Abstract:Cyst-forming nematode is an important plant parasitic nematode group,in which over 80 species were reported and described.There are many economically important cyst-forming nematodes species in China,such as Heterodera glycines,Heterodera avenae,and Heterodera filipjevii.During 2015—2016,a survey for cyst-forming nematodes in Zhejiang,eastern China,revealed the distribution of a cyst-forming nematode population from Phyllostachys praecox in Lin'an,Zhejiang,eastern China.Morphological characteristics and morphometrics of cysts and second-stage juveniles (J2s)were observed and measured using light microscope and scanning electron microscope.Cysts were characterized by appearing light to dark brown in coloration,globose to subspherical shape of body contour,distinct neck and cone,lacking underbridge,bullae and fenestrae,body length ranging from 575.0 to 1230.0μm,body width ranging from 397.0 to 872.0μm,and vulva slit length ranging from 36.7 to 50.9μm.J2 was characterized by hemispherical labial region,nearly continuous with round body contour and stylet knobs,three incisures in lateral field,tail tapering and tail hyaline region accounting for 55% 75%,body length ranging from 426.3 to 608.0μm;body width ranging from 15.9 to 29.3μm;stylet length ranging from 17.7 to 21.9μm;dorsal gland orifice ranging from 4.3 to 6.2μm;tail length ranging from 68.7 to 84.5μm.Amplification of the ITS and D2/D3 fragments of the cyst-forming nematodes from bamboo with universal primers AB28 (ATATGCTTAAGTTCAGCGGGT)and TW81 (GTTTCCGTAGGTGAACCTGC),D2 A (ACAAGTACCGTGA GGGAAAGTTG)and D3B (TCGGAAGGAACCAGCTACTA)yielded PCR fragments with sizes of 1006 bp (GenBank:KX640828)and 786 bp (GenBank:KX640827),respectively,the sequences of ITS and D2/D3 of cyst nematodes parasitizing on bamboo were 99.7% and 99.6% similar to that of Heterodera koreana deposited in GenBank,respectively.Combined with morphological, morphometrics and molecular phylogeny analysis, the results showed that the cyst nematodes parasitizing on bamboo from Lin'an,Zhejiang,China is H.koreana,is a new record in Zhej iang,Eastern China.

A new record of the genus Froggattiella Leonardi (Hemiptera, Coccomorpha, Diaspididae) in South Korea

Heterodera koreana,a new record of cyst-forming nematodes in Zhejiang Province,China

Two new records of the genus Trioxys (Hymenoptera, Braconidae, Aphidiinae) parasitic on bamboo aphids from South Korea

Two New Species and Three New Records of Ascomycetes in Korea

Taxonomic review of the family Throscidae Laporte, 1840 (Coleoptera: Elateroidea) in Korea, the description of a new species with new generic and species records

Current State of Knowledge of the Korean Cynipini: Subspecies Description, New Combinations and Checklist (hymenoptera, Cynipidae)

New Species and Eight Undescribed Species Belonging to the Families Aspergillaceae and Trichocomaceae in Korea

Nine new species of the genus Pholcus Walckenaer (Araneae: Pholcidae) from South Korea

The genus Ommatidiotus Spinola (Hemiptera: Auchenorrhyncha: Caliscelidae) from the Korean Peninsula and neighboring countries

Additions to the genus Kirschsteiniothelia (Dothideomycetes); Three novel species and a new host record, based on morphology and phylogeny

Taxonomic notes on the genus Chaitoregma (Hemiptera, Aphididae, Hormaphidinae), with description of a new species from China

Unveiling Species Diversity Within Early-Diverging Fungi from China III: Six New Species and a New Record of Gongronella (cunninghamellaceae, Mucoromycota)

First record from Europe of the Asian bamboo-feeding leafhopper Trifida bilobata Ohara, 2014 (Hemiptera: Cicadellidae: Typhlocybinae)

The genus Rhodocollybia (Omphalotaceae, Basidiomycota) in the Republic of Korea

Hidden in the bamboo: A new parachuting frog (Rhacophoridae, Rhacophorus) from the borderlands of western China, with comments on the taxonomy of R. rhodopus

The checklist of leaf-mining moths Phyllonorycter Hübner (Lepidoptera: Gracillariidae) of Korea with description of two new species and nine newly recorded species

Aspergillus ullungdoensis sp. nov., Penicillium jeongsukae sp. nov., and other fungi from Korea

Korean species of Hydrosmecta Thomson (Coleoptera: Staphylinidae: Aleocharinae) with descriptions of two new species

Description of a new species and two new records of the family Cosmopterigidae (Lepidoptera) from Korea

The genus Pulvinaria (Hemiptera: Coccomorpha: Coccidae) in China, with description of a new species and a new record

A new species in the genus Aphlugiolopsis Wang, Liu & Li, 2015 (Tettigoniidae: Meconematinae) with descriptive notes on the known species from China