Genotyping SNP Rs12255372 TCF7L2 Gene Using Three-Primer ARMS-PCR for Detection T2DM n Indonesian Batak Ethnic

Syamsurizal,H Kadri
DOI: https://doi.org/10.1088/1742-6596/1040/1/012003
2018-06-04
Journal of Physics: Conference Series
Abstract:Genetic markers may indicate the increasing of individuals' susceptibility towards type 2 diabetes mellitus. The purpose of this research is to construct a primary SNP rs12255372 variant TGCCCAGGAATAAGGCAAGAATTCC (G/T) ATACCATATTCTGAATTACTCAGGC in the TCF7L2 gene and to determine the primary ability to detect polymorphisms of SNP rs12255372 variant TCF7L2 gene as a genetic marker. A case control study was used as the research method. Samples (62 people) were taken from the people of Batak ethnic with diabetes mellitus type 2 who came to the Metabolic Endocrinology clinic of Dr. M. Djamil Hospital. Controls were taken from healthy people without type 2 diabetes mellitus (62 people). EDTA blood was taken for DNA extraction. Polymorphisms of SNP rs12255372 in the TCF7L2 gene were detected by using three primer ARMS-PCR method and direct DNA sequencing method, and then were Analysed by bioinformatics. Based on the data analysis, it can be concluded that it has successfully constructed three primers ie RS12F forward primer, reverse primer and forward primer RS12R RS12C. All constructed primers are able to recognize SNP rs12255372 in TCF7L2 gene with three primer ARMS-PCR method, however, the SNP rs12255372 is genetic markers of type 2 diabetes mellitus for the Indonesian Batak ethnic.
What problem does this paper attempt to address?