Abstract:Rationale: Inherited antithrombin deficiency (ATD) is a major cause of thrombotic deficiency. Genetic testing is of great value in the diagnosis of hereditary thrombophilia. Herein, we report a case of inherited ATD admitted to our hospital. We include the results of genealogy and discuss the significance of genetic testing in high-risk groups of hereditary thrombophilia. Patient concerns: A 16-year-old male patient presented with chest tightness, shortness of breath, wheezing, and intermittent fever (up to 39 °C) after strenuous exercise for 2 weeks. He also had a cough with white sputum with a small amount of bright red blood in the sputum and occasional back pain. Diagnoses: The blood tests showed that the patient's antithrombin III concentration and activity were both significantly reduced to 41% and 43.2%, respectively. Enhanced chest computed tomography scans showed pulmonary infarction in the lower lobe of the right lung with multiple embolisms in the bilateral pulmonary arteries and branches. Lower vein angiography revealed a contrast-filling defect of the inferior vena cava and left common iliac vein. Thrombosis was considered as a differential diagnosis. His father and his uncle also had a history of thrombosis. The patient was diagnosed with inherited ATD. Further, peripheral venous blood samples of the family members were collected for whole-exome gene sequencing, and Sanger sequencing was used to verify the gene mutation site in the family. The patient and his father had a SERPINC1 gene duplication mutation: c.1315_1345dupCCTTTCCTGGTTTTTAAGAGAAGTTCCTC (NM000488.4). Interventions: An inferior vena cava filter was inserted to avoid thrombus shedding from the lower limbs. Urokinase was injected intermittently through the femoral vein cannula for thrombolysis. Heparin combined with warfarin anticoagulant therapy was sequentially administered. After reaching the international normalized ratio, heparin was discontinued, and oral warfarin anticoagulant therapy was continued. After discharge, the patient was switched to rivaroxaban as oral anticoagulation therapy. Outcomes: The patient's clinical symptoms disappeared. reexamination showed that the thrombotic load was less than before, and the inferior vena cava filter was then removed. Lessons: By this report we highlight that gene detection and phenotypic analysis are important means to study inherited ATD.

SERPINC1 c.1247dupC: a novel SERPINC1 gene mutation associated with familial thrombosis results in a secretion defect and quantitative antithrombin deficiency

Clinical and functional characterization of rare compound heterozygous mutations in the SERPINC1 gene causing severe thrombophilia

Identification and characterization of two SERPINC1 mutations causing congenital antithrombin deficiency

A novel SERPINC1 c.119G>A (p.Cys40Tyr) mutation with variable clinical expression in an Indian family

Long-range and real-time PCR identification of a large SERPINC1 deletion in a patient with antithrombin deficiency

Atypical pulmonary thromboembolism caused by the mutation site SERPINC1 of the antithrombin III gene: A case report

Antithrombin deficiency: A pediatric disorder

A Novel Variation of SERPINC1 Caused Deep Venous Thrombosis in a Chinese Family: A Case Report.

Inherited antithrombin deficiency caused by a mutation in the SERPINC1 gene: A case report

Compound Hemizygous Variants in SERPINA7 Gene Cause Thyroxine-Binding Globulin Deficiency

Missense Mutation of SERPINC1 (p.ser426leu) in a Young Patient Presenting As Refractory and Recurrent Venous Thromboembolism: A Case Report.

Clinical and Molecular Characterization of Nine Novel Antithrombin Mutations

Rare Double Heterozygous Mutations in Antithrombin Underlie Hereditary Thrombophilia in a Chinese Family.

Characterization of molecular defect of 13387-9delG mutated antithrombin in inherited type I antithrombin deficiency.

A novel mutation in antithrombin gene results in hereditary antithrombin deficiency]

Identification of two point mutations associated with inherited antithrombin deficiency

[A heterozygous point mutation G13328A in antithrombin gene causes thrombosis].

SERPINA11 related novel serpinopathy – A perinatal lethal disorder

Factor V haemostatic diathesis impairing thrombin activation, membrane binding and circulating antigen level due to a novel compound heterozygous mutation, Leu1821Ser and Gly2192Cys

Human induced pluripotent stem cells derived from a patient with a mutation of SERPINC1 c.236G>A (p.R79H)

The protein C omega-loop substitution Asn2Ile is associated with reduced protein C anticoagulant activity