Attenuated Free Cholesterol Loading-induced Apoptosis but Preserved Phospholipid Composition of Peritoneal Macrophages from Mice That Do Not Express Group VIA Phospholipase A2
Shunzhong Bao,Yankun Li,Xiaoyong Lei,Mary Wohltmann,Wu Jin,Alan Bohrer,Clay F. Semenkovich,Sasanka Ramanadham,Ira Tabas,John Turk
DOI: https://doi.org/10.1074/jbc.m701316200
IF: 5.485
2007-01-01
Journal of Biological Chemistry
Abstract:Mouse macrophages undergo ER stress and apoptosis upon free cholesterol loading (FCL). We recently generated iPLA2β-null mice, and here we demonstrate that iPLA2β-null macrophages have reduced sensitivity to FCL-induced apoptosis, although they and wild-type (WT) cells exhibit similar increases in the transcriptional regulator CHOP. iPLA2β-null macrophages are also less sensitive to apoptosis induced by the sarcoplasmic reticulum Ca2+-ATPase inhibitor thapsigargin and the scavenger receptor A ligand fucoidan, and restoring iPLA2βexpression with recombinant adenovirus increases apoptosis toward WT levels. WT and iPLA2β-null macrophages incorporate [3H]arachidonic acid ([3H]AA]) into glycerophosphocholine lipids equally rapidly and exhibit identical zymosan-induced, cPLA2α-catalyzed [3H]AA release. In contrast, although WT macrophages exhibit robust [3H]AA release upon FCL, this is attenuated in iPLA2β-null macrophages and increases toward WT levels upon restoring iPLA2β expression. Recent reports indicate that iPLA2β modulates mitochondrial cytochrome c release, and we find that thapsigargin and fucoidan induce mitochondrial phospholipid loss and cytochrome c release into WT macrophage cytosol and that these events are blunted in iPLA2β-null cells. Immunoblotting studies indicate that iPLA2β associates with mitochondria in macrophages subjected to ER stress. AA incorporation into glycerophosphocholine lipids is unimpaired in iPLA2β-null macrophages upon electrospray ionization-tandem mass spectrometry analyses, and their complex lipid composition is similar to WT cells. These findings suggest that iPLA2β participates in ER stress-induced macrophage apoptosis caused by FCL or thapsigargin but that deletion of iPLA2β does not impair macrophage arachidonate incorporation or phospholipid composition. Mouse macrophages undergo ER stress and apoptosis upon free cholesterol loading (FCL). We recently generated iPLA2β-null mice, and here we demonstrate that iPLA2β-null macrophages have reduced sensitivity to FCL-induced apoptosis, although they and wild-type (WT) cells exhibit similar increases in the transcriptional regulator CHOP. iPLA2β-null macrophages are also less sensitive to apoptosis induced by the sarcoplasmic reticulum Ca2+-ATPase inhibitor thapsigargin and the scavenger receptor A ligand fucoidan, and restoring iPLA2βexpression with recombinant adenovirus increases apoptosis toward WT levels. WT and iPLA2β-null macrophages incorporate [3H]arachidonic acid ([3H]AA]) into glycerophosphocholine lipids equally rapidly and exhibit identical zymosan-induced, cPLA2α-catalyzed [3H]AA release. In contrast, although WT macrophages exhibit robust [3H]AA release upon FCL, this is attenuated in iPLA2β-null macrophages and increases toward WT levels upon restoring iPLA2β expression. Recent reports indicate that iPLA2β modulates mitochondrial cytochrome c release, and we find that thapsigargin and fucoidan induce mitochondrial phospholipid loss and cytochrome c release into WT macrophage cytosol and that these events are blunted in iPLA2β-null cells. Immunoblotting studies indicate that iPLA2β associates with mitochondria in macrophages subjected to ER stress. AA incorporation into glycerophosphocholine lipids is unimpaired in iPLA2β-null macrophages upon electrospray ionization-tandem mass spectrometry analyses, and their complex lipid composition is similar to WT cells. These findings suggest that iPLA2β participates in ER stress-induced macrophage apoptosis caused by FCL or thapsigargin but that deletion of iPLA2β does not impair macrophage arachidonate incorporation or phospholipid composition. Phospholipases A2 (PLA2) 2The abbreviations used are:PLA2phospholipase A2BELbromoenol lactone suicide substrateCADcollisionally activated dissociationESIelectrospray ionizationGPCglycerophosphocholineiPLA2βgroup VIA phospholipase A2LPClysophosphatidylcholineMSmass spectrometryMS/MStandem MSPAFplatelet-activating factorPCphosphatidylcholineRTreverse transcriptaseWTwild typeERendoplasmic reticulumSERCAsarcoplasmic reticulum Ca2+-ATPasePBSphosphate-buffered salineBSAbovine serum albuminAAarachidonic acidAc-LDLacetyl-low density lipoproteinACATacyl-CoA:cholesterol O-acyltransferaseJNKc-Jun NH2-terminal kinaseSRAscavenger receptor AsPLA2secretory PLA2cPLA2cytosolic PLA2KOknock out. catalyze hydrolysis of the sn-2 fatty acid substituent from glycerophospholipid substrates to yield a free fatty acid, e.g. arachidonic acid, and a 2-lysophospholipid (1Six D.A. Dennis E.A. Biochim. Biophys. Acta. 2000; 1488: 1-19Crossref PubMed Scopus (1161) Google Scholar, 2Ma Z. Turk J. Prog. Nucleic Acids Res. Mol. Biol. 2001; 67: 1-33Crossref PubMed Google Scholar) that have intrinsic mediator functions (3Brash A.R. J. Clin. Investig. 2001; 107: 1339-1345Crossref PubMed Google Scholar, 4Radu C.G. Yang L.V. Riedinger M. Au M. Witte O.N. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 245-250Crossref PubMed Scopus (147) Google Scholar) and can initiate synthesis of other mediators, such as prostaglandins, leukotrienes, epoxy-eicosatrienoates, and platelet-activating factor (PAF) (5Murphy R.C. Sala A. Methods Enzymol. 1990; 187: 90-98Crossref PubMed Google Scholar). Mammalian PLA2s include the PAF-acetylhydrolase PLA2 family, which exhibits substrate specificity for PAF and oxidized phospholipids, and the secretory PLA2 (sPLA2), which are low molecular weight enzymes that require millimolar concentrations of [Ca2+] for catalysis and affect inflammation and other processes (1Six D.A. Dennis E.A. Biochim. Biophys. Acta. 2000; 1488: 1-19Crossref PubMed Scopus (1161) Google Scholar). Of the group IV cytosolic PLA2 (cPLA2) family members (1Six D.A. Dennis E.A. Biochim. Biophys. Acta. 2000; 1488: 1-19Crossref PubMed Scopus (1161) Google Scholar), cPLA2α was the first identified and prefers substrates with sn-2 arachidonoyl residues, associates with its substrates in membranes when cytosolic [Ca2+] rises, and is also regulated by phosphorylation (6Gijon M.A. Spencer D.M. Kaiser A.L. Leslie C.C. J. Cell Biol. 1999; 145: 1219-1232Crossref PubMed Scopus (178) Google Scholar). Additional cPLA2 family members are encoded by separate genes (7Underwood K.W. Song C. Kriz R.W. Chang X.J. Knopf J.L. Lin L-L. J. Biol. Chem. 1998; 273: 21926-21932Abstract Full Text Full Text PDF PubMed Scopus (193) Google Scholar, 8Pickard R.T. Strifler B.A. Kramer R.M. Sharp J.D. J. Biol. Chem. 1999; 274: 8823-8831Abstract Full Text Full Text PDF PubMed Scopus (176) Google Scholar, 9Song C. Chang X.J. Bean K.M. Proia M.S. Knopf J.L. Kriz R.W. J. Biol. Chem. 1999; 274: 17063-17067Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar, 10Ohto T. Uozumi N. Hirabayashi T. Shimizu T. J. Biol. Chem. 2005; 280: 24576-24583Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar). phospholipase A2 bromoenol lactone suicide substrate collisionally activated dissociation electrospray ionization glycerophosphocholine group VIA phospholipase A2 lysophosphatidylcholine mass spectrometry tandem MS platelet-activating factor phosphatidylcholine reverse transcriptase wild type endoplasmic reticulum sarcoplasmic reticulum Ca2+-ATPase phosphate-buffered saline bovine serum albumin arachidonic acid acetyl-low density lipoprotein acyl-CoA:cholesterol O-acyltransferase c-Jun NH2-terminal kinase scavenger receptor A secretory PLA2 cytosolic PLA2 knock out Group VI PLA2 (iPLA2) enzymes (11Tang J. Kriz R.W. Wolfman N. Shaffer M. Seehra J. Jones S.S. J. Biol. Chem. 1997; 272: 8567-8575Abstract Full Text Full Text PDF PubMed Scopus (265) Google Scholar, 12Balboa M.A. Balsinde J. Jones S.S. Dennis E.A. J. Biol. Chem. 1997; 272: 8576-8580Abstract Full Text Full Text PDF PubMed Scopus (139) Google Scholar, 13Ma Z. Ramanadham S. Kempe K. Chi X.S. Ladenson J. Turk J. J. Biol. Chem. 1997; 272: 11118-11127Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar) do not require Ca2+ for catalysis and are inhibited by a bromoenol lactone (BEL) suicide substrate (14Hazen S.L. Zupan L.A. Weiss R.H. Getman D.P. Gross R.W. J. Biol. Chem. 1991; 266: 7227-7232Abstract Full Text PDF PubMed Google Scholar) that does not inhibit sPLA2 or cPLA2 at similar concentrations (14Hazen S.L. Zupan L.A. Weiss R.H. Getman D.P. Gross R.W. J. Biol. Chem. 1991; 266: 7227-7232Abstract Full Text PDF PubMed Google Scholar, 15Balsinde J. Dennis E.A. J. Biol. Chem. 1997; 272: 16069-16072Abstract Full Text Full Text PDF PubMed Scopus (279) Google Scholar, 16Ma Z. Ramanadham S. Hu Z. Turk J. Biochim. Biophys. Acta. 1998; 1391: 384-400Crossref PubMed Scopus (42) Google Scholar, 17Balsinde J. Dennis E.A. J. Biol. Chem. 1996; 271: 6758-6765Abstract Full Text Full Text PDF PubMed Scopus (337) Google Scholar). Group VIA PLA2 (iPLA2β) resides in the cytoplasm of resting cells and undergoes subcellular redistribution upon cellular stimulation (2Ma Z. Turk J. Prog. Nucleic Acids Res. Mol. Biol. 2001; 67: 1-33Crossref PubMed Google Scholar). Group VIB PLA2 (iPLA2γ) contains a peroxisomal targeting sequence and is membrane-associated (18Mancuso D.J. Jenkins C.M. Gross R.W. J. Biol. Chem. 2000; 275: 9937-9945Abstract Full Text Full Text PDF PubMed Scopus (175) Google Scholar, 19Tanaka H. Takeya R. Sumimoto H. Biochem. Biophys. Res. Commun. 2000; 272: 320-326Crossref PubMed Scopus (76) Google Scholar). These enzymes belong to a larger class of serine lipases encoded by several genes (20van Tienhoven M. Atkins J. Li Y. Glynn P. J. Biol. Chem. 2002; 277: 20942-20948Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar, 21Jenkins C.M. Mancuso D.J. Yan W. Sims H.F. Gibson B. Gross R.W. J. Biol. Chem. 2004; 279: 48968-48975Abstract Full Text Full Text PDF PubMed Scopus (622) Google Scholar). The iPLA2β enzymes are 84–88-kDa proteins that contain a GXSXG lipase consensus sequence and 7 or 8 stretches of a repetitive motif homologous to that of the ankyrin protein-binding domain (11Tang J. Kriz R.W. Wolfman N. Shaffer M. Seehra J. Jones S.S. J. Biol. Chem. 1997; 272: 8567-8575Abstract Full Text Full Text PDF PubMed Scopus (265) Google Scholar, 12Balboa M.A. Balsinde J. Jones S.S. Dennis E.A. J. Biol. Chem. 1997; 272: 8576-8580Abstract Full Text Full Text PDF PubMed Scopus (139) Google Scholar, 13Ma Z. Ramanadham S. Kempe K. Chi X.S. Ladenson J. Turk J. J. Biol. Chem. 1997; 272: 11118-11127Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar). In murine P388D1 macrophage-like cells iPLA2β is proposed to generate lysophosphatidylcholine (LPC) acceptors for arachidonic acid incorporation into phosphatidylcholine (PC), based on studies with BEL or an antisense oligonucleotide that reduces iPLA2 expression (22Balsinde J. Biochem. J. 2002; 364: 695-702Crossref PubMed Scopus (70) Google Scholar, 23Balsinde J. Balboa M.A. Cell. Signal. 2005; 17: 1052-1062Crossref PubMed Scopus (170) Google Scholar, 24Balsinde J. Bianco I.D. Ackermann E.J. Conde-Frieboes K. Dennis E.A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 8527-8531Crossref PubMed Scopus (251) Google Scholar, 25Balsinde J. Balboa M.A. Dennis E.A. J. Biol. Chem. 1997; 272: 29317-29321Abstract Full Text Full Text PDF PubMed Scopus (192) Google Scholar). It has also been proposed that iPLA2β cooperates with CTP:phosphocholine cytidylyltransferase (26Baburina I. Jackowski S. J. Biol. Chem. 1999; 274: 9400-9408Abstract Full Text Full Text PDF PubMed Scopus (158) Google Scholar, 27Barbour S.E. Kapur A. Deal C.L. Biochim. Biophys. Acta. 1999; 1439: 77-88Crossref PubMed Scopus (72) Google Scholar), which catalyzes the rate-limiting step in PC synthesis, to maintain PC homeostasis by degrading excess PC, based on studies with BEL in cells that overexpress CTP:phosphocholine cytidylyltransferase (26Baburina I. Jackowski S. J. Biol. Chem. 1999; 274: 9400-9408Abstract Full Text Full Text PDF PubMed Scopus (158) Google Scholar, 27Barbour S.E. Kapur A. Deal C.L. Biochim. Biophys. Acta. 1999; 1439: 77-88Crossref PubMed Scopus (72) Google Scholar). Many other iPLA2β functions have been proposed (28Akiba S. Mizunaga S. Kume K. Hayama M. Sato T. J. Biol. Chem. 1999; 274: 19906-19912Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar, 29Atsumi G. Murakami M. Kojima K. Hadano A. Tajima M. Kudo I. J. Biol. Chem. 2000; 275: 18248-18258Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar, 30Jenkins C.M. Han X. Mancuso D.J. Gross R.W. J. Biol. Chem. 2002; 277: 32807-32814Abstract Full Text Full Text PDF PubMed Scopus (155) Google Scholar, 31Seegers H.C. Gross R.W. Boyle W.A. J. Pharmacol. Exp. Ther. 2002; 302: 918-923Crossref PubMed Scopus (23) Google Scholar, 32Perez R. Melero R. Balboa M.A. Balsinde J. J. Biol. Chem. 2004; 279: 40385-40391Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar, 33Yellaturu C.R. Rao G.N. J. Biol. Chem. 2003; 278: 43831-43837Abstract Full Text Full Text PDF PubMed Scopus (43) Google Scholar, 34Smani T. Zakharov S.I. Csutora P. Leno E. Trepakova E.S. Bolotina V.M. Nat. Cell Biol. 2004; 6: 113-120Crossref PubMed Scopus (232) Google Scholar, 35Martinson B.D. Albert C.J. Corbett J.A. Wysolmerski R.B. Ford D.A. J. Lipid Res. 2003; 44: 1686-1691Abstract Full Text Full Text PDF PubMed Scopus (22) Google Scholar, 36Moran J.M. Buller R.M. McHowat J. Turk J. Wohltmann M. Gross R.W. Corbett J.A. J. Biol. Chem. 2005; 280: 28162-28168Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar, 37Guo Z. Su W. Ma Z. Smith G.M. Gong M.C. J. Biol. Chem. 2003; 278: 1856-1863Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar, 38Balboa M.A. Saez Y. Balsinde J. J. Immunol. 2003; 170: 5276-5280Crossref PubMed Scopus (54) Google Scholar, 39Song K. Zhang X. Zhao C. Ang N.T. Ma Z.A. Mol. Endocrinol. 2005; 19: 504-515Crossref PubMed Scopus (46) Google Scholar, 40Larsson Forsell P.K. Kennedy B.P. Claesson H.E. Eur. J. Biochem. 1999; 262: 575-585Crossref PubMed Scopus (111) Google Scholar, 41Ma Z. Wang X. Nowatzke W. Ramanadham S. Turk J. J. Biol. Chem. 1999; 274: 9607-9616Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar), including a role for apoptosis in human U937 promonocytes induced by anti-Fas antibody (42Atsumi G. Tajima M. Hadano A. Nakatani Y. Murakami M. Kudo I. J. Biol. Chem. 1998; 273: 13870-13877Abstract Full Text Full Text PDF PubMed Scopus (195) Google Scholar). Hydrolysis of arachidonic acid from U937 phospholipids induced by such antibodies is inhibited by BEL (42Atsumi G. Tajima M. Hadano A. Nakatani Y. Murakami M. Kudo I. J. Biol. Chem. 1998; 273: 13870-13877Abstract Full Text Full Text PDF PubMed Scopus (195) Google Scholar), and U937 cell apoptosis is associated with cleavage of iPLA2β by caspase-3 (29Atsumi G. Murakami M. Kojima K. Hadano A. Tajima M. Kudo I. J. Biol. Chem. 2000; 275: 18248-18258Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar), a central protease in executing apoptosis. Overexpressing this iPLA2β cleavage product amplifies both thapsigargin-induced arachidonate release and cell death (29Atsumi G. Murakami M. Kojima K. Hadano A. Tajima M. Kudo I. J. Biol. Chem. 2000; 275: 18248-18258Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar). Thapsigargin is a SERCA inhibitor (43Thastrup O. Cullen P.J. Drobak B.K. Hanley M.R. Dawson A.P. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 2466-2470Crossref PubMed Google Scholar) and induces loss of ER Ca2+ stores and apoptosis in many cells by ER stress pathways. Thapsigargin-induced apoptosis of pancreatic islet β-cells and insulinoma cells requires hydrolysis of arachidonic acid from membrane phospholipids and generation of arachidonate metabolites (44Zhou Y-P. Teng D. Dralyuk F. Ostrega D. Roe M.W. Philipson L. Polonsky K. J. Clin. Investig. 1998; 101: 1623-1632Crossref PubMed Google Scholar) by a Ca2+-independent mechanism that is suppressed by BEL (45Nowatzke W. Ramanadham S. Ma Z. Hsu F-F. Bohrer A. Turk J. Endocrinology. 1998; 139: 4073-4085Crossref PubMed Scopus (53) Google Scholar). Overexpressing iPLA2β also amplifies thapsigargin-induced apoptosis of insulinoma cells by a BEL-sensitive mechanism (46Ramanadham S. Hsu F.F. Zhang S. Jin C. Bohrer A. Ma Z. Turk J. Biochemistry. 2004; 43: 918-930Crossref PubMed Google Scholar), and these observations suggest that iPLA2β participates in ER stress-induced β-cell apoptosis. Death of cholesterol-laden macrophages in atherosclerotic lesions (47Ross R. Annu. Rev. Physiol. 1995; 57: 791-804Crossref PubMed Google Scholar) is thought to contribute to plaque rupture and thrombosis (48Ball R.Y. Stowers E.D. Burton J.H. Cary N.R. Skepper J.N. Mitchinson M.J. Atherosclerosis. 1995; 114: 45-54Abstract Full Text PDF PubMed Scopus (185) Google Scholar), and mouse peritoneal macrophages undergo apoptosis by a mechanism that involves ER stress when loaded with free cholesterol by incubation with acetylated low density lipoprotein (Ac-LDL) and an inhibitor of the cholesterol esterification enzyme ACAT (49Yao P.M. Tabas I. J. Biol. Chem. 2000; 275: 23807-23813Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar, 50Feng B. Yao P.M. Li Y. Devlin C.M. Zhang D. Harding H.P. Sweeney M. Rong J.X. Kuriakose G. Fisher E.A. Marks A.R. Rong D. Tabas I. Nat. Cell Biol. 2003; 5: 781-792Crossref PubMed Scopus (662) Google Scholar, 51Li Y. Ge M. Ciani L. Kuriakose G. Westover E.J. Dura M. Covey D.F. Freed J.H. Mayfield F.R. Lytton J. Tabas I. J. Biol. Chem. 2004; 279: 37030-37039Abstract Full Text Full Text PDF PubMed Scopus (214) Google Scholar, 52De Vries-Seimon T. Li Y. Yao P.M. Stone E. Wang Y. Davis R.J. Flavell R. Tabas I. J. Cell Biol. 2005; 171: 61-73Crossref PubMed Scopus (268) Google Scholar). Free cholesterol accumulates in macrophage ER membranes, which results in SERCA-2b inhibition (51Li Y. Ge M. Ciani L. Kuriakose G. Westover E.J. Dura M. Covey D.F. Freed J.H. Mayfield F.R. Lytton J. Tabas I. J. Biol. Chem. 2004; 279: 37030-37039Abstract Full Text Full Text PDF PubMed Scopus (214) Google Scholar), and the macrophages subsequently undergo apoptosis, which might be attributable to ER Ca2+ loss and induction of ER stress in a manner analogous to events induced by thapsigargin (51Li Y. Ge M. Ciani L. Kuriakose G. Westover E.J. Dura M. Covey D.F. Freed J.H. Mayfield F.R. Lytton J. Tabas I. J. Biol. Chem. 2004; 279: 37030-37039Abstract Full Text Full Text PDF PubMed Scopus (214) Google Scholar, 53Seimon T.A. Obstfeld A. Moore K.J. Golenbock D.T. Tabas I. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 19794-19799Crossref PubMed Scopus (155) Google Scholar). We generated iPLA2β-null mice by homologous recombination (54Bao S. Miller D.J. Ma Z. Wohltmann M. Eng G. Ramanadham S. Moley K. Turk J. J. Biol. Chem. 2004; 279: 38194-38200Abstract Full Text Full Text PDF PubMed Scopus (143) Google Scholar), and their peritoneal macrophages exhibit defective transcriptional regulation of the inducible nitric-oxide synthase gene in response to viral infection (36Moran J.M. Buller R.M. McHowat J. Turk J. Wohltmann M. Gross R.W. Corbett J.A. J. Biol. Chem. 2005; 280: 28162-28168Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar). Because iPLA2β appears to participate in ER stress-induced apoptosis in U937 promonocytes (29Atsumi G. Murakami M. Kojima K. Hadano A. Tajima M. Kudo I. J. Biol. Chem. 2000; 275: 18248-18258Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar, 42Atsumi G. Tajima M. Hadano A. Nakatani Y. Murakami M. Kudo I. J. Biol. Chem. 1998; 273: 13870-13877Abstract Full Text Full Text PDF PubMed Scopus (195) Google Scholar) and β-cells (44Zhou Y-P. Teng D. Dralyuk F. Ostrega D. Roe M.W. Philipson L. Polonsky K. J. Clin. Investig. 1998; 101: 1623-1632Crossref PubMed Google Scholar, 45Nowatzke W. Ramanadham S. Ma Z. Hsu F-F. Bohrer A. Turk J. Endocrinology. 1998; 139: 4073-4085Crossref PubMed Scopus (53) Google Scholar, 46Ramanadham S. Hsu F.F. Zhang S. Jin C. Bohrer A. Ma Z. Turk J. Biochemistry. 2004; 43: 918-930Crossref PubMed Google Scholar) and because iPLA2β-null mouse macrophages exhibit signaling defects (36Moran J.M. Buller R.M. McHowat J. Turk J. Wohltmann M. Gross R.W. Corbett J.A. J. Biol. Chem. 2005; 280: 28162-28168Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar), we examined the possibility that iPLA2β might be involved in free cholesterol loading-induced apoptosis by comparing responses of wild-type and iPLA2β-null macrophages. We also compared the phospholipid composition of wild-type and iPLA2β-null macrophages to examine the proposed housekeeping functions of iPLA2β in phospholipid homeostasis (22Balsinde J. Biochem. J. 2002; 364: 695-702Crossref PubMed Scopus (70) Google Scholar, 23Balsinde J. Balboa M.A. Cell. Signal. 2005; 17: 1052-1062Crossref PubMed Scopus (170) Google Scholar, 24Balsinde J. Bianco I.D. Ackermann E.J. Conde-Frieboes K. Dennis E.A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 8527-8531Crossref PubMed Scopus (251) Google Scholar, 25Balsinde J. Balboa M.A. Dennis E.A. J. Biol. Chem. 1997; 272: 29317-29321Abstract Full Text Full Text PDF PubMed Scopus (192) Google Scholar, 26Baburina I. Jackowski S. J. Biol. Chem. 1999; 274: 9400-9408Abstract Full Text Full Text PDF PubMed Scopus (158) Google Scholar, 27Barbour S.E. Kapur A. Deal C.L. Biochim. Biophys. Acta. 1999; 1439: 77-88Crossref PubMed Scopus (72) Google Scholar). Materials—[5,6,8,9,11,12,14,15-3H]Arachidonic acid (217 Ci/mmol) was obtained from Amersham Biosciences; enhanced chemiluminescence (ECL) reagents from were Amersham Biosciences; standard phospholipids were from Avanti Polar Lipids (Birmingham, AL); SDS-PAGE supplies were from Bio-Rad; organic solvents were from Fisher; Coomassie reagent was from Pierce; ampicillin, kanamycin, zymosan, fucoidan, common reagents, and salts were from Sigma; culture media, penicillin, streptomycin, Hanks' balanced salt solution, l-glutamine, agarose, molecular mass standards, and RT-PCR reagents were from Invitrogen; Pentex bovine serum albumin (BSA, fatty acid-free, fraction V) was from ICN Biomedical (Aurora, OH); thapsigargin was from Calbiochem. Heat-inactivated (1 h, 65 °C) fetal bovine serum was obtained from Hyclone (Logan UT). Krebs-Ringer bicarbonate buffer contained 25 mm HEPES (pH 7.4), 115 mm NaCl, 24 mm NaHCO3, 5 mm KCl, 1 mm MgCl2, and 2.5 mm CaCl2. ACAT inhibitor 58035 (3-[decyldimethyl-silyl]-N-[2-(4methylphenyl)-1-phenylethyl]propanamide (55Ross A.C. Go K.J. Heider J.G. Rothblat G.H. J. Biol. Chem. 2004; 259: 815-819Abstract Full Text PDF Google Scholar) was provided by J. Heider, formerly of Sandoz (East Hanover, NJ); a 10 mg ml-1 stock solution was prepared in dimethyl sulfoxide (Me2SO), and final Me2SO concentration for treated and control cells was 0.05%. Cholesterol (>99% pure) was obtained from Nu Chek Prep. (Elysian, MN). LDL (d, 1.020–1.063 g ml-1) from fresh human plasma was isolated by preparative ultracentrifugation. Acetyl-LDL was prepared by reaction with acetic anhydride (56Basu S.K. Goldstein J.L. Anderson R.G.W. Brown M.S. Proc. Natl. Acad. Sci. U. S. A. 1976; 73: 3178-3182Crossref PubMed Google Scholar). Anti-GADD153 (CHOP) antibody was obtained from Santa Cruz Biotechnology. Horseradish peroxidase-conjugated goat anti-rabbit IgG and goat anti-mouse IgG were from Bio-Rad. Generating iPLA2β-/- Knock-out Mice—The Washington University Animal Studies Committee approved all studies described in this study. Preparation of the iPLA2β knock-out construct, its introduction into 129/SvJ mouse embryonic stem cells, their selection with G418, characterization by Southern blotting, injection into C57BL/6 mouse blastocysts, production of chimeras and then heterozygotes, and mating of heterozygotes to yield wild-type, heterozygous, and iPLA2β-null mice in a Mendelian distribution are described elsewhere, as is their genotyping by Southern blotting of tail genomic DNA (54Bao S. Miller D.J. Ma Z. Wohltmann M. Eng G. Ramanadham S. Moley K. Turk J. J. Biol. Chem. 2004; 279: 38194-38200Abstract Full Text Full Text PDF PubMed Scopus (143) Google Scholar, 57Bao S. Song H. Wohltmann M. Bohrer A. Turk J. J. Biol. Chem. 2006; 281: 20958-20973Abstract Full Text Full Text PDF PubMed Scopus (75) Google Scholar). Isolation of Peritoneal Macrophages—As described previously (49Yao P.M. Tabas I. J. Biol. Chem. 2000; 275: 23807-23813Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar, 50Feng B. Yao P.M. Li Y. Devlin C.M. Zhang D. Harding H.P. Sweeney M. Rong J.X. Kuriakose G. Fisher E.A. Marks A.R. Rong D. Tabas I. Nat. Cell Biol. 2003; 5: 781-792Crossref PubMed Scopus (662) Google Scholar, 51Li Y. Ge M. Ciani L. Kuriakose G. Westover E.J. Dura M. Covey D.F. Freed J.H. Mayfield F.R. Lytton J. Tabas I. J. Biol. Chem. 2004; 279: 37030-37039Abstract Full Text Full Text PDF PubMed Scopus (214) Google Scholar, 52De Vries-Seimon T. Li Y. Yao P.M. Stone E. Wang Y. Davis R.J. Flavell R. Tabas I. J. Cell Biol. 2005; 171: 61-73Crossref PubMed Scopus (268) Google Scholar), peritoneal macrophages from adult female C57BL/6 mice and mutant mice were harvested 3 days after intraperitoneal injection of 40 μg of concanavalin A in PBS (0.2 ml). Cells were incubated in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and 20% L-cell-conditioned medium. Medium was replaced every 24 h until macrophages were confluent. On days of experiments, cells were washed three times with warm PBS and incubated as indicated in the figures. Analyses of iPLA2β mRNA in Mouse Peritoneal Macrophages and Brain—Northern blots of iPLA2β mRNA were performed as described (54Bao S. Miller D.J. Ma Z. Wohltmann M. Eng G. Ramanadham S. Moley K. Turk J. J. Biol. Chem. 2004; 279: 38194-38200Abstract Full Text Full Text PDF PubMed Scopus (143) Google Scholar). For RT-PCR, total RNA was isolated with an RNeasy kit (Qiagen Inc.). SuperScript First Strand Synthesis System (Invitrogen) was used to synthesize cDNA in 20-μl reactions that contained DNase I-treated total RNA (2 μg). The cDNA product was treated (20 min, 37 °C) with RNase H (2 units; Invitrogen) and heat-inactivated (70 °C, 15 min). Reactions without reverse transcriptase were performed to verify the absence of genomic DNA. PCR with the pair of primers 1 and 2 amplifies a fragment that spans the neomycin resistance cassette insertion site. PCR with the pair of primers 3 and 2 amplifies a fragment downstream from that site. The sequence of primer 1 is tgtgacgtggacagcactagc, that of primer 2 is ccccagagaaacgactatgga, and that of primer 3 is tatgcgtggtgtgtacttccg. Free Cholesterol Loading of Mouse Peritoneal Macrophages, Incubation with Thapsigargin and Fucoidan, Cell Death Assays, Caspase Activation, and Analyses of Internucleosomal DNA Cleavages—Macrophages were loaded with free cholesterol by incubation with 100 μg ml-1 acetyl-LDL in the presence of 10 μg ml-1 58035, which inhibits ACAT-mediated cholesterol esterification (49Yao P.M. Tabas I. J. Biol. Chem. 2000; 275: 23807-23813Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar). Alternatively, macrophages were incubated with the SERCA inhibitor thapsigargin (0.5 μm), the scavenger receptor A ligand fucoidan (25 μg/ml), or both agents for 24 h as described (52De Vries-Seimon T. Li Y. Yao P.M. Stone E. Wang Y. Davis R.J. Flavell R. Tabas I. J. Cell Biol. 2005; 171: 61-73Crossref PubMed Scopus (268) Google Scholar). At the end of the incubation, macrophages were assayed for early-to-mid stage apoptosis (i.e. externalization of phosphatidylserine) by staining with Alexa-488-labeled annexin V and for late stage apoptosis (i.e. increased membrane permeability) by staining with propidium iodide (PI) as described (49Yao P.M. Tabas I. J. Biol. Chem. 2000; 275: 23807-23813Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar). Cells were viewed immediately with an Olympus IX-70 inverted fluorescence microscope, and six representative fields (∼1000 cells) for each condition were counted for the number of annexin-positive cells, PI-positive cells, and total cells. In other experiments, cell or nuclear preparations were subjected to immunoblot analyses, as described below. Activated caspase-3 in macrophages was detected with an EnzCheck caspase-3 assay kit (Invitrogen). DNA laddering kits (Roche Diagnostics) were used to analyze internucleosomal cleavages characteristic of apoptosis as described (46Ramanadham S. Hsu F.F. Zhang S. Jin C. Bohrer A. Ma Z. Turk J. Biochemistry. 2004; 43: 918-930Crossref PubMed Google Scholar). Immunoblotting of the Endoplasmic Reticulum Stress Marker CHOP—Immunoblotting of CHOP was performed as described (58Harding H.P. Novoa I. Zhang Y. Zeng H. Wek R. Schapira M. Ron D. Mol. Cell. 2000; 6: 1099-1108Abstract Full Text Full Text PDF PubMed Google Scholar, 59Calfon M. Zeng H. Urano F. Till J.H. Hubbard S.R. Harding H.P. Clark S.G. Ron D. Nature. 2002; 415: 92-96Crossref PubMed Scopus (1882) Google Scholar) with minor modifications. Briefly, cells were lysed in RIPA buffer to prepare whole-cell lysates, which were resuspended in 2× SDS-PAGE loading buffer and incubated (95 °C, 10 min). After SDS-PAGE analyses, samples were electrotransfered to 0.22-μm nitrocellulose membranes using a Bio-Rad mini-transfer tank and then incubated with primary antibodies. Protein bands were detected with horseradish peroxidase-conjugated secondary antibodies (Bio-Rad) by ECL (Amersham Biosciences). Membranes were also probed with an anti-β-actin monoclonal antibody to assess loading. Preparation of Recombinant Adenovirus to Restore iPLA2β Expression to iPLA2β-Null Cells—An adenovirus that caused expression of iPLA2β was prepared with a ViraPower adenovirus expression system (Invitrogen) according to the manufacturer's instructions. Briefly, cDNA that encodes the 84-kDa iPLA2β (13Ma Z. Ramanadham S. Kempe K. Chi X.S. Ladenson J. Turk J. J. Biol. Chem. 1997; 272: 11118-11127Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar) was subcloned into the