Abstract:Onions ( Allium cepa L.) are the leading vegetable crop in Georgia accounting for 13.7% of total state vegetable production ( Wolfe and Stubbs, 2017 ). In November 2017, two samples each of onion (var. Candy Ann) seedlings and soil were received from the University of Georgia Cooperative Extension office in Tattnall County, GA. The samples were collected from a nursery fumigated with metam sodium and used for sweet onion transplant production. Symptoms of the damaged plants included stunted growth both in the root system and foliage, tip die-back of the leaves ( Fig. 1A,B ), and slight swelling at the tip of roots. Vermiform life stages from the soil samples were extracted using centrifugal-flotation technique ( Jenkins, 1964 ). On an average, 67 stubby-root nematodes per 100 cm 3 of soil were obtained. Additional two soil samples were collected from the nursery in December 2017 to confirm the presence of the nematode. On an average, 1 and 75 nematodes per 100 cm 3 of soil were recovered from areas with healthy and infested plants, respectively. Because the male individuals were not found in the soil samples, females were used for species identification. Morphological and molecular analyses of females ( Fig. 2A-C ) identified the species as Paratrichodorus minor (Colbran) Siddiqi; ( Decraemer, 1995 ). Nematode body shape was "cigar-shaped" with dorsally curved "onchiostyle" stylet Females had an oval-shaped vagina, vulva a transverse slit, and lateral body pores were absent. The measurements of females ( n = 20) included: body length 671.1 (570.1-785.3) µm; body width 32.5 (27.8-37.0) µm; onchiostyle 32.5 (31.1-34.8) µm; anterior end to esophagus-intestinal valve 117.6 (101.2-128.5) µm; a 21.5 (15.3-28.1) µm; b 5.2 (4.9-6.3) µm; V 52.9% (48.1-55.4%) µm; and vagina length 8.7 (7.8-10.7) µm. To confirm the identity of P. minor, DNA was extracted from single females ( n = 3) using Extract-N-Amp ™ Tissue PCR Kit (Sigma-Alredich Inc., St. Louis, MO). The partial 18S rRNA, the D2-D3 expansion segments of 28S rRNA, and ITS1 rDNA were amplified using primer pairs 360F (5' CTACCACATCCAAGGAAGGC 3')/932R (5' TATCTGATCGCTGTCGAACC 3'), D2A (5' ACAAGTACCGTGAGGGAAAGTTG 3')/D3B (5' TCGGAAGGAACCAGCTACTA 3'), and BL18 (5' CCCGTCGCTACTACCGATT 3')/5818 (5' ACGARCCGAGTGATCCAC 3'), respectively ( Riga et al., 2007 ; Duarte et al., 2010 ; Ye et al., 2015 ; Shaver et al., 2016 ). The obtained PCR fragments were purified using QIAquick Gel Extraction Kit (Qiagen Inc., Santa Clara, CA, USA), sequenced and deposited in the GenBank databases (18S rRNA: MG856931; 28S rRNA: MG856933; ITS1 rDNA: MH464152). The 18S rRNA, 28S D2-D3, and ITS1 rDNA sequences shared 99% similarity (100% coverage) with GenBank accessions of P. minor from California, Arkansas, and China (18S rRNA: JN123365; 28S D2-D3: JN123395; ITS1 rDNA: GU645811). In a pathogenicity test, five sweet onion seeds var. Pirate were planted (one per pot) in 11.5-cm-diameter polyethylene pots containing 1,000 cm 3 of equal parts of pasteurized field soil and sand, and then inoculated with 1,000 fresh P. minor . Plants were grown for 9 wk in a greenhouse at 25 ± 2°C prior to extraction of nematodes from soil. Plant roots were abbreviated and final population density of P. minor was 2,856 ± 104 per pot (285 nematodes/100 cm 3 of soil) confirming the nematode parasitism on onion. To our knowledge, this is the first report of P. minor parasitizing onion in Georgia. Stubby-root nematode ( Paratrichodorus sp.) has already been reported on corn, St. Augustine grass, and switchgrass in Georgia ( Heald and Perry, 1969 ; Davis and Timper, 2000 ; Mekete et al., 2011 ). In the U.S.A, P. minor is known to occur on diverse crops in most of the states ( Decraemer, 1995 ; CABI/EPPO, 2002 ). A survey of vegetable-producing areas in Georgia is currently under investigation to determine the distribution of this economically important nematode species. Figure 1Damage symptoms caused by stubby-root nematode Paratrichodorus minor on sweet onion in Georgia. A large area of stunted and chlorotic plant foliage (A); Infested seedlings with abbreviated roots and necrotic leaf tips (B). Figure 2Light microscopy micrographs showing morphological characters of stubby-root nematode, Paratrichodorus minor. Entire body (A), anterior end (B), and posterior region (C) of female nematode.

Occurrence and abundance of nematodes on onion in Turkey and their relationship with soil physicochemical properties

Türkiye'de İzmir, Manisa, Balıkesir ve Çanakkale illerinde zeytin alanlarındaki nematodların komünite yapısı

Occurrence, distribution and species characteristics of cyst nematode on wheat in central and South region of Shanxi, China

Comparative analysis of soil nematode biodiversity from five different fruit orchards in Osmaneli district, Bilecik, Türkiye

Association of Plant-Parasitic Nematodes and Soil Physicochemical Properties in Tomatoes in Turfloop, Limpopo Province, South Africa

Preliminary Assessment of the Occurrence of Longidorid and Trichodorid Nematodes (nematoda : Longidoridae and Trichodoridae) in Xiamen, Fujian Province, China

Effect of organic, conventional and mixed cultivation practices on soil microbial community structure and nematode abundance in a cultivated onion crop

Onion (Allium cepa L.) as a new host for ' Candidatus Arsenophonus phytopathogenicus' in Germany

Diversity and incidence of plant-parasitic nematodes associated with saffron (Crocus sativus L.) in Morocco and their relationship with soil physicochemical properties

Investigation on the population dynamics of Helicotylenchus pseudorobustus and its relationship with soil factors in tomato fields

Microfungi in cultivated fields in Eskişehir provience (Turkey)

Drought and salt stress effects on biochemical changes and gene expression of photosystem II and catalase genes in selected onion cultivars

First Report of Stubby-Root Nematode, Paratrichodorus minor, on Onion in Georgia, U.S.A

Enset (Ensete ventricosum) landraces associated parasitic nematodes and their relationship with Xanthomonas wilt disease in Gurage, Ethiopia

Occurrence and distribution of vermiform plant-parasitic nematodes and the relationship with soil factors in field pea (Pisum sativum) in North Dakota, USA

Biodiversity and Selected Soil Parameters Analysis of Soil Inhabited Nematodes Associated with Different Crops of Upper Gangetic Plains, India

Effect of nitrogen fertilization levels and plant density on dry weight, yield components and bulb quality of onion plant

Variations in Total Phenolic, Total Flavonoid Contents, and Free Radicals' Scavenging Potential of Onion Varieties Planted under Diverse Environmental Conditions

Occurrence and Geographic Distribution of Plant-Parasitic Nematodes Associated with Citrus in Morocco and Their Interaction with Soil Patterns

Entomopathogenic Nematodes for Field Control of Onion Maggot (Delia antiqua) and Compatibility with Seed Treatments

Seasonal fluctuations in plant-parasitic nematode vertical distributions and their interactions with edaphic factors in vegetable fields of South Georgia, USA