Nuclear PKM2 regulates [bgr]-catenin transactivation upon EGFR activation
Weiwei Yang,Yan Xia,Haitao Ji,Yanhua Zheng,Ji Liang,Zhimin Lu,Wenhua Huang,Xiang Gao,Kenneth Aldape
DOI: https://doi.org/10.1038/nature10598
IF: 64.8
2011-01-01
Nature
Abstract:Because both EGFR activation and PKM2 expression are instrumental in tumorigenesis5, 6, 7, we examined whether EGFR activation regulates PKM2 functions in a subcellular-compartment-dependent manner. Immunofluorescence analysis showed that EGF treatment resulted in the nuclear accumulation of PKM2 in U87/EGFR human glioblastoma (GBM) cells (Fig. 1a). In addition, expression of the constitutively active EGFRvIII mutant in U87 cells resulted in a higher amount of nuclear PKM2 than was observed in EGF-untreated U87/EGFR cells (Supplementary Fig. 2a). The finding that EGF induces nuclear translocation of PKM2 was further supported by cell fractionation analysis of DU145 prostate cancer cells, MDA-MB-231 breast cancer cells and U87/EGFR cells (Supplementary Fig. 2b). In addition, PKM1 failed to translocate into the nucleus upon EGF stimulation (Supplementary Fig. 2c), indicating that EGF specifically regulates the subcellular distribution of PKM2 in multiple types of cancer cells. To examine whether PKM2 directly regulates gene transcription and cell proliferation, we expressed PKM2 short hairpin RNA (shRNA) in U87/EGFR cells (Supplementary Fig. 3a). PKM2 depletion largely reduced both basal and EGF-induced tumour cell proliferation (Fig. 1b) and blocked EGF-enhanced expression of cyclin D1 and c-Myc (Fig. 1c), which are known to be important regulators of cell proliferation and downstream genes of β-catenin transactivation8. To examine whether these PKM2-dependent effects were mediated by β-catenin, we performed TCF/LEF-1 luciferase reporter analyses, showing that PKM2 depletion significantly inhibited EGF-induced β-catenin transactivation (Fig. 1d). In addition, chromatin immunoprecipitation (ChIP) analyses showed that EGFR activation resulted in increased binding of β-catenin to the promoter region of CCND1 (coding for cyclin D1) (Fig. 1e) and c-Myc (data not shown), which was blocked by PKM2 depletion. In addition, co-immunoprecipitation analyses showed that PKM2 depletion inhibited the EGF-induced interaction between β-catenin and Myc-tagged TCF4 (Fig. 1f). However, PKM2 depletion failed to inhibit WNT3A- or WNT1- (data not shown) induced β-catenin transactivation (Supplementary Fig. 3b) and cyclin D1 expression (Supplementary Fig. 3c). In addition, WNT3A did not induce PKM2 nuclear translocation (Supplementary Fig. 3d). These results indicate that EGF induces β-catenin transactivation via a mechanism distinct from that induced by Wnt/Wingless4 and that PKM2 expression has a pivotal role in EGF-, but not Wnt-induced β-catenin transactivation. To examine the mechanism underlying PKM2-regulated β-catenin transactivation, we performed co-immunoprecipitation analyses, showing that EGF stimulation resulted in an interaction between endogenous PKM2 and β-catenin in the nuclear, but not cytosolic, fraction of U87/EGFR cells (Fig. 1g). However, an in vitro glutathione S-transferase (GST) pull-down assay showed that purified GST–β-catenin failed to bind to purified His–PKM2 (Supplementary Fig. 4). These results suggest that the interaction of these two proteins might require post-translational modifications of the proteins. PKM2 binds to tyrosine-phosphorylated peptides, and expression of the phosphotyrosine-binding form is required for cancer cell growth9. To examine whether β-catenin is tyrosine phosphorylated, we performed immunoblotting analyses with a phospho-Tyr antibody, showing that EGF stimulation induced Tyr phosphorylation of immunoprecipitated β-catenin in the nucleus, but not in the cytosol or at the plasma membrane (Fig. 1h). Treatment of the immunoprecipitated β-catenin with calf intestinal alkaline phosphatase (CIP) resulted in β-catenin dephosphorylation and abrogation of the PKM2–β-catenin interaction (Fig. 1i). Thus, EGF-induced Tyr phosphorylation of β-catenin is required for the PKM2–β-catenin interaction. The PKM2 K433E mutant, which fails to bind to tyrosine-phosphorylated peptides9, had similar glycolytic enzyme activity to its wild-type counterpart (Supplementary Fig. 5)9. Co-immunoprecipitation analyses showed that EGF treatment induced the binding of β-catenin to Flag-tagged wild-type PKM2, but not to the PKM2 K433E mutant (Fig. 1j). In contrast, a kinase-dead Flag–PKM2 K367M mutant10, 11, acting like its wild-type counterpart, binds to β-catenin (Fig. 1k). These results indicate that the K433 binding residue of PKM2, but not its catalytic activity, is critical for the PKM2–β-catenin interaction. Abl and c-Src have been reported to phosphorylate β-catenin12, 13. Pre-treatment with SU6656 (an Src inhibitor) or an Abl inhibitor completely abrogated EGF-induced activation of c-Src or Abl, as shown by the reduced levels of c-Src (Y418) or Abl (Y412) phosphorylation (Supplementary Fig. 6a). However, inhibition of c-Src, but not Abl, blocked EGF-induced Tyr phosphorylation of β-catenin (Fig. 2a). In addition, deficiency of c-Src (Fig. 2b), but not of Abl (Supplementary Fig. 6b), abrogated EGF-induced β-catenin Tyr phosphorylation and the PKM2–β-catenin interaction. These results indicate that c-Src, a downstream effector of EGFR, phosphorylates β-catenin, which is required for the PKM2–β-catenin interaction. To examine the subcellular compartment in which c-Src phosphorylates β-catenin, we conducted fractionation analyses. We found that EGF stimulation resulted in the nuclear translocation of c-Src (Supplementary Fig. 6c). In addition, co-immunoprecipitation analyses showed that EGF treatment induced an enhanced interaction between β-catenin and c-Src in nuclear fractions (Fig. 2c). These results, combined with the evidence that β-catenin is phosphorylated in the nucleus (Fig. 1h), strongly suggest that c-Src translocates into the nucleus and subsequently interacts with and phosphorylates β-catenin. The Y86 residue of β-catenin has been shown to be phosphorylated by c-Src as well as BCR–ABL12, 13, and analysis of the amino acid sequence identified an additional potential Src phosphorylation site at Y333. Immunoblotting analysis showed that EGF stimulation resulted in tyrosine phosphorylation of Flag-tagged wild-type β-catenin and β-catenin Y86F, but not β-catenin Y333F, which was further validated by immunoblotting with a phospho-β-catenin Y333 antibody (Fig. 2d). In addition, cell fractionation analysis demonstrated that EGF induced β-catenin Y333 phosphorylation primarily in the nucleus (Supplementary Fig. 6d). Furthermore, an in vitro protein kinase assay showed that active c-Src was able to phosphorylate wild-type β-catenin (Fig. 2e), but the β-catenin Y333F mutation largely reduced total Tyr-phosphorylation levels and completely abrogated the Y333 phosphorylation. These results reveal that c-Src binds and phosphorylates β-catenin at Y333 in vitro and in vivo. To examine whether phosphorylation of β-catenin Y333 regulates its binding to PKM2, we performed a GST pull-down assay by mixing purified GST–β-catenin and His–PKM2 with or without purified active c-Src. Figure 2f shows that wild-type PKM2 did not bind to unphosphorylated wild-type β-catenin. However, the presence of c-Src enabled the binding of wild-type PKM2 to β-catenin, which was abrogated by mutation of β-catenin at Y333 or PKM2 at K433. These in vitro results were further validated by co-immunoprecipitation analyses, showing that in contrast to Flag-tagged wild-type β-catenin or β-catenin Y86F, Flag–β-catenin Y333F failed to bind to endogenous PKM2 (Fig. 2g). These results indicate that c-Src-mediated β-catenin Y333 phosphorylation is required for the PKM2–β-catenin interaction. We next examined the importance of the PKM2–β-catenin interaction in β-catenin transactivation. Figure 3a shows that Flag–β-catenin Y333F failed to interact with Myc-tagged TCF4 upon EGF stimulation, in contrast to its wild-type counterpart. ChIP analyses demonstrated that Flag-tagged wild-type β-catenin bound to the CCND1 promoter region upon EGFR activation, which was abrogated by the Y333F mutation (Fig. 3b). In addition, reconstituted expression of the RNA interference (RNAi)-resistant (r)β-catenin Y333F mutant, but not of wild-type rβ-catenin, in endogenous β-catenin-depleted U87/EGFRvIII cells failed to induce cyclin D1 and c-Myc expression (Fig. 3c). Furthermore, Flag–PKM2 K433E and the inactive Flag–PKM2 K367M mutant translocated into the nucleus upon EGF stimulation (Supplementary Fig. 7), but reconstituted expression of these mutants (Supplementary Fig. 8) failed to induce cyclin D1 expression as did wild-type rPKM2 expression (Fig. 3d). Thus, both PKM2 catalytic activity and the PKM2–β-catenin interaction are required for cyclin D1 expression upon EGFR activation. To compare downstream targets of EGF and Wnt signalling, we examined the expression of other Wnt/β-catenin downstream genes: AXIN2, DKK1 and βTrCP (also known as BTRCP)8. Quantitative reverse transcription–polymerase chain reaction (RT–PCR) analysis showed that EGF treatment increased mRNA levels of DKK1, but not of AXIN2 or βTrCP, which was blocked by PKM2 depletion (Supplementary Fig. 9). These results indicate that EGF-induced and PKM2-dependent β-catenin transactivation induced transcription of a set of genes, which do not completely overlap with those induced by Wnt signalling. The finding that PKM2 was not required for WNT3A-induced β-catenin transactivation (Supplementary Fig. 3b) suggested that c-Src-dependent β-catenin Y333 phosphorylation is not involved in Wnt-induced signalling or cell adhesion. This assumption was supported by the results, which showed that β-catenin Y333F behaved similarly to wild-type β-catenin both in binding to APC, AXIN2 and E-cadherin and in Wnt-induced β-catenin transactivation and cellular functions (Supplementary Fig. 10a–g). In contrast, expression of β-catenin Y333F blocked EGF- but not WNT3A-induced cell migration (Supplementary Fig. 10h). To investigate the mechanisms underlying PKM2- and β-catenin-dependent cyclin D1 expression, we performed ChIP analyses. Figure 3e shows that EGF induced an enhanced binding of wild-type Flag–PKM2 and Flag–PKM2 K367M, but not of Flag–PKM2 K433E, to the CCND1 promoter region. In addition, binding of Flag–PKM2 to the promoter region was not detected in ChIP analyses after β-catenin had been immunodepleted from cell lysates (Fig. 3f). These results indicate that the PKM2–β-catenin interaction, but not PKM2 kinase activity, is required for both proteins to bind to the CCND1 promoter region. We next examined whether PKM2 binding to the CCND1 promoter region regulates histone H3 acetylation, which is important for gene transcription. ChIP analyses showed that EGF treatment resulted in a significant increase of histone H3 acetylation in the CCND1 promoter region, which was blocked by PKM2 depletion (Fig. 3g). Reconstituted expression of rPKM2 K433E and the inactive rPKM2 K367M mutant failed to restore EGF-induced histone H3 acetylation, compared with the wild-type protein. To understand further the mechanism underlying PKM2-regulated histone H3 acetylation, we performed ChIP analyses with antibodies against ubiquitously expressed histone deacetylase (HDAC)1, HDAC2 and HDAC3 (ref. 14). Figure 3h shows that HDAC3, but not HDAC1 or HDAC2 (Supplementary Fig. 11a), was pre-bound to the CCND1 promoter. EGF treatment resulted in the disassociation of HDAC3 from the CCND1 promoter, and this disassociation was blocked by PKM2 depletion. Furthermore, reconstituted expression of wild-type rPKM2, but not of rPKM2 K367M or rPKM2 K433E mutants, was able to restore EGF-induced disassociation of HDAC3 from the promoter (Fig. 3h). These results indicate that the kinase activity of PKM2 and its binding with β-catenin to the CCND1 promoter region are required for HDAC3 removal from the promoter. An additional co-immunoprecipitation analysis showed that wild-type PKM2, but not PKM2 K367M, interacted with HDAC3 upon EGF treatment (Supplementary Fig. 11b). These results suggest that PKM2 can interact with HDAC3 in an active conformation, which facilitates HDAC3 removal from the CCND1 promoter, acetylation of histone H3, and cyclin D1 expression. To support the findings that EGF-induced and c-Src-dependent PKM2–β-catenin interaction and subsequent cyclin D1 expression are not cell-line specific, we treated GSC11 and GSC23 human primary GBM cells with EGF. Supplementary Fig. 12a shows that EGF treatment results in nuclear translocation of PKM2 and cyclin D1 expression in these cells. In addition, EGF-induced phosphorylation of β-catenin Y333 (Supplementary Fig. 12b) and its association with PKM2 (Supplementary Fig. 12c) were blocked by pre-treatment with SU6656. We next examined the significance of the PKM2–β-catenin interaction in tumour cell proliferation. Figure 4a shows that U87/EGFRvIII cells proliferated much faster than did parental U87 cells. Expression of β-catenin shRNA (Fig. 3c) largely inhibited U87/EGFRvIII cell proliferation, which was rescued by reconstituted expression of wild-type rβ-catenin, but not of the rβ-catenin Y333F mutant (Fig. 4a). In addition, EGFRvIII-promoted cell proliferation was similarly inhibited by PKM2 depletion, which was rescued by the reconstituted expression of wild-type rPKM2, but not of the rPKM2 K433E or rPKM2 K367M mutant (Supplementary Fig. 13a and Fig. 4b). β-Catenin-regulated cyclin D1 expression is critical for G1–S phase transition and cell cycle progression15. Depletion of β-catenin or PKM2 resulted in an accumulation of U87/EGFRvIII cells in G0/G1 phase, which was rescued by reconstituted expression of wild-type rβ-catenin or wild-type rPKM2, but not of the rβ-catenin Y333F or rPKM2 K433E mutant (Supplementary Fig. 13b). Thus, the PKM2–β-catenin interaction is essential for cell cycle progression. To determine the role of PKM2-dependent β-catenin transactivation in brain tumour development, we intracranially injected U87 or U87/EGFRvIII cells into athymic nude mice. U87 cells did not form a detectable tumour 2 weeks after injection (Fig. 4c, bottom left). In contrast, U87/EGFRvIII cells elicited rapid tumorigenesis (Fig. 4c, top left). Notably, depletion of β-catenin (Fig. 4c, top) or PKM2 (Fig. 4c, bottom) abrogated EGFRvIII-driven tumour growth, which was rescued by expression of wild-type rβ-catenin or wild-type rPKM2, but not of the rβ-catenin Y333F or rPKM2 K433E mutant. Similar results were obtained using GSC11 cells (Supplementary Fig. 14a). In addition, adding doxycycline to the drinking water 14 days after intracranial injection of GSC11 cells that expressed a tetracycline-inducible PKM2 shRNA partially depleted PKM2 expression in tumour tissues and inhibited tumour growth (Supplementary Fig. 14b). Thus, the PKM2–β-catenin interaction and PKM2 expression is instrumental in tumour growth. To support further the role of c-Src in EGFR-induced β-catenin transactivation in vivo, we injected SU6656 intratumorally, which significantly blocked tumour growth (Supplementary Fig. 15a, b), reduced the phosphorylation levels of c-Src Y418 and β-catenin Y333, and inhibited cyclin D1 expression in tumour tissue (Supplementary Fig. 15c). The requirement of β-catenin transactivation in tumorigenesis was also examined by expression of WNT1 in U87/EGFRvIII-PKM2 shRNA cells. WNT1 expression resulted in the induction of cyclin D1 (Supplementary Fig. 16a) and largely rescued PKM2 depletion-blocked tumorigenesis (Supplementary Fig. 16b, c). In addition, this effect was further enhanced using WNT1-expressing U87/EGFRvIII cells with reconstituted expression of rPKM2 K433E, which retains its catalytic activity for glycolysis. These results suggest that, whereas the metabolic function of PKM2 has a critical role in aerobic glycolysis7 and tumorigenesis, brain tumour development promoted by EGFR requires PKM2-modulated β-catenin transactivation. Analysis of publicly available microarray data sets (Affymetrix, U133) from The Cancer Genome Atlas (TCGA) and other sources16, 17, 18, 19 revealed a correlation of c-Myc and CCND1 expression with EGFR expression in GBM samples (Supplementary Fig. 17). In addition, phosphorylation levels of β-catenin Y333 correlated with phosphorylation levels of activated c-Src in seven human primary GBM cell lines (Supplementary Fig. 18). We next performed immunohistochemical (IHC) analyses to examine c-Src activity, β-catenin Y333 phosphorylation, and PKM2 nuclear localization in serial sections of 55 human primary GBM specimens by using antibodies with validated specificities (Supplementary Fig. 19). Figure 4d shows that the levels of c-Src Y418 phosphorylation, β-catenin Y333 phosphorylation, and nuclear PKM2 expression were correlated with each other. In addition, β-catenin Y333 phosphorylation accumulated in the nuclei of a large percentage of tumour cells (Fig. 4d, left). Quantification of the staining upon a scale of 0 to 8.0 showed that these correlations were significant (Supplementary Fig. 20). The survival durations of 84 patients, all of whom received standard adjuvant radiotherapy after surgery, followed by treatment with an alkylating agent (temozolomide in the majority of cases), with low (0–5 staining) versus high (5.1–8 staining) β-catenin Y333 phosphorylation and nuclear PKM2 expression were compared. Patients whose tumours had low β-catenin Y333 phosphorylation or nuclear PKM2 expression had a median survival of 185.2 and 130.0 weeks, respectively. The median survival of patients decreased to 69.4 and 82.5 weeks, respectively, when their tumours showed high levels of β-catenin Y333 phosphorylation or nuclear PKM2 expression. In a Cox multivariate model, the IHC scores of β-catenin phosphorylation (Fig. 4e) and nuclear PKM2 expression (Fig. 4f) were independent predictors of glioblastoma patient survival, after adjusting for the age of the patient, a relevant clinical covariate. These results support the role of PKM2 association with c-Src-phosphorylated β-catenin Y333 in the clinical behaviour of human GBM and reveal a relationship between β-catenin Y333 phosphorylation/nuclear PKM2 localization and clinical aggressiveness of the tumour. These findings were further supported by IHC analyses, showing significantly lower levels of β-catenin Y333 phosphorylation in low-grade diffuse astrocytoma (30 cases) (World Health Organization (WHO) grade II; median survival time >5 years) than were present in GBM specimens (WHO grade IV)20 (Supplementary Fig. 21). We previously showed that GSK-3β-independent transactivation of β-catenin by growth factor receptor occurs by mechanisms distinct from Wnt-dependent canonical signalling4, 21, 22, 23. In this study, we describe an important and previously unknown mechanism underlying EGFR activation-induced β-catenin transactivation through interaction with PKM2, which has a critical role in transcription of CCND1 and c-Myc (Supplementary Fig. 1). The understanding that phosphorylation of β-catenin Y333 and its interaction with PKM2 are required for tumour cell proliferation and tumour development, and that the levels of β-catenin Y333 phosphorylation and nuclear PKM2 correlate with grades of glioma malignancy and prognosis, may provide a molecular basis for improved diagnosis and treatment of tumours with activated EGFR and upregulated PKM2. Our findings, in combination with previous reports7, 24, delineate two essential mechanisms underlying tumour development by regulation of metabolic and non-metabolic functions of PKM2: (1) PKM2 enhances aerobic glycolysis7, 24; and (2) PKM2 promotes tumour cell proliferation by binding to and transactivating Y333-phosphorylated β-catenin. Thus, PKM2 has dual roles that are essential for tumorigenesis: regulating cancer cell metabolism and gene transcription required for cell proliferation. The coordinated control of metabolism and proliferation by PKM2 is essential for tumorigenesis. U87, U87/EGFR and U251 GBM cells; DU145 prostate cancer cells; MDA-MB-231 breast cancer cells; A431 epidermoid carcinoma cells and NIH3T3, 293T, c-SRC+/+, c-SRC−/−, ABL+/+ and ABL−/− cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% bovine calf serum (HyClone). Human primary GBM cells were maintained in DMEM/F-12 50/50 supplemented with B27, EGF (10 ng ml−1), bFGF (10 ng ml−1). Rat pheochromocytoma PC12 cells were maintained in DMEM supplemented with 10% horse serum and 5% fetal bovine serum. Cell cultures were made quiescent by growing them to confluence, and the medium was replaced with fresh medium containing 0.5% serum for 1 day. EGF with 100 ng ml−1 final concentration was used for cell stimulation. Rabbit polyclonal antibodies recognizing phospho-β-catenin Y333, PKM1, PKM2, c-Src, Abl, phospho-Abl Y412 and c-Myc were obtained from Signallway Biotechnology. A mouse antibody recognizing phospho-tyrosine was obtained from BD Biosciences. A monoclonal antibody against phospho-c-Src Y418 was purchased from Millipore. Polyclonal antibodies for cyclin D1 and PCNA and monoclonal antibodies for β-catenin and Myc tag were purchased from Santa Cruz Biotechnology. A polyclonal antibody of acetylated histone H3 and a monoclonal antibody for HDAC3 were obtained from Upstate Biotechnology. EGF and mouse monoclonal antibodies for Flag, GST, His and tubulin were purchased from Sigma. Hygromycin, puromycin, G418, SU6656, Abl inhibitor, cycloheximide, DNase-free RNase A and propidium iodide were purchased from EMD Biosciences. Active c-Src was obtained from Signallchem. Hoechst 33342 and Alexa Fluor 488 goat anti-rabbit antibody was from Molecular Probes. HyFect transfection reagents were from Denville Scientific. GelCode Blue Stain Reagent was obtained from Pierce. Cells were plated at a density of 4 × 105 per 60-mm dish 18 h before transfection. Transfection was performed as previously described14. Extraction of proteins with a modified buffer from cultured cells was followed by immunoprecipitation and immunoblotting with corresponding antibodies, as described previously25. 2 × 104 cells were plated and counted 7 days after seeding in DMEM with 0.5% bovine calf serum. Data represent the means ± s.d. of three independent experiments. PCR-amplified human PKM1 was cloned into pcDNA3.1/hygro (+) vector between BamHI and XhoI. PCR-amplified human PKM2 was cloned into pcDNA3.1/hygro (+) vector between BamHI and NotI. β-Catenin was subcloned into pGEX-4T-1 vector between BamHI and NotI. pcDNA 3.1/hygro (+)-PKM2, -K433E, -K367M, pcDNA 3.1/hygro (+)-β-catenin Y86F, and -β-catenin Y333F were made using the QuikChange site-directed mutagenesis kit (Stratagene). pCDNA 3.1-rPKM2 contains mutations of C1192T and C1194G. The pGIPZ control was generated with a control oligonucleotide GCTTCTAACACCGGAGGTCTT. pGIPZ PKM2 shRNA and pTRIPZ PKM2 shRNA were generated with TTATTTGAGGAACTCCGCCGC oligonucleotide targeting exon 10 of the PKM2 transcript. pGIPZ β-catenin shRNA was generated with CATGCACAAGAATGGATCACAA. 1 × 106 treated cells were fixed in cold 70% ethanol for 3 h, spun down, and incubated for 1 h at 37 °C in PBS with DNase-free RNase A (100 μg ml−1) and propidium iodide (50 μg ml−1). Cells were then analysed by fluorescence-activated cell sorting (FACS). The wild-type and mutants of GST–β-catenin were expressed in bacteria and purified as described previously14. The kinase reactions were performed as described previously22. The transcriptional activation of β-catenin in 293T cells was measured as previously described22. The relative levels of luciferase activity were normalized to the levels of untreated cells and to the levels of luciferase activity of the Renilla control plasmid. ChIP was performed using an Upstate Biotechnology kit. Chromatin prepared from cells (in a 10-cm dish) was used to determine total DNA input and for overnight incubation with the specific antibodies or with normal rabbit or mouse immunoglobulin G. The human CCND1 promoter-specific primers used in PCR were 5′-GGGGCGATTTGCATTTCTAT-3′ (forward) and 5′-CGGTCGTTGAGGAGGTTGG-3′ (reverse). Immunofluorescence analysis was performed as described previously22. Nuclei, cytosol and cell membranes were isolated using the Nuclear Extract Kit from Active Motif North America and the ProteoExtract Subcellular Proteome Extraction Kit from Calbiochem. Mouse tumour tissues were fixed and prepared for staining. The specimens were stained with Mayer’s haematoxylin and subsequently with eosin (Biogenex Laboratories). Afterwards, the slides were mounted using Universal Mount (Research Genetics). The tissue sections from paraffin-embedded human GBM specimens were stained with antibodies against phospho-c-Src Y418, phospho-β-catenin Y333, PKM2, or nonspecific IgG as a negative control. We quantitatively scored the tissue sections according to the percentage of positive cells and staining intensity, as previously defined21. We assigned the following proportion scores: 0 if 0% of the tumour cells showed positive staining, 1 if 0% to 1% of cells were stained, 2 if 1% to 10% stained, 3 if 11% to 30% stained, 4 if 31% to 70% stained, and 5 if 71% to 100% stained. We rated the intensity of staining on a scale of 0 to 3: 0, negative; 1, weak; 2, moderate; and 3, strong. We then combined the proportion and intensity scores to obtain a total score (range, 0–8), as described previously21. Scores were compared with overall survival, defined as the time from date of diagnosis to death or last known date of follow-up. All patients received standard adjuvant radiotherapy after surgery, followed by treatment with an alkylating agent (temozolomide in the majority of cases). The use of human brain tumour specimens and the database was approved by the institutional review board at MD Anderson Cancer Center. We intracranially injected 5 × 105 GBM cells (in 5 μl of DMEM per mouse), with or without regulation of β-catenin or PKM2 expression, into 4-week-old female athymic nude mice. The intracranial injections were performed as described in a previous publication26. Seven mice per group in each experiment were included. Animals injected with U87/EGFRvIII or GSC 11 cells were killed 2 weeks or 30 days after glioma cell injection, respectively. The brain of each mouse was harvested, fixed in 4% formaldehyde, and embedded in paraffin. Tumour formation and phenotype were determined by histological analysis of H&E-stained sections. For doxycycline induction studies, 7 mice were killed 14 days after GBM cell injection to examine tumour growth, whereas the remaining 14 mice in two groups were fed with or without water containing 800 μg ml−1 doxycycline. The water containing doxycycline was changed every 3 days. The mice in these two groups were killed at day 30. For the SU6656 treatment studies, 7 mice were killed 5 days after U87/EGFRvIII cell injection to examine tumour growth, whereas the remaining 14 mice in two groups were treated with either DMSO or SU6656. SU6656 (0.015 mg kg−1 in 5 μl of DMSO) was intracranially injected into the tumour every 3 days, and the mice in both groups were killed at day 14 after GBM cell injection. Mouse NGF (Upstate Biotechnology) was added at 100 ng ml−1 to PC12 cells in culture, and the medium was changed every 3 days. Two hundred cells from 10 randomly chosen microscopic fields for each condition were examined. A cell was considered to respond to NGF if it extended neurites at least two cell bodies long after the incubation duration. The activity of bacterially purified wild-type PKM2 (0.1 μg) and PKM2 K433E (0.1 μg) towards PEP was measured by a pyruvate kinase assay (BioVision), according to the manufacturer’s instruction. Data represent the mean ± s.d. of three independent experiments. Matrigel-transwell assay was performed as described previously22. We transfected 293T cells in 150-mm plates with 12 μg pFU-CGW WNT1, 4 μg pMDL, 4 μg pRSV-Rev, and 4 μg pCMV-VSVG, a plasmid encoding the G-protein of the vesicular stomatitis virus (VSV-G) envelope. The medium was changed the next day. The medium containing lentivirus was harvested at 48 h and 72 h after transfection. Virus particles were concentrated and purified by ultra-high-speed centrifugation (25,000g for 2 h at 4 °C). Cells were infected with lentivirus (1 × 106) in the presence of 6 μg ml−1 polybrene (Sigma). Total RNA was extracted using a RNA High-purity Total RNA Rapid Extraction Kit (Signallway Biotechnology). cDNA was prepared using oligonucleotide (dT), random primers, and a Thermo Reverse Transcription kit (Signallway Biotechnology). Quantitative real-time PCR analysis was performed using 2× SIBR real-time PCR Premixture (Signallway Biotechnology) under the following conditions: 5 min at 95 °C followed by 40 cycles at 95 °C for 30 s, 55 °C for 40 s, and 72 °C for 1 min using an ABI Prism 7700 sequence detection system. Data were normalized to expression of a control gene (b-actin) for each experiment. The following primer pairs were used for quantitative real-time PCR: DKK1, 5′-CATTGACAACTACCAGCCGTAC-3′ (forward) and 5′-GGGCAGCACATAGCGTGA-3′ (reverse); AXIN2, 5′-GGGAGCCTAAAGGTCGTG-3′ (forward) and 5′-GGGTTCTCGGGAAATGAG-3′ (reverse); βTRCP, 5′-CCCCAACTGACATTACCC-3′ (forward) and 5′-TCGAATACAACGCACCAA-3′ (reverse); β-actin, 5′-ATGGATGACGATATCGCTGCGC-3′ (forward) and 5′-GCAGCACAGGGTGCTCCTCA-3′ (reverse). Download references We thank T. Hunter (The Salk Institute for Biological Studies) for Abl and Src knockout cells, H. Clevers (Netherlands Institute for Developmental Biology) for the pTOP-FLASH and the pFOP-FLASH, and Y. Li (Baylor College of Medicine) for a WNT1 lenti-vector. This work was supported by National Cancer Institute grants 5R01CA109035 (Z.L.), 5 P50 CA127001-03 and CA16672 (Cancer Center Support Grant); a research grant (RP110252; Z.L.) from the Cancer Prevention and Research Institute of Texas (CPRIT), an American Cancer Society Research Scholar Award RSG-09-277-01-CSM (Z.L.), and a Sister Institution Network Fund from The University of Texas MD Anderson Cancer Center (Z.L.). Subscribe to comments