GmSABP2-1 encodes methyl salicylate esterase and functions in soybean defense against soybean cyst nematode

Chen, Feng

DOI: https://doi.org/10.1007/s00299-024-03224-9

IF: 6.2

2024-05-12

Plant Cell Reports

Abstract:The soybean gene GmSABP2-1 encodes methyl salicylate esterase and its overexpression led to significant reduction in development of pathogenic soybean cyst nematode.

plant sciences

What problem does this paper attempt to address?

A methyl esterase 1 (PvMES1) promotes the salicylic acid pathway and enhances Fusarium wilt resistance in common beans

Renfeng Xue,Ming Feng,Jian Chen,Weide Ge,Matthew W. Blair

DOI: https://doi.org/10.1007/s00122-021-03830-1

IF: 5.4

2021-06-14

Theoretical and Applied Genetics

Abstract:Methyl esterase (MES), PvMES1, contributes to the defense response toward Fusarium wilt in common beans by regulating the salicylic acid (SA) mediated signaling pathway from phenylpropanoid synthesis and sugar metabolism as well as others.

plant sciences,genetics & heredity,horticulture,agronomy
Overexpression of GmSRC2 confers resistance to Phytophthora sojae in soybean

Sushuang Deng,Yu Zhang,Xiaowan Fang,Han Gou,Ruidong Sun,Huidong Xuan,Haitang Wang,Jinming Zhao,Han Xing,Na Guo

DOI: https://doi.org/10.1016/j.plantsci.2024.112247

Abstract:Phytophthora root and stem rot caused by Phytophthora sojae (P. sojae) is one of the most destructive diseases to affect soybean (Glycine max (L.) Merr) production. GmSRC2 that encodes a C2 domain-containing protein can respond to various stresses, however, the molecular mechanism of GmSRC2 in resistance of soybean to P. sojae is yet to be fully elucidated. In this study, GmSRC2 was found to be significantly up-regulated under P. sojae treatment; GmSRC2-overexpression (OE) transgenic lines and GmSRC2-silencing transient plants were generated via Agrobacterium tumefaciens mediated transformation and virus-induced gene silencing (VIGS) system, respectively. Infected leaves and cotyledons of OE-GmSRC2-1 and OE-GmSRC2-2 lines showed significant decreases in the disease symptoms and P. sojae biomass than those of wild type (WT); the activities of superoxide dismutase (SOD) and peroxidase (POD) confirmed the accumulation of reactive oxygen species (ROS) in overexpressed transgenic lines. Whereas, silencing of GmSRC2 severely increased the disease symptoms and the biomass of P. sojae. Further, we confirmed that GmSRC2 interacted with the effector PsAvh23 of P. sojae, and the C2 domain was crucial for the interaction. Overexpression of GmSRC2 upregulated the ADA2/GCN5 module upon P. sojae. The aforementioned results demonstrated that GmSRC2 played vital roles in regulating soybean resistance to oomycetes.
The Serine Palmitoyltransferase Core Subunit StLcb2 Regulates Sphingolipid Metabolism and Promotes Setosphaeria Turcica Pathogenicity by Modulating Appressorium Development

Pan Li,Zhenwu An,Hehe Sun,Yanan Meng,Lifeng Hou,Xinpeng Han,Shang Feng,Yuwei Liu,Shen,Fanli Zeng,Jingao Dong,Zhimin Hao

DOI: https://doi.org/10.1016/j.ijbiomac.2024.137928

IF: 8.2

2024-01-01

International Journal of Biological Macromolecules

Abstract:The fungal pathogen Setosphaeria turcica (S. turcica) causes northern corn leaf blight (NCLB), resulting in significant yield and economic losses in maize. To elucidate the metabolic pathways essential for its pathogenicity, we investigated the metabolome of S. turcica during appressorium development, a critical stage for host infection. Our analysis indicated a substantial enrichment of sphingosine and related compounds during this phase. The application of chemical inhibitors to disrupt sphingolipid metabolism confirmed their pivotal role in appressorium formation and pathogenicity. Additionally, silencing of the serine palmitoyl transferase (Spt) core subunit gene StLCB2 led to significant alterations in fungal morphology and growth, accompanied by changes in cell membrane integrity, surface hydrophobicity, melanin, and sphingosine synthesis. These findings underscore the importance of sphingolipids in the pathogenicity of S. turcica and suggest that targeting specific components of the sphingolipid pathway could aid in developing novel fungicides or genetically engineered maize varieties with increased resistance to NCLB.
Overexpression of a plasma membrane protein generated broad‐spectrum immunity in soybean

Micheline N. Ngaki,Dipak K. Sahoo,Bing Wang,Madan K. Bhattacharyya

DOI: https://doi.org/10.1111/pbi.13479

IF: 13.8

2020-10-09

Plant Biotechnology Journal

Abstract:Plants fight‐off pathogens and pests by manifesting an array of defense responses using their innate immunity mechanisms. Here we report the identification of a novel soybean gene encoding a plasma membrane protein, transcription of which is suppressed following infection with the fungal pathogen, Furatium virguliforme. Overexpression of the protein led to enhanced resistance against not only against F. virguliforme, but also against spider mites (Tetranychus urticae, Koch), soybean aphids (Aphis glycines, Matsumura) and soybean cyst nematode (Heterodera glycines). We, therefore, name this protein as Glycine max disease resistance 1 (GmDR1; Glyma.10g094800). The homologues of GmDR1 have been detected only in legumes, cocoa, jute and cotton. The deduced GmDR1 protein contains 73 amino acids. GmDR1 is predicted to contain an ecto‐ and two transmembrane domains. Transient expression of the green fluorescent protein fused GmDR1 protein in soybean leaves showed that it is a plasma membrane protein. We investigated if chitin, a pathogen associated molecular pattern (PAMP), common to all pathogen and pests considered in this study, can significantly enhance defense pathways among the GmDR1‐overexpressed transgenic soybean lines. Chitin induces marker genes of the salicylic‐ and jasmonic acid‐mediated defense pathways; but suppresses the defense pathway regulated by ethylene. Chitin induced SA‐ and JA‐regulated defense pathways may be one of the mechanisms involved in generating broad‐spectrum resistance among the GmDR1‐overexpressed transgenic soybean lines against two serious pathogens and two pests including spider‐mites, against which no known resistance genes have been identified in soybean and among the most other crop species.

biotechnology & applied microbiology,plant sciences
N6-Methyladenosine (m6A) Sequencing Reveals Heterodera glycines-Induced Dynamic Methylation Promoting Soybean Defense

Ruifeng Qin,Minghui Huang,Ye Jiang,Dan Jiang,Doudou Chang,Yifan Xie,Yuewen Dou,Lili Wu,Liuli Wei,Mingze Wang,Zhongyan Tian,Chunjie Li,Congli Wang

DOI: https://doi.org/10.1094/PHYTO-12-23-0474-R

Phytopathology

Abstract:Unraveling the intricacies of soybean cyst nematode (Heterodera glycines) race 4 resistance and susceptibility in soybean breeding lines-11-452 (highly resistant) and Dongsheng1 (DS1, highly susceptible)-was the focal point of this study. Employing cutting-edge N6-methyladenosine (m6A) and RNA sequencing techniques, we delved into the impact of m6A modification on gene expression and plant defense responses. Through the evaluation of nematode development in both resistant and susceptible roots, a pivotal time point (3 days postinoculation) for m6A methylation sequencing was identified. Our sequencing data exhibited robust statistics, successful soybean genome mapping, and prevalent m6A peak distributions, primarily in the 3' untranslated region and stop codon regions. Analysis of differential methylation peaks and differentially expressed genes revealed distinctive patterns between resistant and susceptible genotypes. In the highly resistant line (11-452), key resistance and defense-associated genes displayed increased expression coupled with inhibited methylation, encompassing crucial players such as R genes, receptor kinases, and transcription factors. Conversely, the highly susceptible DS1 line exhibited heightened expression correlated with decreased methylation in genes linked to susceptibility pathways, including Mildew Locus O-like proteins and regulatory elements affecting defense mechanisms. Genome-wide assessments, Gene Ontology and Kyoto Encyclopedia of Genes and Genomes analyses, and differential methylation peak/differentially expressed gene overlap emphasized the intricate interplay of m6A modifications, alternative splicing, microRNA, and gene regulation in plant defense. Protein-protein interaction networks illuminated defense-pivotal genes, delineating divergent mechanisms in resistant and susceptible responses. This study sheds light on the dynamic correlation between methylation, splicing, and gene expression, providing profound insights into plant responses to nematode infection.
Soybean GmSAUL1, a Bona Fide U-Box E3 Ligase, Negatively Regulates Immunity Likely through Repressing the Activation of GmMPK3

Jun-Mei Li,Mei-Yan Ye,Chaofeng Wang,Xiao-Han Ma,Ni-Ni Wu,Chen-Li Zhong,Yanjun Zhang,Ninghui Cheng,Paul A. Nakata,Lirong Zeng,Jian-Zhong Liu

DOI: https://doi.org/10.3390/ijms24076240

IF: 5.6

2023-03-26

International Journal of Molecular Sciences

Abstract:E3 ubiquitin ligases play important roles in plant immunity, but their role in soybean has not been investigated previously. Here, we used Bean pod mottle virus (BPMV)-mediated virus-induced gene silencing (VIGS) to investigate the function of GmSAUL1 (Senescence-Associated E3 Ubiquitin Ligase 1) homologs in soybean. When two closely related SAUL1 homologs were silenced simultaneously, the soybean plants displayed autoimmune phenotypes, which were significantly alleviated by high temperature, suggesting that GmSAUL1a/1b might be guarded by an R protein. Interestingly, silencing GmSAUL1a/1b resulted in the decreased activation of GmMPK6, but increased activation of GmMPK3 in response to flg22, suggesting that the activation of GmMPK3 is most likely responsible for the activated immunity observed in the GmSAUL1a/1b-silenced plants. Furthermore, we provided evidence that GmSAUL1a is a bona fide E3 ligase. Collectively, our results indicated that GmSAUL1 plays a negative role in regulating cell death and immunity in soybean.

biochemistry & molecular biology,chemistry, multidisciplinary
Overexpressing GmCGS2 Improves Total Amino Acid and Protein Content in Soybean Seed

Yuchen Zhang,Qingyu Wang,Yajing Liu,Shuo Dong,Yongqiang Zhang,Youcheng Zhu,Yu Tian,Jingwen Li,Zhuoyi Wang,Ying Wang,Fan Yan

DOI: https://doi.org/10.3390/ijms241814125

IF: 5.6

2023-09-16

International Journal of Molecular Sciences

Abstract:Soybean (Glycine max (L.) Merr.) is an important source of plant protein, the nutritional quality of which is considerably affected by the content of the sulfur-containing amino acid, methionine (Met). To improve the quality of soybean protein and increase the Met content in seeds, soybean cystathionine γ-synthase 2 (GmCGS2), the first unique enzyme in Met biosynthesis, was overexpressed in the soybean cultivar "Jack", producing three transgenic lines (OE3, OE4, and OE10). We detected a considerable increase in the content of free Met and other free amino acids in the developing seeds of the three transgenic lines at the 15th and 75th days after flowering (15D and 75D). In addition, transcriptome analysis showed that the expression of genes related to Met biosynthesis from the aspartate-family pathway and S-methyl Met cycle was promoted in developing green seeds of OE10. Ultimately, the accumulation of total amino acids and soluble proteins in transgenic mature seeds was promoted. Altogether, these results indicated that GmCGS2 plays an important role in Met biosynthesis, by providing a basis for improving the nutritional quality of soybean seeds.

biochemistry & molecular biology,chemistry, multidisciplinary
The GmCYP2-GmHAL3 module regulates salt tolerance in soybean seedlings

Han Gou,Jilei Gan,Juan Liu,Sushuang Deng,Ling Gan,Xiushuai Wang,Jinming Zhao,Han Xing,Na Guo

DOI: https://doi.org/10.1016/j.envexpbot.2023.105604

IF: 6.028

2024-02-01

Environmental and Experimental Botany

Abstract:Soybean (Glycine max L. Merr) production is severely affected by soil salinization as an important crop. The discovery of salt stress-responsive genes is essential for soybean breeding. To our knowledge, cyclophilins (CYPs) play important roles in salt stresses in crops such as rice and cotton, except in soybean. This study cloned GmCYP2 from soybean salt-tolerant cultivar Suxie No. 1 and obtained ten stable transgenic soybean lines overexpressing GmCYP2 by Agrobacterium rhizogenes-mediated transformation. Two of the higher-expressing transgenic lines (OE1 and OE2) were used to compare salt tolerance with the wild type (WT). Under the salt stress, the chlorophyll content, the maximum efficiency of PSII photochemistry (Fv/Fm) and actual photochemical quantum yield [Y(II)] of OE1 and OE2 lines were significantly higher than those of the WT. Meanwhile, the accumulation of malondialdehyde (MDA) in the OE1 and OE2 lines was significantly lower than that in the WT. In addition, the Na+/K+ ratio was also significantly lower than that of the WT in leaves and roots. The results also confirmed that the salt tolerance of GmCYP2-silencing soybean seedlings obtained by virus-induced gene silencing (VIGS) was reduced compared to the control. Subcellular localization showed that GmCYP2 was expressed in the plasma membrane and nucleus of Nicotiana benthamiana. RNA-seq results demonstrated that GmCYP2 is involved in key regulators of the ABA and Ca2+ signaling pathway. Yeast two-hybrid, bimolecular fluorescence complementation (BiFC) and split-luciferase complementation assay demonstrated that GmCYP2 protein interacts with salt-associated halotolerance 3 (HAL3) protein. These results suggest that the GmCYP2-GmHAL3 module enhances salt tolerance of soybean seedlings by maintaining the Na+/K+ ratio and good photosynthetic state and it may be involved in the ABA and Ca2+ signaling pathway.

plant sciences,environmental sciences
The EIN3 transcription factor GmEIL1 improves soybean resistance to Phytophthora sojae

Xi Chen,Yan Sun,Yu Yang,Yuxin Zhao,Chuanzhong Zhang,Xin Fang,Hong Gao,Ming Zhao,Shengfu He,Bo Song,Shanshan Liu,Junjiang Wu,Pengfei Xu,Shuzhen Zhang

DOI: https://doi.org/10.1111/mpp.13452

Abstract:Phytophthora root and stem rot of soybean (Glycine max), caused by the oomycete Phytophthora sojae, is an extremely destructive disease worldwide. In this study, we identified GmEIL1, which encodes an ethylene-insensitive3 (EIN3) transcription factor. GmEIL1 was significantly induced following P. sojae infection of soybean plants. Compared to wild-type soybean plants, transgenic soybean plants overexpressing GmEIL1 showed enhanced resistance to P. sojae and GmEIL1-silenced RNA-interference lines showed more severe symptoms when infected with P. sojae. We screened for target genes of GmEIL1 and confirmed that GmEIL1 bound directly to the GmERF113 promoter and regulated GmERF113 expression. Moreover, GmEIL1 positively regulated the expression of the pathogenesis-related gene GmPR1. The GmEIL1-regulated defence response to P. sojae involved both ethylene biosynthesis and the ethylene signalling pathway. These findings suggest that the GmEIL1-GmERF113 module plays an important role in P. sojae resistance via the ethylene signalling pathway.
Soybean CALCIUM-DEPENDENT PROTEIN KINASE17 Positively Regulates Plant Resistance to Common Cutworm (Spodoptera litura Fabricius)

Huiqi Wang,Xiao Li,Fenglin Su,Hailun Liu,Dezhou Hu,Fang Huang,Deyue Yu,Hui Wang

DOI: https://doi.org/10.3390/ijms232415696

IF: 5.6

2022-12-10

International Journal of Molecular Sciences

Abstract:Soybean is frequently attacked by herbivorous pests throughout the growth period. Exploring anti-insect genes to improve insect resistance in soybean is an important soybean breeding goal. Here, we cloned and characterized the gene for a quantitative trait locus (QTL) related to insect resistance, Glyma.06g189600, which encodes CALCIUM-DEPENDENT PROTEIN KINASE17 (GmCDPK17) in soybean. The pairwise sequence alignment analysis revealed that the presumed protein of GmCDPK17 shares 52.06% similarity with that of GmCDPK38, a known negative regulatory gene of insect resistance in soybean. Ectopic expression of GmCDPK17 and GmCDPK38 restored the phenotypes of the Arabidopsis insect-susceptible mutant cpk10 and insect-resistant mutant cpk28, respectively. Moreover, transgenic hairy roots of the soybean cultivar Jack were generated by Agrobacterium-mediated transformation. Overexpression of GmCDPK17 increased soybean hairy root resistance to common cutworm (CCW), while RNA interference of the gene decreased soybean hairy root resistance to CCW. Sequencing data from the cultivated and wild soybeans were used to analyze the genetic diversity of GmCDPK17. This gene was subjected to domestication selection. Six and seven haplotypes (Haps) were identified in cultivated and wild soybeans, respectively. The resistance Hap1 is not widely used in cultivated soybeans and is mainly distributed at low latitudes. Accessions with resistance haplotypes of the GmCDPK17 and GmCDPK38 genes showed high resistance to CCW. Altogether, we revealed a novel positive regulatory insect resistance gene, GmCDPK17, which may further improve insect resistance in soybean.

biochemistry & molecular biology,chemistry, multidisciplinary
[Gm WRKY33A positively regulates disease resistance in soybean (Glycine max)]

Chenli Zhong,Hujiao Lan,Wenxu Wang,Yating Zhao,Xiaohan Ma,Jianzhong Liu

DOI: https://doi.org/10.13345/j.cjb.230805

2024-10-25

Abstract:The WRKY transcription factor gene family is a plant-specific transcription factor that plays important roles defense responses. Studies in model plant Arabidopsis demonstrated that WRKYs function downstream of mitogen activated-protein kinase (MAPK) signaling cascade and participate in defense responses through activating the expression of defense-related genes. However, the roles of WRKYs in defense responses have not been previously investigated in paleopolyploidy soybean. Bioinfomatic analysis revealed that there are three pair of GmWRKY33 genes in the soybean genome. The identity of first two pair of GmWRKY33 genes is greater than 84% (named as GmWRKY33A). The identity of genes within the same pair is greater than 95%. A 300 bp fragment highly homologous to these four GmWRKY33A was chosen to clone into bean pod mosaic virus (BPMV)-based silencing vector (BPMV-VIGS) to achieve the goal of silencing four GmWRKY33A genes simultaneously. In this study, we simultaneously silenced four homologous genes of GmWRKY33A using a bean pod mottle virus (BPMV) vector carrying a single fragment of GmWRKY33A. Comparing the silenced plants with the vector control plants, no evident morphological phenotypes were observed. However, the GmWRKY33A-silenced plants exhibited significantly reduced resistance to Pseudomonas syringae pv. glycinea (Psg), Xanthomonas axonopodis pv. glycine (Xag), as well as to soybean mosaic virus (SMV). Furthermore, we demonstrated that silencing these GmWRKY33A genes significantly inhibited the activation of GmMPK3/GmMPK6 induced by Psg infection. Collectively, our results suggest that GmWRKY33As are involved in soybean immunity through regulating the transcription of GmMPK3/6 genes or activating the kinase activities of GmMPK3/6. Taken together, our results demonstrated that GmWRKY33As are positive regulators of soybean immune responses.
Comparative transcriptome profiling reveals the importance of GmSWEET15 in soybean susceptibility to Sclerotinia sclerotiorum

Kunqin Xiao,Kaibin Qiao,Wenjing Cui,Xun Xu,Hongyu Pan,Fengting Wang,Shoudong Wang,Feng Yang,Yuanhu Xuan,Anmo Li,Xiao Han,Zhuojian Song,Jinliang Liu

DOI: https://doi.org/10.3389/fmicb.2023.1119016

IF: 5.2

2023-01-26

Frontiers in Microbiology

Abstract:Soybean sclerotinia stem rot (SSR) is a disease caused by Sclerotinia sclerotiorum that causes incalculable losses in soybean yield each year. Considering the lack of effective resistance resources and the elusive resistance mechanisms, we are urged to develop resistance genes and explore their molecular mechanisms. Here, we found that loss of GmSWEET15 enhanced the resistance to S. sclerotiorum , and we explored the molecular mechanisms by which gmsweet15 mutant exhibit enhanced resistance to S. sclerotiorum by comparing transcriptome. At the early stage of inoculation, the wild type (WT) showed moderate defense response, whereas gmsweet15 mutant exhibited more extensive and intense transcription reprogramming. The gmsweet15 mutant enriched more biological processes, including the secretory pathway and tetrapyrrole metabolism, and it showed stronger changes in defense response, protein ubiquitination, MAPK signaling pathway-plant, plant-pathogen interaction, phenylpropanoid biosynthesis, and photosynthesis. The more intense and abundant transcriptional reprogramming of gmsweet15 mutant may explain how it effectively delayed colonization by S. sclerotiorum . In addition, we identified common and specific differentially expressed genes between WT and gmsweet15 mutant after inoculation with S. sclerotiorum , and gene sets and genes related to gmsweet15 _24 h were identified through Gene Set Enrichment Analysis. Moreover, we constructed the protein–protein interaction network and gene co-expression networks and identified several groups of regulatory networks of gmsweet15 mutant in response to S. sclerotiorum , which will be helpful for the discovery of candidate functional genes. Taken together, our results elucidate molecular mechanisms of delayed colonization by S. sclerotiorum after loss of GmSWEET15 in soybean, and we propose novel resources for improving resistance to SSR.

microbiology
Mitogen-activated protein kinases MPK3 and MPK6 phosphorylate receptor-like cytoplasmic kinase CDL1 to regulate soybean basal immunity

Lei Zhang,Qun Zhu,Yuanhua Tan,Miaomiao Deng,Lei Zhang,Yangrong Cao,Xiaoli Guo

DOI: https://doi.org/10.1093/plcell/koae008

2024-02-02

The Plant Cell

Abstract:Soybean cyst nematode (SCN; Heterodera glycines Ichinohe), one of the most devastating soybean (Glycine max) pathogens, causes significant yield loss in soybean production. Nematode infection triggers plant defense responses; however, the components involved in the upstream signaling cascade remain largely unknown. In this study, we established that a mitogen-activated protein kinase (MAPK) signaling module, activated by nematode infection or wounding, is crucial for soybeans to establish SCN resistance. GmMPK3 and GmMPK6 directly interact with CDG1-LIKE1 (GmCDL1), a member of the receptor-like cytoplasmic kinase (RLCK) subfamily VII. These kinases phosphorylate GmCDL1 at Thr-372 to prevent its proteasome-mediated degradation. Functional analysis demonstrated that GmCDL1 positively regulates immune responses and promotes SCN resistance in soybeans. GmMPK3-mediated and GmMPK6-mediated phosphorylation of GmCDL1 enhances GmMPK3 and GmMPK6 activation and soybean disease resistance, representing a positive feedback mechanism. Additionally, 2 L-type lectin receptor kinases, GmLecRK02g and GmLecRK08g, associate with GmCDL1 to initiate downstream immune signaling. Notably, our study also unveils the potential involvement of GmLecRKs and GmCDL1 in countering other soybean pathogens beyond nematodes. Taken together, our findings reveal the pivotal role of the GmLecRKs–GmCDL1–MAPK regulatory module in triggering soybean basal immune responses.

cell biology,biochemistry & molecular biology,plant sciences
Enhanced tolerance to Phytophthora root and stem rot by over-expression of the plant antimicrobial peptide CaAMP1 gene in soybean

Lu Niu,Xiaofang Zhong,Yuanyu Zhang,Jing Yang,Guojie Xing,Haiyun Li,Dongbo Liu,Rui Ma,Yingshan Dong,Xiangdong Yang

DOI: https://doi.org/10.1186/s12863-020-00872-0

2020-07-06

BMC Genetics

Abstract:Abstract Background Antimicrobial peptides play important roles in both plant and animal defense systems. Moreover, over-expression of CaAMP1 ( Capsicum annuum antimicrobial protein 1 ), an antimicrobial protein gene isolated from C. annuum leaves infected with Xanthomonas campestris pv. vesicatoria , confers broad-spectrum resistance to hemibiotrophic bacterial and necrotrophic fungal pathogens in Arabidopsis . Phytophthora root and stem rot (PRR), caused by the fungus Phytophthora sojae , is one of the most devastating diseases affecting soybean ( Glycine max ) production worldwide. Results In this study, CaAMP1 was transformed into soybean by Agrobacterium -mediated genetic transformation. Integration of the foreign gene in the genome of transgenic soybean plants and its expression at the translation level were verified by Southern and western blot analyses, respectively. CaAMP1 over-expression ( CaAMP1- OX) lines inoculated with P. sojae race 1 exhibited enhanced and stable PRR tolerance through T 2 –T 4 generations compared with the wild-type Williams 82 plants. Gene expression analyses in the transgenic plants revealed that the expression of salicylic acid-dependent, jasmonic acid-dependent, and plant disease resistance genes ( R -genes) were significantly up-regulated after P. sojae inoculation. Conclusions These results indicate that CaAMP1 over-expression can significantly enhance PRR tolerance in soybean by eliciting resistance responses mediated by multiple defense signaling pathways. This provides an alternative approach for developing soybean varieties with improved tolerance against soil-borne pathogenic PRR.

genetics & heredity
Loss-of-function of an α-SNAP gene confers resistance to soybean cyst nematode

Mariola Usovsky,Vinavi A Gamage,Clinton G Meinhardt,Nicholas Dietz,Marissa Triller,Pawan Basnet,Jason D Gillman,Kristin D Bilyeu,Qijian Song,Bishnu Dhital,Alice Nguyen,Melissa G Mitchum,Andrew M Scaboo

DOI: https://doi.org/10.1038/s41467-023-43295-y

2023-11-22

Abstract:Plant-parasitic nematodes are one of the most economically impactful pests in agriculture resulting in billions of dollars in realized annual losses worldwide. Soybean cyst nematode (SCN) is the number one biotic constraint on soybean production making it a priority for the discovery, validation and functional characterization of native plant resistance genes and genetic modes of action that can be deployed to improve soybean yield across the globe. Here, we present the discovery and functional characterization of a soybean resistance gene, GmSNAP02. We use unique bi-parental populations to fine-map the precise genomic location, and a combination of whole genome resequencing and gene fragment PCR amplifications to identify and confirm causal haplotypes. Lastly, we validate our candidate gene using CRISPR-Cas9 genome editing and observe a gain of resistance in edited plants. This demonstrates that the GmSNAP02 gene confers a unique mode of resistance to SCN through loss-of-function mutations that implicate GmSNAP02 as a nematode virulence target. We highlight the immediate impact of utilizing GmSNAP02 as a genome-editing-amenable target to diversify nematode resistance in commercially available cultivars.
GmCIPK21, a CBL-interacting protein kinase confers salt tolerance in soybean (Glycine max. L)

Hui Li,Xiao-Hua Wang,Qiang Li,Ping Xu,Zhen-Ning Liu,Meng Xu,Xiao-Yu Cui

DOI: https://doi.org/10.1016/j.plaphy.2022.05.027

2022-08-01

Abstract:Salt stress severely affects plant development and yield. Calcineurin B-like protein interacting protein kinases (CIPKs) play a crucial role in plant adaptation to environmental challenges. However, the biological functions of CIPKs in soybean remain poorly understood. Here, we identified GmCIPK21, a salt-responsive CIPK gene from soybean. Overexpression of GmCIPK21 in Arabidopsis and soybean hairy roots led to increased salt tolerance. The hairy roots with GmCIPK21 suppression by RNA interference exhibited salt-sensitive phenotypes. Further physiological analysis revealed that GmCIPK21 reduced the content of hydrogen peroxide (H2O2) and malondialdehyde (MDA) and increased the activity of the antioxidant enzymes under salt stress. Additionally, GmCIPK21 was found to enhance the ABA sensitivity of transgenic plants. GmCIPK21 was also implicated in increasing the activation of antioxidant-, salt-, and ABA-related genes upon salt stress. Interestingly, GmCIPK21 interacted with GmCBL4, promoting the scavenging salt-induced reactive oxygen species (ROS). These results collectively suggested that GmCIPK21 affects ROS homeostasis and ABA response to improve salt tolerance in soybean.
Modulation of (homo)glutathione Metabolism and H2O2 Accumulation During Soybean Cyst Nematode Infections in Susceptible and Resistant Soybean Cultivars

Xi Chen,Shuang Li,Xuebing Zhao,Xiaofeng Zhu,Yuanyuan Wang,Yuanhu Xuan,Xiaoyu Liu,Haiyan Fan,Lijie Chen,Yuxi Duan

DOI: https://doi.org/10.3390/ijms21020388

IF: 5.6

2020-01-01

International Journal of Molecular Sciences

Abstract:In plant immune responses, reactive oxygen species (ROS) act as signaling molecules that activate defense pathways against pathogens, especially following resistance (R) gene-mediated pathogen recognition. Glutathione (GSH), an antioxidant and redox regulator, participates in the removal of hydrogen peroxide (H2O2). However, the mechanism of GSH-mediated H2O2 generation in soybeans (Glycine max (L.) Merr.) that are resistant to the soybean cyst nematode (SCN; Heterodera glycines Ichinohe) remains unclear. To elucidate this underlying relationship, the feeding of race 3 of H. glycines with resistant cultivars, Peking and PI88788, was compared with that on a susceptible soybean cultivar, Williams 82. After 5, 10, and 15 days of SCN infection, we quantified γ-glutamylcysteine (γ-EC) and (homo)glutathione ((h)GSH), and a gene expression analysis showed that GSH metabolism in resistant cultivars differed from that in susceptible soybean roots. ROS accumulation was examined both in resistant and susceptible roots upon SCN infection. The time of intense ROS generation was related to the differences of resistance mechanisms in Peking and PI88788. ROS accumulation that was caused by the (h)GSH depletion-arrested nematode development in susceptible Williams 82. These results suggest that (h)GSH metabolism in resistant soybeans plays a key role in the regulation of ROS-generated signals, leading to resistance against nematodes.
The BTB/POZ domain protein GmBTB/POZ promotes the ubiquitination and degradation of the soybean AP2/ERF-like transcription factor GmAP2 to regulate the defense response to Phytophthora sojae

Chuanzhong Zhang,Hong Gao,Yan Sun,Liangyu Jiang,Shengfu He,Bo Song,Shanshan Liu,Ming Zhao,Le Wang,Yaguang Liu,Junjiang Wu,Pengfei Xu,Shuzhen Zhang

DOI: https://doi.org/10.1093/jxb/erab363

IF: 6.9

2021-08-02

Journal of Experimental Botany

Abstract:Abstract Phytophthora root and stem rot in soybean (Glycine max) is a destructive disease worldwide, and hence improving crop resistance to the causal pathogen, P. sojae, is a major target for breeders. However, it remains largely unclear how the pathogen regulates the various affected signaling pathways in the host, which consist of complex networks including key transcription factors and their targets. We have previously demonstrated that GmBTB/POZ enhances soybean resistance to P. sojae and the associated defense response. Here, we demonstrate that GmBTB/POZ interacts with the transcription factor GmAP2 and promotes its ubiquitination. GmAP2-RNAi transgenic soybean hairy roots exhibited enhanced resistance to P. sojae, whereas roots overexpressing GmAP2 showed hypersensitivity. GmWRKY33 was identified as a target of GmAP2, which represses its expression by directly binding to the promoter. GmWRKY33 acts as a positive regulator in the response of soybean to P. sojae. Overexpression of GmBTB/POZ released the GmAP2-regulated suppression of GmWRKY33 in hairy roots overexpressing GmAP2 and increased their resistance to P. sojae. Taken together, our results indicate that GmBTB/POZ-GmAP2 modulation of the P. sojae resistance response forms a novel regulatory mechanism, which putatively regulates the downstream target gene GmWRKY33 in soybean.

plant sciences
Transcriptional and Metabolomic Analyses Reveal That GmESR1 Increases Soybean Seed Protein Content Through the Phenylpropanoid Biosynthesis Pathway

Runnan Zhou,Sihui Wang,Jianwei Li,Mingliang Yang,Chunyan Liu,Zhaoming Qi,Chang Xu,Xiaoxia Wu,Qingshan Chen,Ying Zhao

DOI: https://doi.org/10.1111/pce.15250

2024-11-02

Plant Cell & Environment

Abstract:Soybeans are an economically vital food crop, which is employed as a key source of oil and plant protein globally. This study identified an EREBP‐type transcription factor, GmESR1 (Enhance of Shot Regeneration). GmESR1 overexpression has been observed to significantly increase seed protein content. Furthermore, the molecular mechanism by which GmESR1 affects protein accumulation through transcriptome and metabolomics was also identified. The transcriptomic and metabolomic analyses identified 95 differentially expressed genes and 83 differentially abundant metabolites during the seed mid‐maturity stage. Co‐analysis strategies revealed that GmESR1 overexpression inhibited the biosynthesis of lignin, cellulose, hemicellulose, and pectin via the phenylpropane biosynthetic pathway, thereby redistributing biomass within cells. The key genes and metabolites impacted by this biochemical process included Gm4CL‐like, GmCCR, Syringin, and Coniferin. Moreover, it was also found that GmESR1 binds to (AATATTATCATTAAGTACGGAC) during seed development and inhibits the transcription of GmCCR. GmESR1 overexpression also enhanced sucrose transporter gene expression during seed development and increased the sucrose transport rate. These results offer new insight into the molecular mechanisms whereby GmESR1 increases protein levels within soybean seeds, guiding future molecular‐assisted breeding efforts aimed at establishing high‐protein soybean varieties.

plant sciences
DNA methylation analysis reveals local changes in resistant and susceptible soybean lines in response to Phytophthora sansomeana

Charlotte N DiBiase,Xi Cheng,Gwonjin Lee,Richard C Moore,Austin G McCoy,Martin I Chilvers,Lianjun Sun,Dechun Wang,Feng Lin,Meixia Zhao

DOI: https://doi.org/10.1093/g3journal/jkae191

2024-10-07

Abstract:Phytophthora sansomeana is an emerging oomycete pathogen causing root rot in many agricultural species including soybean. However, as of now, only one potential resistance gene has been identified in soybean, and our understanding of how genetic and epigenetic regulation in soybean contributes to responses against this pathogen remains largely unknown. In this study, we performed whole genome bisulfite sequencing (WGBS) on two soybean lines, Colfax (resistant) and Williams 82 (susceptible), in response to P. sansomeana at two time points: 4 and 16 hours post-inoculation to compare their methylation changes. Our findings revealed that there were no significant changes in genome-wide CG, CHG (H = A, T, or C), and CHH methylation. However, we observed local methylation changes, specially an increase in CHH methylation around genes and transposable elements (TEs) after inoculation, which occurred earlier in the susceptible line and later in the resistant line. After inoculation, we identified differentially methylated regions (DMRs) in both Colfax and Williams 82, with a predominant presence in TEs. Notably, our data also indicated that more TEs exhibited changes in their methylomes in the susceptible line compared to the resistant line. Furthermore, we discovered 837 DMRs within or flanking 772 differentially expressed genes (DEGs) in Colfax and 166 DMRs within or flanking 138 DEGs in Williams 82. These DEGs had diverse functions, with Colfax primarily showing involvement in metabolic process, defense response, plant and pathogen interaction, anion and nucleotide binding, and catalytic activity, while Williams 82 exhibited a significant association with photosynthesis. These findings suggest distinct molecular responses to P. sansomeana infection in the resistant and susceptible soybean lines.

GmSABP2-1 encodes methyl salicylate esterase and functions in soybean defense against soybean cyst nematode

A methyl esterase 1 (PvMES1) promotes the salicylic acid pathway and enhances Fusarium wilt resistance in common beans

Overexpression of GmSRC2 confers resistance to Phytophthora sojae in soybean

The Serine Palmitoyltransferase Core Subunit StLcb2 Regulates Sphingolipid Metabolism and Promotes Setosphaeria Turcica Pathogenicity by Modulating Appressorium Development

Overexpression of a plasma membrane protein generated broad‐spectrum immunity in soybean

N6-Methyladenosine (m6A) Sequencing Reveals Heterodera glycines-Induced Dynamic Methylation Promoting Soybean Defense

Soybean GmSAUL1, a Bona Fide U-Box E3 Ligase, Negatively Regulates Immunity Likely through Repressing the Activation of GmMPK3

Overexpressing GmCGS2 Improves Total Amino Acid and Protein Content in Soybean Seed

The GmCYP2-GmHAL3 module regulates salt tolerance in soybean seedlings

The EIN3 transcription factor GmEIL1 improves soybean resistance to Phytophthora sojae

Soybean CALCIUM-DEPENDENT PROTEIN KINASE17 Positively Regulates Plant Resistance to Common Cutworm (Spodoptera litura Fabricius)

[Gm WRKY33A positively regulates disease resistance in soybean (Glycine max)]

Comparative transcriptome profiling reveals the importance of GmSWEET15 in soybean susceptibility to Sclerotinia sclerotiorum

Mitogen-activated protein kinases MPK3 and MPK6 phosphorylate receptor-like cytoplasmic kinase CDL1 to regulate soybean basal immunity

Enhanced tolerance to Phytophthora root and stem rot by over-expression of the plant antimicrobial peptide CaAMP1 gene in soybean

Loss-of-function of an α-SNAP gene confers resistance to soybean cyst nematode

GmCIPK21, a CBL-interacting protein kinase confers salt tolerance in soybean (Glycine max. L)

Modulation of (homo)glutathione Metabolism and H2O2 Accumulation During Soybean Cyst Nematode Infections in Susceptible and Resistant Soybean Cultivars

The BTB/POZ domain protein GmBTB/POZ promotes the ubiquitination and degradation of the soybean AP2/ERF-like transcription factor GmAP2 to regulate the defense response to Phytophthora sojae

Transcriptional and Metabolomic Analyses Reveal That GmESR1 Increases Soybean Seed Protein Content Through the Phenylpropanoid Biosynthesis Pathway

DNA methylation analysis reveals local changes in resistant and susceptible soybean lines in response to Phytophthora sansomeana