Alternation of Circadian Clock Modulates Forkhead Box Protein-3 Gene Transcription in CD4+ T Cells in the Intestine.
Gui Yang,Hong Zhang,Yi Liu,Ying Feng,Xiang-Qian Luo,Zhi-Qiang Liu,Xiao-Rui Geng,Shuai Wang,Peng-Yuan Zheng,Bai-Sui Feng,Zhi-Gang Liu,Ping-Chang Yang,Hua-Bin Li,Shan-Dong Wu
DOI: https://doi.org/10.1016/j.jaci.2016.04.035
IF: 14.29
2016-01-01
Journal of Allergy and Clinical Immunology
Abstract:The alteration of the circadian clock is associated with the pathogenesis of a large number of disorders in the body.1Geiger S.S. Fagundes C.T. Siegel R.M. Chrono-immunology: progress and challenges in understanding links between the circadian and immune systems.Immunology. 2015; 146: 349-358Crossref PubMed Scopus (65) Google Scholar Prompted by the fact that some patients complained that their food allergy occurred after engaging their career with regular day-/night-shift rotation for several years, we carried out a survey on identifying a possible connection between the day-/night-shift rotation and food allergy. Within 668 nurses with regular day-/night-shift rotation, the incidence of food allergy was 86 of 668 (12.9%), whereas in those without engaging the regular day-/night-shift rotation, the incidence of food allergy was 26 of 668 (3.9%) (Table I). The serum levels of specific IgE and IL-4 in patients with food allergy were significantly higher than in healthy subjects. The frequency of CD4+ CD25+ Foxp3+ regulatory T (Treg) cells in patients with food allergy was significantly lower than in healthy subjects (Table I, section 2). A correlation analysis with the data showed a positive correlation (r = 0.3664; P < .01) between the day-/night-shift rotation and the incidence of food allergy. Most food allergies (81.4%) in this group occurred 3 to 4 years after the group members engaged in the day-/night-shift-rotation career (Table I, section 3). The data imply that there is a possible connection between the day-/night-shift-rotation lifestyle and the initiation of food allergy.Table IClinical features of human subjectsSection 1: Food allergy surveySubjects with day/night shiftSubjects with non–day/night shiftHealthy subjectsParticipants, n66866840Sex: male/female, n334/334334/33420/20Age (y), mean ± SD38.5 ± 1637.8 ± 1538.8 ± 18Allergensn (%)n (%)Total food allergy patients86 (12.9)26 (3.9)∗P < .01, compared with the day-night-shift group (χ2 test).0Allergen distribution Fish18 (20.9)5 (19.2)0 Shell fish12 (13.9)3 (11.5)0 Milk11 (12.8)3 (11.5)0 Tree nuts10 (11.6)3 (11.5)0 Soy10 (11.6)1 (3.8)0 Fruit8 (9.3)6 (23.1)0 Sesame seed6 (6.9)00 Wheat6 (6.9)00 Egg6 (6.9)5 (19.2)0 Peanut5 (5.8)5 (19.2)0With other allergies Asthma1 (0.15)1 (0.15) Allergic rhinitis2 (0.3)0 Allergic dermatitis1 (0.15)2 (0.3)Serum vitamin D (ng/mL)30.8 ± 1.930.5 ± 1.3Serum cortisol (ng/mL)19.8 ± 2.420.2 ± 2.3Height (m)1.59 ± 0.061.58 ± 0.06Weight (kg)61.5 ± 3.560.6 ± 3.2BMI (kg/m2)24.2 ± 2.823.9 ± 2.1Section 2: Immune testsParametersDay/night shiftRegular shiftHealthy subjectsFANon-FAFANon-FASpecific IgE (kU/L)15.3 ± 21.6<0.3512.5 ± 18.2<0.35<0.35Regulatory T cells (%)2.14 ± 2.065.95 ± 5.142.28 ± 2.356.28 ± 7.296.68 ± 6.26Serum IL-4 (pg/mL)45.8 ± 25.912.6 ± 18.639.5 ± 31.39.8 ± 15.410.5 ± 8.6SPT diameter (mm)6.58 ± 4.872.11 ± 1.145.74 ± 3.851.86 ± 1.471.17 ± 1.08Section 3: Occurrence of food allergy after the career of day-/night-shift rotationTime (y)Patients with food allergyPercent1-255.83-47081.45-6910.5>711.2Some patients were allergic to more than 1 allergen. Data are presented as mean ± SD from all subjects.BMI, Body mass index; FA, food allergy; SPT, skin prick test.∗ P < .01, compared with the day-night-shift group (χ2 test). Open table in a new tab Some patients were allergic to more than 1 allergen. Data are presented as mean ± SD from all subjects. BMI, Body mass index; FA, food allergy; SPT, skin prick test. Published data indicate that the altered circadian clock (ACC) compromises the intestinal epithelial barrier integrity.2Kyoko O.O. Kono H. Ishimaru K. Miyake K. Kubota T. Ogawa H. et al.Expressions of tight junction proteins Occludin and Claudin-1 are under the circadian control in the mouse large intestine: implications in intestinal permeability and susceptibility to colitis.PLoS One. 2014; 9: e98016Crossref PubMed Scopus (81) Google Scholar Epithelial barrier dysfunction facilitates the initiation of food allergy.3Yang P.C. Jury J. Soderholm J.D. Sherman P.M. McKay D.M. Perdue M.H. Chronic psychological stress in rats induces intestinal sensitization to luminal antigens.Am J Pathol. 2006; 168 (quiz 363): 104-114Abstract Full Text Full Text PDF PubMed Scopus (143) Google Scholar Therefore, we inferred that ACC contributed to the pathogenesis of food allergy. To test this, we treated mice with ovalbumin (OVA, a specific antigen) and ACC or RCC (regular circadian clock). As shown in Fig 1, mice of the ACC group showed intestinal allergy like signs, including high serum levels of IL-4, IL-5, and IL-13 (Fig 1, A) and OVA-specific IgE (Fig 1, B), profound infiltration of mast cell and eosinophil in the intestinal mucosa (Fig 1, C), high frequency of OVA-specific CD4+ T-cell proliferation after exposure to the specific antigen OVA in the culture (Fig 1, D; see Fig E1 in this article's Online Repository at www.jacionline.org), and intestinal epithelial barrier dysfunction (Fig 1, E and F). None of the RC group mice developed food allergy (Fig 1, A-F). The results suggest that ACC facilitates the development of intestinal allergy. Previous studies suggest that the abnormality of Treg cells is associated with the pathogenesis of food allergy.4van Esch B.C. Schouten B. Blokhuis B.R. et al.Depletion of CD4+CD25+ T cells switches the whey-allergic response from immunoglobulin E- to immunoglobulin free light chain-dependent.Clin Exp Allergy. 2010; 40: 1414-1421Crossref PubMed Scopus (17) Google Scholar Because ACC facilitates the development of food allergy as shown in Fig 1, we inferred that ACC might interfere with Treg cells in the intestine. To test this, we assessed Treg cells in the mouse intestine after ACC. As analyzed by flow cytometry, about 9.94% of Treg cells were detected in CD4+ T cells in RCC mice whereas less (5.92%) Treg cells were detected in CD4+ T cells in ACC mice (see Fig E2 in this article's Online Repository at www.jacionline.org). The results suggest that ACC does reduce the Treg-cell population in the intestine, which may be one of the important factors in the development of food allergy that occurred after ACC. To test the inference, we adoptively transferred OVA-specific Treg cells to the ACC mice in the course of sensitization. Indeed, the ACC-facilitated food allergy in the mice was abolished (see Fig E3 in this article's Online Repository at www.jacionline.org). The aberrant expression in some of the circadian clock–related proteins is associated with the pathogenesis of immune disorders.5Erren T.C. Reiter R.J. Defining chronodisruption.J Pineal Res. 2009; 46: 245-247Crossref PubMed Scopus (166) Google Scholar On the basis of results of Fig E1, we reasoned that one or some of the circadian clock–related proteins interfered with the expression of Foxp3 in CD4+ T cells. Thus, after treating with ACC, we isolated CD4+ T cells from the mouse intestine; the cells were analyzed by chromatin immunoprecipitation assay. The results showed that among the tested molecules, nuclear factor IL-3 (NFIL-3) was uniquely high at the Foxp3 promoter locus in CD4+ T cells from ACC-treated mice, which did not occur in CD4+ T cells from RCC-treated mice (see Fig E4, A, in this article's Online Repository at www.jacionline.org). To elucidate whether such a phenomenon also occurred in humans, we analyzed peripheral CD4+ T cells from subjects after night shifts (ACC subjects). The results showed that before night shifts, mRNA levels of NFIL-3 in CD4+ T cells of ACC subjects were similar to mRNA levels of RCC subjects. After night shifts, the levels of NFIL-3 in CD4+ T cells were increased in a night-shift time-dependent manner, which returned to normal levels within 2 days after the night shifts (Fig E4, B). The NFIL-3 level was also increased at the Foxp3 promoter locus (Fig E4, C). Collectively, the data suggest that ACC increases NFIL-3 levels in peripheral CD4+ T cells; the NFIL-3 can bind to the Foxp3 promoter in CD4+ T cells. The above data implicate that NFIL-3 may modulate the expression of Foxp3 in CD4+ T cells. To corroborate the results, we overexpressed NFIL-3 in CD4+ T cells (see Fig E5, A, in this article's Online Repository at www.jacionline.org); the CD4+ T cells were transfected with a Foxp3 promoter luciferase reporter gene (Fig E5, B). The results showed that, after activation by anti-CD3/CD28 and TGF-β in the culture, the luciferase activity was significantly increased in the CD4+ T cells, which was abolished by the overexpression of NFIL-3 (Fig E5, C). The results suggest that NFIL-3 represses the expression of Foxp3 by CD4+ T cells. However, naive CD4+ CD25− T cells were overexpressed with NFIL-3 by transfecting with NFIL-3 plasmids (Fig E5, A). The cells were treated with the Foxp3 polarization condition and analyzed by flow cytometry. The results showed that about 71.4% Foxp3+ CD4+ T cells were induced, while almost no Foxp3+ CD4+ T cells were detected in the NFIL-3–overexpressing CD4+ T cells (Fig E5, D and E). In addition, a complex of Foxp3 and NFIL-3 was detected in the CD4+ T cells with NFIL-3 overexpression after the treatment of the Foxp3 polarization (Fig E5, F). The results indicate that NFIL-3 physically contacts Foxp3 to repress the expression of Foxp3 in CD4+ T cells. Because Foxp3 binds GATA3 to prevent the expression of IL-4,6Dardalhon V. Awasthi A. Kwon H. Galileos G. Gao W. Sobel R.A. et al.IL-4 inhibits TGF-beta-induced Foxp3+ T cells and, together with TGF-beta, generates IL-9+ IL-10+ Foxp3(−) effector T cells.Nat Immunol. 2008; 9: 1347-1355Crossref PubMed Scopus (886) Google Scholar after the ACC treatment, we assessed the expression of IL-4 in CD4+ T cells. The results showed that at the IL-4 promoter locus, the levels of p300, acetylated H3K4, Pol II, and GATA3 were significantly increased (see Fig E6, A-D, in this article's Online Repository at www.jacionline.org). The levels of IL-4 were also increased in the CD4+ T cells (Fig E6, E and F). The results suggest that ACC-induced NFIL-3 may be the most important factor to increase IL-4 expression in CD4+ T cells in ACC-treated mice. To test the inference, we treated NFIL-3–deficient mice with ACC. Indeed, the expression of IL-4 was not altered in CD4+ T cells (Fig E6). The ACC-treated NFIL-3–deficient mice did not show food allergy signs (see Fig E7 in this article's Online Repository at www.jacionline.org). Male BALB/c mice and OVA-TCR transgenic DO11.10 mice (6-8-week-old) were purchased from the Guangzhou Experimental Animal Center. The NFIL-3–deficient mice were provided by the Shanghai Research Center for Model Organisms (Shanghai, China). The mice were maintained in a pathogen-free environment with free access to food and water. The animal experimental procedures were approved by the Animal Ethic Committee at Shenzhen University. All the animal experiments were performed in accordance with the approved guidelines. The participation of human subjects in the present study was approved by the Human Ethic Committee at Zhengzhou University. An informed and written consent was obtained from each subject. The survey was carried out in the First Hospital, the Second Hospital, and the Fifth Hospital of Zhengzhou University between 2013 and 2014. The staff nurses with or without the regular day-/night-shift rotation (day shift and night shift were swapped at least once a week) were randomly (even numbers were selected; odd numbers were gave up) selected into this study. Subjects without the day-/night-shift rotation in their daily life were randomly selected from the outpatients of the 3 hospitals. The diagnosis of food allergy was performed by physicians of the Department of Gastroenterology on the basis of history of food allergy, positive results of skin test, and serum levels of food allergen specific IgE being greater than 0.35 IU/mL. Exclusion criteria were (1) subjects with allergic disorders before their nursing career, (2) subjects with autoimmune diseases, (3) subjects with cancer, (4) subjects using immunosuppressants, and (5) subjects with severe organ diseases. Skin prick test of fish, shell fish, milk, tree nuts, soy, fruit, sesame seed, wheat, egg, and peanut was performed for each subject controlled with both histamine phosphate (0.1%; positive control) and saline (negative control). The skin prick test was performed by applying a drop of the allergen extract on the skin of the volar aspect of the forearm. Skin reaction was evaluated 20 minutes later. The size of flare or wheal was measured. A flare or wheal of 3 mm greater than that with negative control was regarded as a positive result. Peripheral blood samples were collected from each human subject (20 mL/person) via ulnar vein puncture. Serum aliquots were sent to the laboratory without any patient identification. We performed allergen specific IgE detection using ImmunoCAP (Phadia, Uppsala, Sweden) according to the manufacturer's instructions. The specific IgE detection range of ImmunoCAP FEIA was 0.1 to 100 kU/L. Serum levels of cortisol and vitamin D were determined by ELISA with commercial reagent kits (Gudou Biotech, Shanghai, China) following the manufacturer's instructions. Height and weight were measured for each participant. Body mass index was calculated as body weight divided by height squared (kg/m2). Mice were treated with a 18-day schedule of ACC as reported by Yu et alE1Yu X. Rollins D. Ruhn K.A. Stubblefield J.J. Green C.B. Kashiwada M. et al.TH17 cell differentiation is regulated by the circadian clock.Science. 2013; 342: 727-730Crossref PubMed Scopus (274) Google Scholar or treated with RCC. The mice were provided a specific mouse food, in which OVA was added to the regular mouse food at a ratio of 1/100. Each mouse took about 0.5 to 1.0 mg OVA daily from day 0 to day 18. The mice of both groups ingested comparable amounts of food and therefore OVA. Naive controls mice were fed with regular mouse food (free of OVA). The mice were sacrificed on day 19 and subjected to the assessment of the allergy status in the intestine following our established procedures.E2Yang G. Geng X.R. Song J.P. Wu Y. Yan H. Zhan Z. et al.Insulin-like growth factor 2 enhances regulatory T-cell functions and suppresses food allergy in an experimental model.J Allergy Clin Immunol. 2014; 133: 1702-1708Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar The blood samples were collected from each mouse. The sera were isolated from the blood samples by centrifugation. The serum levels of IL-4, IL-5, IL-13, and OVA-specific IgE were determined by ELISA with commercial reagent kits (kits of IL-4, IL-5, and IL-13 were purchased from R&D Systems (Minneapolis, Minn); kit of OVA-specific IgE was purchased from Shuoheng Biotech, Guangzhou, China) following the manufacturer's instructions. A jejunal segment was excised from each mouse after sacrifice and fixed with 4% formalin overnight. The tissue was processed from paraffin sections. The sections were stained with 0.5% toluidine blue (for mast cell staining) or hematoxylin and eosin (for eosinophil staining). Mast cells and eosinophils were counted on 20 fields (×400) of each sample under a light microscope. The slides were coded. The observers were not aware of the code to avoid the observer bias. The small intestine was collected from each mouse at sacrifice. Lamina propria mononuclear cells were isolated from the intestinal tissue following our established procedures.E2Yang G. Geng X.R. Song J.P. Wu Y. Yan H. Zhan Z. et al.Insulin-like growth factor 2 enhances regulatory T-cell functions and suppresses food allergy in an experimental model.J Allergy Clin Immunol. 2014; 133: 1702-1708Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar CD4+ CD25− T cells and CD11c+ dendritic cells were isolated from the lamina propria mononuclear cells by magnetic cell sorting (MACS) with commercial reagent kits (Miltenyi Biotech, San Diego, Calif) following the manufactuer's instructions. The purity of the cells was greater than 95% as checked by flow cytometry. The CD4+ T cells (labeled with CFSE; carboxyfluorescein diacetate succinimidyl ester) and dendritic cells were cultured (at 105 cells:2 × 104 cells/well) in the presence of OVA (5 μg/mL) or BSA (5 μg/mL; control), phorbol 12-myristate 13-acetate (20 ng/mL), and ionomycin (1 μg/mL) for 3 days. The cells were analyzed with a flow cytometer. The permeability to a macromolecular tracer (horseradish peroxidase [HRP], MW = 44 kDa) of the jejunal epithelial layer was determined by Ussing chamber technique following our established proceduresE3Zheng P.Y. Feng B.S. Oluwole C. Struiksma S. Chen X. Li P. et al.Psychological stress induces eosinophils to produce corticotrophin releasing hormone in the intestine.Gut. 2009; 58: 1473-1479Crossref PubMed Scopus (88) Google Scholar and used as an indicator of the epithelial barrier function. Briefly, 4 adjacent pieces of the jejunum (2 cm each) were cut from each mouse (cut at 10 cm from the stomach) and mounted on Ussing chambers. The electrical current crossing the tissue (a measure of net ion transport) was determined in the voltage-clamp mode (0 V potential difference) and expressed as short-circuit current (Isc, in μA/cm2). To measure the permeability of the epithelial layers, HRP was added to the epithelial side chambers at 10 μmol/L. The serosal buffer was sampled at 30-minute intervals for 90 minutes. The concentration of intact HRP in the samples was determined by assaying enzyme activity using a modified Worthington method. Briefly, 150 μL of sample was added to 800 μL of phosphate buffer containing 0.003% H2O2 and 80 μg/mL o-dianisidine. Enzyme activity was determined from the rate of increase in OD at 460 nm. Fluxes were calculated according to standard formulae and were expressed as pmol/cm2/h. CD4+ CD25− T cells were isolated from the naive DO11.10 mouse spleen; the cells were cultured in RPMI1640 medium containing TGF-β (20 ng/mL), 10% FBS, 100 U/mL penicillin, 0.1 mg/mL streptomycin, and 2 mM l-glutamine for 6 days. The medium was changed on day 3. The CD4+ CD25+ CD127− T cells were isolated by MACS to be used as Treg cells in the cell culture experiments as well as the adoptive transfer in the mouse model. The Foxp3+ cells were greater than 98% as checked by flow cytometry. The viability of the cells was greater than 99% as checked by Trypan blue exclusion assay. Twenty nurses without food allergy were randomly recuited for this procedure. Before and immediately after the night shift, and 1 day after the shift, about 20 mL peripheral blood samples were drawn from the ulnar vein at each time point from each nurse. Mononuclear cells were isolated from the blood by the gradient density centrifugation. The cells were further isolated for CD4+ T cells by MACS with purchased reagent kits (Miltenyi Biotech) following the manufacturer's instructions. In the surface staining, cells were stained with fluorochrome-labeled antibodies (or isotype IgG) for 30 minutes at 4°C. In the intracellular staining, cells were fixed with 2% paraformaldehyde for 2 hours at room temperature, and then treated with 0.5% saponin for 30 minutes. The cells were incubated with fluorochrome-labeled antibodies (0.5 μg/mL, or isotype IgG) for 30 minutes at 4°C. The cells were analyzed with a flow cytometer (FACSCanto II, BD Biosciences, Franklin Lakes, NJ). The data were analyzed with the software Flow Jo (TreeStar, Ashland, Ore). Data of isotype IgG were used as the gating reference. Antibodies for flow cytometry were purchased from BD Biosciences. The total RNA was extracted from the cells with TRIzol reagent, and the first-strand cDNA was synthesized with a reverse transcription kit. The real-time PCR was performed using SYBR Green Master Mix on a real-time PCR device (MiniOpticon, Bio-Rad, Hercules, Calif). The sequences of the primers used in this study are presented in Table E1. The data were calculated by using the 2−ΔΔCt method. (Reagents for RT-quantitative PCR were purchased from Invitrogen, Carlsbad, Calif.) Cells were incubated with lysis buffer (10 mM HEPES, pH 7.4, 10 mM NaCl, 1.5 mM MgCl2, 0.5 mM dithiothreitol, 0.2% Nonidet P-40, and 0.2 mM phenylmethylsulfonyl fluoride) at 4°C for 15 minutes, and centrifuged at 500g for 10 minutes at 4°C. The supernatant was collected as the cytosolic extract. The pellet was added with nuclear extract buffer (20 mM HEPES-KOH, pH 7.9, 25% glycerol, 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM dithiothreitol, 0.2 mM phenylmethylsulfonyl fluoride, and 1× protease inhibitor cocktail) and incubated for 15 minutes at 4°C, followed by centrifugation at 13,000g for 10 minutes at 4°C. The supernatant was collected as the nuclear extract. The protein concentrations were determined by using the Bradford method. For the preclearing, the cellular extracts were incubated with protein-G beads (Sigma Aldrich, St Louis, Mo) for 2 hours at 4°C, and centrifuged for 2 minutes at 13,000 rpm at 4°C. The supernatant was incubated overnight with specific antibodies (or isotype IgG) and protein-G beads. The immunoprecipitates were collected and eluted with eluting buffer. The supernatant was then subjected to Western blotting. The total proteins were extracted from cells; the extracts were fractioned by SDS-PAGE and transferred onto a PVDF (polyvinylidene fluoride) membrane. After blocking with 5% skim milk for 30 minutes, the membrane was incubated with the primary antibodies (0.5 μg/mL, or isotype IgG) overnight at 4°C and followed by incubation with the secondary antibodies (labeled by peroxidase) for 1 hour at room temperature. The membrane was washed with TRIS-buffered saline with Tween between incubations. The immune blots on the membranes were developed by enhanced chemiluminescene. The results were photographed with a KODAK Image Station 4000Pro (KODAK, Shanghai, China). The antibodies used in Western blotting were purchased from Santa Cruz Biotech (Santa Cruz, Calif). Chromatin immunoprecipitation (ChIP) assays were performed using a ChIP kit (Sigma Aldrich) following the manufacturer's instructions. Briefly, CD4+ T-cell extracts were treated as indicated above and cross-linked with formaldehyde and sonication. Resulting cell lysates (input) were immunoprecipitated with respective antibodies (2.5 μg each, or isotype IgG). The precipitated protein-DNA complexes were subjected to proteinase (Sigma Aldrich) treatment. The primers used to confirm the binding of factors to the promoter region include Foxp3 (gcctggttgtgagaaggtct and gcttctccttttccagctcc) and IL-4 (aacgaggtcacaggagaagg and caggacagagaaagcatcgc). (The antibodies used in ChIP were purchased from Santa Cruz Biotech.) The NFIL-3 DNA vector was constructed by GeneScript (Nanjing, China). 2 × 105 CD4+ T cells were seeded in each well of a 24-well tissue culture plate 1 day before transfection. The equimolar amount of the NFIL-3 DNA vector was transfected into each well, according to the Lipofectamine 2000 Transfection Reagent manual from Invitrogen. The NFIL-3 expression in the CD4+ T cells was assessed by Western blotting. The data are presented as mean ± SD. The difference between groups was determined by t test, or ANOVA if more than 2 groups. In the case of a distribution different from normal, the Mann-Whitney U test was used. A correlation assay with the day-/night-shift rotation as 1, non–day-/night-shift rotation as 0, subjects with food allergy as 1, and subjects with non–food allergy as 0 was performed with Excel. P < .05 was set as a significant criterion.Fig E2ACC suppresses Treg cells in the intestine. A, The gated dot plots are CD4+ T cells of LPMCs. B and C, The gated dot plots are Treg cells. D, The bars (mean ± SD; *P < .01, compared with the RCC group) are the summarized data of Fig E2, B and C. Each group consists of 10 mice. Samples from individual mice were processed separately. LPMC, Lamina propria mononuclear cell; SSC, side-scattered light.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig E3Adoptive transfer with Treg cells suppresses ACC (altered circadian clock)-induced food allergy. The ACC mice were treated with Treg cells, or naive CD4+ T cells, at 106 cells/mouse via tail vein injection. The bars indicate the serum TH2 cytokine levels (A), serum specific IgE levels (B), intestinal epithelial barrier permeability (C), infiltration of mast cell/eosinophil in the intestinal mucosa (D), the frequency of antigen-specific CD4+ T cell in the intestinal mucosa (E) and the number of diarrhea mice after antigen challenge (F). The data of bars are presented as mean ± SD. *P < .01, compared with the saline group. Samples from individual mice were processed separately. Each group consists of 10 mice.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig E4ACC upregulates NFIL-3 expression in CD4+ T cells. A, The bars indicate the NFIL-3 promoter binding rate by ACC molecules in mice treated with ACC. B and C, The bars indicate the NFIL-3 mRNA (Fig E4, B) and NFIL-3 binding to Foxp3 promoter in peripheral B cells of subjects engaging day-/night-shift rotation. *P < .01, compared with the RCC group (Fig E4, A), or the “Before” group (Fig E4, B and C). Samples from the individual subjects were analyzed separately.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig E5NFIL-3 represses Foxp3 expression in CD4+ T cells. A, Medium: CD4+ T cells were cultured with medium alone. NFIL-3 plasmid or control plasmid: CD4+ T cells were transfected with NFIL-3-expression plasmids or control plasmids. B, Sketch of Foxp3 promoter reporter construct. C, The bars indicate the Foxp3 gene activity. D, The gated cells indicate the frequency of Foxp3+ T cells. E, The bars show the summarized data of panel D. F, The immune blots indicate an immune complex of Foxp3 and NFIL3. The data of bars are presented as mean ± SD. *P < .001, compared with the medium group. The data represent 3 independent experiments. Ab, Antibody; SSC, side scattered light.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig E6ACC-induced NFIL-3 increases IL-4 expression in CD4+ T cells. #NFIL-3–deficient mice. The bars of (A-D) indicate the levels of p300, acetylated H3K4, Pol II, and GATA3 at the IL-4 promoter locus. E, The bars indicate the IL-4 mRNA levels in CD4+ T cells. F, The immune blots indicate the protein levels of IL-4 in CD4+ T cells. The data of bars are presented as mean ± SD. *P < .001, compared with the medium group RCC (regular circadian clock). The data represent 3 independent experiments.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig E7Deficiency of NFIL-3 abolishes ACC-induced food allergy in mice. Wild and NFIL-3-deficient mice were sensitized and sacrificed next day after the last antigen challenge. A and B, The bars indicate the serum levels of TH2 cytokines (A) and antigen-specific IgE (B). C, The bars indicate the frequency of mast cell/eosinophil in the intestinal mucosa. D-G, The flow cytometry histograms indicate the frequency of antigen-specific CD4+ T cells in the intestinal mucosa. H, The bars indicate the summarized data of D-G. I-J, The bars indicate the intestinal epithelial barrier function. The data of bars are presented as mean ± SD. *P < .01, compared with the RCC group. Samples from individual mice were processed separately. Each group consists of 10 mice. NFIL-3d, NFIL-3–deficient.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Table E1Primers used in this studyMoleculeForwardReverseHDAC1gatgaggagggagaaggtggaacttggggagaagatggggFoxp3cctccactccacctaaagcaccttgttttgcgctgagagtNFIL-3agcagaaccacgataacccaatcttgtctgagctgctggtβ-Actingtgggaatgggtcagaaggatcatcttttcacggttggcc Open table in a new tab