An atypical CRISPR-Cas locus in Symbiobacterium thermophilum flanked by a transposase, a reverse transcriptase, the endonuclease MutS2 and a putative Cas9-like protein

Sandeep Chakraborty
DOI: https://doi.org/10.1101/252296
2018-01-27
Abstract:Abstract Clustered regularly interspaced short palindromic repeats (CRISPR) is a prokaryotic adaptive defense system that assimilates short sequences of invading genomes (spacers) within repeats, and uses nearby effector proteins (Cas), one of which is an endonuclease (Cas9), to cleave homologous nucleic acid during future infections from the same or closely related organisms. Here, a novel CRISPR locus with uncharacterized Cas proteins, is reported in Symbiobacterium thermophilum (Accid:NC 006177.1) around loc.1248561. Credence to this assertion is provided by four arguments. First, the presence of an exact repeat (CACGTGGGGTTCGGGTCGGACTG, 23 nucleotides) occurs eight times encompassing fragments about 83 nucleotides long. Second, comparison to a known CRISPR-Cas locus in the same organism (loc.355482) with an endonuclease Cas3 (WP 011194444.1, 729 aa) ∼10000 nt upstream shows the presence of a known MutS2 endonuclease (WP 011195247.1, 801 aa) in approximately the same distance in loc.1248561. Thirdly, and remarkably, an uncharacterized protein (1357 aa) long is uncannily close in length to known Cas9 proteins (1368 for Streptococcus pyogenes ). Lastly, the presence of transposases and reverse transcriptase (RT) downstream of the repeat indicates this is one of an enigmatic RT-CRISPR locus, Also, the MutS2 endonuclease is not characterized as a CRISPR-endonuclease to the best of my knowledge. Interestingly, this locus was not among the four loci (three confirmed, one probable) reported by crisperfinder ( http://crispr.i2bc.paris-saclay.fr/Server ), indicating that the search algorithm needs to be revisited. This finding begs the question ‐ how many such CRISPR-Cas loci and Cas9-like proteins lie undiscovered within bacterial genomes?
What problem does this paper attempt to address?