Abstract:An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction between 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and γ-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphorylated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to γ-radiation, while γ-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by γ-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that γ-irradiation, in general, strengthens the binding of phosphorylated p53 protein to the encoding gene.

Cooperative phosphorylation at multiple sites is required to activate p53 in response to UV radiation

DNA-dependent Protein Kinase-independent Activation of p53 in Response to DNA Damage

DNA damage triggers DRB-resistant phosphorylation of human p53 at the CK2 site

Human DNA-activated protein kinase phosphorylates serines 15 and 37 in the amino-terminal transactivation domain of human p53

Phosphorylation Site Interdependence of Human P53 Post-Translational Modifications in Response to Stress.

DNA damage-induced phosphorylation of p53 at serine 20 correlates with p21 and Mdm-2 induction in vivo

Potentiality of DNA-dependent protein kinase to phosphorylate Ser46 of human p53

Phosphorylation of serine 392 stabilizes the tetramer formation of tumor suppressor protein p53.

Limited role of N-terminal phosphoserine residues in the activation of transcription by p53

Irradiation potentiates p53 phosphorylation and p53 binding to the promoter and coding region of the TP53 gene

UBE4B targets phosphorylated p53 at serines 15 and 392 for degradation

CDK9 Phosphorylates p53 on Serine Residues 33, 315 and 392

Ser18 and 23 Phosphorylation is Required for P53-Dependent Apoptosis and Tumor Suppression

Ser392 Phosphorylation Regulates the Oncogenic Function of Mutant P53

Phosphorylation Of Ser312 Contributes To Tumor Suppression By P53 In Vivo

The Catalytic Subunit of DNA-dependent Protein Kinase Selectively Regulates P53-Dependent Apoptosis but Not Cell-Cycle Arrest.

Coordination Between P21 and DDB2 in the Cellular Response to UV Radiation.

Ser18 and Ser23 phosphorylation plays synergistic roles in activating p53-dependent neuronal apoptosis.

Phosphorylation by Casein Kinase I Promotes the Turnover of the Mdm2 Oncoprotein via the SCFβ-TRCP Ubiquitin Ligase

PP2A regulates ionizing radiation-induced apoptosis through Ser46 phosphorylation of p53.

The P53-Induced Oncogenic Phosphatase PPM1D Interacts with Uracil DNA Glycosylase and Suppresses Base Excision Repair.