Abstract:Objective More and more attention has been given to the presumption that glioma stem cells (GSCs) originate from neural stem cells (NSCs) with gene mutation, however, there is no enough evidence by now. This paper aims to get evidence of this area. Methods Glioma stem/progenitor cells (GSPCs) and neural stem/progenitor cells (NSPCs) were cultivated in vitro, and were identified before the following studies. Total RNA was isolated and then reverse⁃transcribed into cDNA, with primers specific to phosphatase and tensin homolog deleted onchromosome ten (PTEN), high⁃fidelity Taq polymerase was used for the polymerase chain reaction (PCR) to avoid the incorporation of pseudomutation. After amplification, 10 μl of the reaction mixture was electrophoresed through 1.5% agarose gel, and the rest of the reaction mixture was used for sequencing in both directions. The procedures for the isolation of total RNA to PCR and sequencing were repeated twice, and the sequencing results of both DNA and PTEN peptide chain were analysed with DNAssist 1.0 software and compared to the sequence of wild⁃type Homo Sapiens PTEN in GenBank. Results No mutation happened in the PTEN of NSPCs, but there were many base mutations in the mRNA of PTEN of GSPCs compared with the wild⁃type Homo Sapiens PTEN. Though most of these mutations were same sense mutation, still several mutations were not, including the normal DNA bases of PTEN bases 22 to 42 "ATCGTTAGCAGAAACAAAAGG" in first exon mutated into "CTACGATTGATTTGCATCTTT", base 712 "T" in exon 7 mutated into "C", and base 1192 "A" in exon 9 mutated into "T". Accordingly, for the amino acids (AA) sequence in the peptide chain of PTEN, the mutation included AA from the 8th to the 14th (from "IVSRNKR" to "LRLICIF"), the 238th AA (from "F" to "L"), and the 398th AA (from "T" to "S"). These mutated regions were involved in membrane interaction, particularly the combination with phosphatidylinositol 4, 5⁃biphosphate (PIP2) and maintaining the protein stability of PTEN. Therefore, these mutations not only lead to the rapid degradation of PTEN, but also hinder the cellular function of PTEN to down⁃regulate phosphoinostide 3⁃kinase (PI3K) signaling. Conclusion The mutation of PTEN occurs even in the early stage of malignant transformation, which is probably an initiating agent for the tumorigenesis of gliomas. DOI：10.3969/j.issn.1672-6731.2010.06.014

Loss of p53 Concurrent with RAS and TERT Activation Induces Glioma Formation

Loss of <i>p53</i> Concurrent with <i>RAS</i> and <i>TERT</i> Activation Induces Glioma Formation

Argininosuccinate Lyase Drives Activation of Mutant TERT Promoter in Glioblastomas

Expression of Mutant p53 Proteins Implicates a Lineage Relationship between Neural Stem Cells and Malignant Astrocytic Glioma in a Murine Model

Gliomagenesis Arising From Pten- And Ink4a/Arf-Deficient Neural Progenitor Cells Is Mediated By The P53-Fbxw7/Cdc4 Pathway, Which Controls C-Myc

PTEN deficiency reprogrammes human neural stem cells towards a glioblastoma stem cell-like phenotype

EZH2-, CHD4-, and IDH-linked Epigenetic Perturbation and Its Association with Survival in Glioma Patients

Opposing Tumor-Promoting and -Suppressive Functions of Rictor/mTORC2 Signaling in Adult Glioma and Pediatric SHH Medulloblastoma.

Haploinsufficiency of Adenomatous Polyposis Coli Coupled with Kirsten Rat Sarcoma Viral Oncogene Homologue Activation and P53 Loss Provokes High-Grade Glioblastoma Formation in Mice

R280T mutation of p53 gene promotes proliferation of human glioma cells through GSK-3β/PTEN pathway.

Glioma Initiating Cells Contribute to Malignant Transformation of Host Glial Cells During Tumor Tissue Remodeling Via PDGF Signaling.

Sequential fate-switches in stem-like cells drive the tumorigenic trajectory from human neural stem cells to malignant glioma

Ccnb2/Sasp/Cathepsin B & Pge2 Axis Induce Cell Senescence Mediated Malignant Transformation

Research of PTEN Mutation in Glioma Stem/progenitor Cells

Foxm1b Regulates Nedd4-1 Expression, Leading To Cellular Transformation And Full Malignant Phenotype In Immortalized Human Astrocytes

Common Denominators of Self-renewal and Malignancy in Neural Stem Cells and Glioma

Activation of JNK and P38 MAPK Mediated by ZDHHC17 Drives Glioblastoma Multiforme Development and Malignant Progression.

GSK3 Palmitoylation Mediated by ZDHHC4 Promotes Tumorigenicity of Glioblastoma Stem Cells in Temozolomide-Resistant Glioblastoma Through the EZH2-STAT3 Axis

Transposon mutagenesis identifies genes that transform neural stem cells into glioma-initiating cells

Simultaneous Nbs1 and P53 Inactivation in Neural Progenitors Triggers High-Grade Gliomas.

Human Glioma Stem-Like Cells Induce Malignant Transformation of Bone Marrow Mesenchymal Stem Cells by Activating TERT Expression