferase, was applied as a selection marker provider. DNA manipulation was performed according to standard laboratory procedures. The 5′ and 3′ flanking regions of fumaric reductase analog coding gene Exfr (Genbank geneID 20312383) were amplified using the primers ExfruF, ExfruR, and ExfrdF, ExfrdR, respectively. The selection maker Hph was amplified from pan7-1 by using primers hphF and hphR. These three fragments are subsequently fused via PCR with primers ExfuF and ExfuR. The protoplasts of wild-type strain ATCC34100 were prepared as described. Further, the fused gene fragment and PEG was mixed with protoplast to complete transformation, and the transformants were transferred to SDA solid culture base (containing a final concentration of 50 μ g/ml hygromycin). DNA extracted from the transformants that could grow stably on HPH medium was sent for sequencing to verify that the target gene had been introduced into the location. The growth, morphology, and in vitro susceptibility of ATCC34100 and △Exfr were further investigated.ResultsThere was no significant difference in the colony or conidial morphology. However, the growth rate of △Exfr was slightly slower than that of the wild-type strain. In addition, the MICs of pyrvinium pamoate (PP) and voriconazole against △Exfr were 2-fold higher (16 ug/ml and 0.5ug/ml, respectively), compared with that of the wild-type strain.ConclusionThe preliminary results suggested that fumaric reductase analog may play an important role in drug sensitivity of E. dermatitidis , especially the sensitivity to PP and voriconazole. In addition, △Exfr is currently the only E. dermatitidis strain that was successfully knocked out by protoplast procedure, which provides reference for subsequent researches on E. dermatitidis gene knockout.Table 1.Primers used in this study.Primer nameSequence (5′ → 3')ExfruFATCAGTAGTACTGTACGTCGTGTGCExfruRGATCTTGCCGATCCCCGTCGATCGCExfrdFGTGTTGTTCAAGTTGGGTGCATGTGExfrdRTCTTGAAGGCGAGTAGACGGACTCAExfuFGTTCAACTTTGGTTTTGTGGAGGAGExfuRCCTTCTCCCTCTTCCTACCGTCCTChphFCTCCGGAGTTGAGACAAATGGhphRCATCCACTGCACCTCAGAGC
infectious diseases,veterinary sciences,mycology