Abstract:Background: There are not many species of turtles and some species have become rare or even endangered due to the changes in the ecological environment, the destruction of human pet market trade, the use of food and medicinal materials and other factors. The phylogenetic study of Geoemyda spengleri and their related species will help to protect turtle germplasm resources. Methods: The sample was collected from nature reserves in Guangxi, China and processed for DNA isolation and confirmed with Polymerase chain reaction (PCR). Maximum-likelihood (ML) were conducted based on concatenated sequences of 13 protein-coding genes from mitochondrial genomes of 25 taxa. Result: The complete mitochondrial genome (17,448 bp) from the Black-breasted leaf turtle (Geoemyda spengleri) was determined. The genome content, gene order and base composition conformed to the consensus vertebrate type mtDNA. However, a remarkable feature was found in this molecule: a small number of (ATATTATTATATTATTATATATC)n direct tandem repeats followed by a AT-enriched microsatellite sequence at the 3’ end of the control region (D-loop), which might be useful as molecular markers for studying population genetics and helpful for species identification and conservation. The results strongly supported that 1) Geoemyda spengleri and the most recent common ancestor of Batagur trivittata and Pangshura sylhetensis formed a monophyletic clade, whereas most other species of Geoemydidae formed another branch, suggesting that Geoemyda and Batagur trivittata may have more closely relationships than other genera; 2) the Geoemydidae with Testudinidae was a sister group rather than with the Emydidae. Furthermore, In order to analyze the relationship between habitat distribution and the phylogenetic evolution of turtles, the habitat distribution map was plotted based on the habitat distribution of species of Geoemydidae. The results also supported that Geoemyda spengleri and Batagur trivittata may relatively have intimate relationships.

Comparison and Phylogenetic Analysis of Mitochondrial Genomes of Talpidae Animals

Evolution and Biogeography of Talpid Moles from Continental East Asia and the Japanese Islands Inferred from Mitochondrial and Nuclear Gene Sequences.

The complete mitochondrial genome of Talpa aquitania (Talpidae; Insectivora), a mole species endemic to northern Spain and southern France

The Complete Mitochondrial Genome Sequence of Tylototriton Taliangensis (amphibia: Caudata).

Cloning of Mitochondrial Cytochrome B Gene of Tetraogallus Himalayensis and Analysis of Its Relationships in Phasianidae

Comparative mitogenome research revealed the phylogenetics and evolution of the superfamily Tenebrionoidea (Coleoptera: Polyphage)

Structure and Phylogenetic Relationships of Scolopacidae Mitogenomes (Charadriiformes: Scolopacidae)

Characterization, Comparative Analyses, and Phylogenetic Implications of Mitochondrial Genomes among Bark and Ambrosia Beetles (coleoptera: Curculionidae, Scolytinae)

Characterization, Comparison of Two New Mitogenomes of Crocodile Newts Tylototriton (Caudata: Salamandridae), and Phylogenetic Implications

The Complete Mitochondrial DNA of Tegillarca Granosa and Comparative Mitogenomic Analyses of Three Arcidae Species

Comparative Analysis of the Complete Mitochondrial Genomes of Related Species Chrysolophus Amherstiae and Chrysolophus Pictus

Testing Hypotheses of Mitochondrial Gene‐tree Paraphyly: Unravelling Mitochondrial Capture of the Streak‐breasted Scimitar Babbler (pomatorhinus Ruficollis) by the Taiwan Scimitar Babbler (pomatorhinus Musicus)

Complete mitochondrial genome of the Iberian Mole Talpa occidentalis (Talpidae, Insectivora) and comparison with Talpa europaea

Characterization of the complete mitochondrial genomes of four tarantulas (Arachnida: Theraphosidae) with phylogenetic analysis

Mitochondrial DNA Phylogeny of Two Morphologically Enigmatic Fishes in the Subfamily Schizothoracinae (teleostei: Cyprinidae) in the Qinghai‐Tibetan Plateau

The Complete Mitochondrial Genome of Stratiolaelaps Scimitus (acari: Laelapidae) and the Comparison of Mitochondrial Gene Rearrangement in the Mesostigmata

A Comprehensive Description and Evolutionary Analysis of Testudines Mitochondrial Genomes

Highly Rearranged Gene Orders and Rapid Evolutionary Rates in the Mitochondrial Genomes of Apodida (echinodermata: Holothuroidea)

Analysis of the Complete Mitochondrial Genome of Pteronura Brasiliensis and Lontra Canadensis.

Mitogenomic phylogeny of Trochoidea (Gastropoda: Vetigastropoda): New insights from increased complete genomes

Influence of Evolutionary Allometry on Rates of Morphological Evolution and Disparity in strictly Subterranean Moles (Talpinae, Talpidae, Lipotyphla, Mammalia)