Abstract:Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung's disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung's disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung's disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype-phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30∗), c.207_8 delCG (p.Cys71Hisfs∗62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs∗42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155_1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs∗117). All pathogenic variants were de novo. The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype-phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10-related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations.

Novel pathogenic genomic variants leading to autosomal dominant and recessive Robinow syndrome

Robinow Syndrome DVL1 variants disrupt morphogenesis and appendage formation in a Drosophila disease model

Craniofacial studies in chicken embryos confirm the pathogenicity of Frizzled2 variants associated with Robinow syndrome

variants and C-terminal deletions have differential effects on craniofacial development and WNT signaling

Prenatal diagnosis of ROR‐2 related Robinow syndrome presenting with fetal ultrasound findings of mesomelia, vertebral, digital and genital abnormalities

A novel single-base deletion in ROR2 causes atypical brachydactyly type B1 with cutaneous syndactyly in a large Chinese family

ROR2-Related Skeletal Dysplasia Reveals Disrupted Chondrocyte Polarity through Modulation of BMP/TGF-β Signaling

De novo variants implicate chromatin modification, transcriptional regulation, and retinoic acid signaling in syndromic craniosynostosis

A Novel ZRS Variant Causes Preaxial Polydactyly Type I by Increased Sonic Hedgehog Expression in the Developing Limb Bud

Novel dominant and recessive variants in human ROBO1 cause distinct neurodevelopmental defects through different mechanisms

Genetic, morphological and electrophysiological findings in a patient with a rare pathogenic variant in the RS1 gene

Biallelic Variants in RNU12 Cause CDAGS Syndrome

Novel compound heterozygous variants in ARL13B lead to Joubert syndrome

Pathogenic Variants in TNRC6B Cause a Genetic Disorder Characterised by Developmental Delay/intellectual Disability and a Spectrum of Neurobehavioural Phenotypes Including Autism and ADHD.

Loss-of-function variants in ERF are associated with a Noonan syndrome-like phenotype with or without craniosynostosis

A Novel de Novo Variant in 5′ UTR of the NIPBL Associated with Cornelia de Lange Syndrome

Clinical and neurogenetic characterisation of autosomal recessive RBL2-associated progressive neurodevelopmental disorder

Clinical Features of X Linked Juvenile Retinoschisis in Chinese Families Associated with Novel Mutations in the RS1 Gene.

Novel Compound Heterozygous Variants in MKS1 Leading to Joubert Syndrome

Novel likely pathogenic variant in the EYA1 gene causing Branchio oto renal syndrome and the exploration of pathogenic mechanisms

Novel SOX10 Mutations in Waardenburg Syndrome: Functional Characterization and Genotype-Phenotype Analysis