Polypropylene Tube Surfaces May Induce Denaturation and Multimerization of DNA
B. P. Belotserkovskii,B. Johnston,C. Gaillard,F. Strauss
DOI: https://doi.org/10.1126/science.271.5246.222
IF: 56.9
1996-01-12
Science
Abstract:except that the nickel column was washed with 100 mM imidazole before elution. 33. Human HRG was extracted from serum by passage over a nickel column, as described (18). It was eluted with 200 mM imidazole and was dialyzed against water for 48 hours with three changes. 34. Recombinant HRP 11(100 pmol) was incubated for 14 hours with 600 nmol of hemin in 500 mM sodium acetate (final volume, 12 ml). Insoluble material was collected by centrifugation as above, and was processed by washing in 2.5% SDS and 0.1 M sodium bicarbonate, then in 2.5% SDS, and finally three times in water. Isolation of parasite hemozoin and production of ,-hematin were as described (4). After lyophilization, each pellet was placed on a sodium chloride disk, and data were acquired for five cycles on a FTIR spectrometer (Perkin-Elmer 1710). 35. RNA was isolated from P. falciparum clone 3B-D5 trophozoites [K. A. Creedon, P. K. Rathod, T. E. Wellems, J. Biol. Chem. 269, 16364 (1994)] and was reverse-transcrbed after extensive deoxyrbonuclease digestion (24). The HRP IV-specific sequence GTAATAGTCCAAAAAGATATTG was used as a primer. This oligonucleotide and one corresponding to the downstream sequence CATCAAATTCTTCTAAGCC were used for polymerase chain reaction amplification; products were analyzed on a 1.3% agarose gel. A control incubation, taken through the same steps but omitting reverse transcriptase, was performed; a band of the predicted size was found from the reverse transcriptase incubation only. Similar reactions with nested prmers also gave bands of the predicted size. 36. We thank D. Taylor for mAbs, T. Wellems for Plasmodium clones 3B-D5 and Dd2, D. Covey for help with FTIR analysis, T. Steinberg for fluorescence microscope use, K. Luker for advice on amino acid analysis, A. Oksman for parasite culture, and S. Francis and D. Minning for critical reading of the manuscript. Supported by NIH grant Al-31615. D.E.G. is a Charies E. Culpeper Medical Scholar.