Developing a One-Step Triplet-Repeat Primed PCR Assay for Diagnosing Myotonic Dystrophy.

Xiaoping Lan,Na Li,Hongling Wan,Lei Luo,Yiming Wu,LI San-xiang,Yu An,Bai-Lin Wu

DOI: https://doi.org/10.1016/j.jgg.2018.06.008

2018-01-01

Abstract:To fix fundamental physics we may need to raise the sterile neutrino from the dead, says Abigail Beall

What problem does this paper attempt to address?

Developing a one-step triplet-repeat primed PCR assay for diagnosing myotonic dystrophy

Xiaoping Lan,Na Li,Hongling Wan,Lintong Luo,Yiming Wu,Sanxiang Li,Yu An,Bai-Lin Wu

DOI: https://doi.org/10.1016/j.jgg.2018.06.008

IF: 5.723

2018-01-01

Journal of Genetics and Genomics

Abstract:Myotonic dystrophy type 1 （DM1）,or Steiner’s disease,is an autosomal dominant disorder caused by the expansion of unstable trinucleotide repeats （CTG） in the 3’ untranslated region of the myotonic dystrophy protein kinase gene （DMPK）（Brook et al.,1992;Mahadevan et al.,1992）.The number of CTG repeats observed in normal individuals is in a range of 5-34,while the individuals with 35-49 CTG repeats are usually asymptomatic but at risk of
Development of a Comprehensive Real-Time PCR Assay for Dystrophin Gene Analysis and Prenatal Diagnosis of Chinese Families.

Ting Zhang,Shaoji Liu,Tianying Wei,Jing Yong,Yuchan Mao,Xiaomei Lu,Jiansheng Xie,Qing Ke,Fan Jin,Ming Qi

DOI: https://doi.org/10.1016/j.cca.2013.05.006

IF: 6.314

2013-01-01

Clinica Chimica Acta

Abstract:Background: To develop a comprehensive method to analyze deletions or duplications of the dystrophin gene in both patients and carriers of Duchenne muscular dystrophy (DMD), likewise applied to prenatal diagnosis.Methods: A total of thirty Chinese families were recruited, composed of 29 DMD affected males and 38 female relatives containing four pregnant women. Deletions were previously screened by multiplex PCR. A comprehensive real-time PCR assay using SYBR Green I dye was performed for the initial detection of duplications in patients with a seven-exon primer set, carrier detection for female relatives and prenatal diagnosis for the 4 of them. The results were later confirmed by multiple ligation-dependent probe amplification (MLPA) and linkage analysis.Results: Three out of 4 duplications were first discovered by real-time PCR. Carrier status was ascertained in 22 and rejected in the remaining sixteen female relatives. Furthermore, 4 fetuses were diagnosed as two normal females, one normal male and one female carrier, respectively.Conclusions: Our real-time PCR assay is useful in duplication screen with a detection rate of > 70%, as well as rapid and reliable in both carrier detection and prenatal diagnosis of DMD families with known deletions and duplications. (c) 2013 Elsevier B.V. All rights reserved.
[Advances in Repeat-Primed PCR Assay for the Genetic Diagnosis of Dynamic Mutation Diseases with Large Pathogenic Expansions].

Sheng Chen,Zhiying Wu

DOI: https://doi.org/10.3724/sp.j.1005.2014.1145

2014-01-01

Abstract:Dynamic mutation diseases are genetic diseases caused by unstable repeat expansions in coding region or noncoding region. The unstable repeat expansions located in the noncoding region usually perform as large expansions which the standard PCR assay is difficult to amplify. Traditional detection methods, including Southern blot, are supposed to be time-consuming and labor-wasting. A new method called fluorescent repeat-primed PCR assay was brought into genetic diagnosis. Here, we reviewed the advances in repeat-primed PCR assay for the genetic diagnoses of myotonic dystrophy, Friedreich's ataxia, SCA10, and amyotrophic lateral sclerosis or frontotemporal dementia caused by C9 or f72 mutations.
Automated DNA Mutation Detection Using Universal Conditions Direct Sequencing: Application to Ten Muscular Dystrophy Genes

Richard R Bennett,Hal E Schneider,Elicia Estrella,Stephanie Burgess,Andrew S Cheng,Caitlin Barrett,Va Lip,Poh San Lai,Yiping Shen,Bai-Lin Wu,Basil T Darras,Alan H Beggs,Louis M Kunkel

DOI: https://doi.org/10.1186/1471-2156-10-66

2009-01-01

BMC Genomic Data

Abstract:Background: One of the most common and efficient methods for detecting mutations in genes is PCR amplification followed by direct sequencing. Until recently, the process of designing PCR assays has been to focus on individual assay parameters rather than concentrating on matching conditions for a set of assays. Primers for each individual assay were selected based on location and sequence concerns. The two primer sequences were then iteratively adjusted to make the individual assays work properly. This generally resulted in groups of assays with different annealing temperatures that required the use of multiple thermal cyclers or multiple passes in a single thermal cycler making diagnostic testing time-consuming, laborious and expensive.These factors have severely hampered diagnostic testing services, leaving many families without an answer for the exact cause of a familial genetic disease. A search of GeneTests for sequencing analysis of the entire coding sequence for genes that are known to cause muscular dystrophies returns only a small list of laboratories that perform comprehensive gene panels.The hypothesis for the study was that a complete set of universal assays can be designed to amplify and sequence any gene or family of genes using computer aided design tools. If true, this would allow automation and optimization of the mutation detection process resulting in reduced cost and increased throughput.Results: An automated process has been developed for the detection of deletions, duplications/insertions and point mutations in any gene or family of genes and has been applied to ten genes known to bear mutations that cause muscular dystrophy: DMD; CAV3; CAPN3; FKRP; TRIM32; LMNA; SGCA; SGCB; SGCG; SGCD. Using this process, mutations have been found in five DMD patients and four LGMD patients (one in the FKRP gene, one in the CAV3 gene, and two likely causative heterozygous pairs of variations in the CAPN3 gene of two other patients). Methods and assay sequences are reported in this paper.Conclusion: This automated process allows laboratories to discover DNA variations in a short time and at low cost.
[Application of triplet-primer PCR technology for the genetic testing and prenatal diagnosis of patients with Myotonic dystrophy type 1]

Chen Chen,Xuechao Zhao,Jingjing Meng,Xiangdong Kong

DOI: https://doi.org/10.3760/cma.j.cn511374-20230919-00144

2024-10-10

Abstract:Objective: To explore the application of triplet-primer PCR (TP-PCR) for the genetic testing and prenatal diagnosis in patients with Myotonic dystrophy type 1 (DM1). Methods: A total of 60 individuals from 48 pedigrees undergoing genetic testing at the Genetic and Prenatal Diagnosis Center of the First Affiliated Hospital of Zhengzhou University from May 2018 to October 2022 were selected as the study subjects. TP-PCR combined with capillary electrophoresis was applied to determine the number of CTG repeats of the DMPK gene, and prenatal testing was provided to four DM1 pedigrees. This study was approved by the First Affiliated Hospital of Zhengzhou University (Ethics No. KS-2018-KY-36). Results: A total of 52 DM1 patients were detected, mostly with muscle weakness, muscular atrophy and myotonia as the initial symptoms, along with typical myotonic potentials. Some patients also had abnormalities of other systems. The number of abnormal CTG repeats of the DMPK gene was > 50, whilst the number of CTG repeats on the normal allele had ranged from 5 to 18. The number of the most common normal CAG repeats was 6 (30.77%, 16/52). Among the four DM1 pedigrees undergoing prenatal diagnosis, one fetus was healthy, whilst three fetuses were found to have abnormal CTG repeats (> 50 times) and diagnosed with DM1. Conclusion: TP-PCR can diagnose DM1 patients with speed and accuracy. However, this method cannot accurately determine the number of CTG repeats when it exceeds 50.
Targeted Next-Generation Sequencing As a Comprehensive Test for Patients with and Female Carriers of DMD/BMD: a Multi-Population Diagnostic Study

Xiaoming Wei,Yi Dai,Ping Yu,Ning Qu,Zhangzhang Lan,Xiafei Hong,Yan Sun,Guanghui Yang,Shuqi Xie,Quan Shi,Hanlin Zhou,Qian Zhu,Yuxing Chu,Fengxia Yao,Jinming Wang,Jingni He,Yun Yang,Yu Liang,Yi Yang,Ming Qi,Ling Yang,Wei Wang,Haitao Wu,Jing Duan,Cheng Shen,Jun Wang,Liying Cui,Xin Yi

DOI: https://doi.org/10.1038/ejhg.2013.82

2013-01-01

European Journal of Human Genetics

Abstract:Duchenne and Becker muscular dystrophies (DMD/BMD) are the most commonly inherited neuromuscular disease. However, accurate and convenient molecular diagnosis cannot be achieved easily because of the enormous size of the dystrophin gene and complex causative mutation spectrum. Such traditional methods as multiplex ligation-dependent probe amplification plus Sanger sequencing require multiple steps to fulfill the diagnosis of DMD/BMD. Here, we introduce a new single-step method for the genetic analysis of DMD patients and female carriers in real clinical settings and demonstrate the validation of its accuracy. A total of 89 patients, 18 female carriers and 245 non-DMD patients were evaluated using our targeted NGS approaches. Compared with traditional methods, our new method yielded 99.99% specificity and 98.96% sensitivity for copy number variations detection and 100% accuracy for the identification of single-nucleotide variation mutations. Additionally, this method is able to detect partial deletions/duplications, thus offering precise personal DMD gene information for gene therapy. We detected novel partial deletions of exons in nine samples for which the breakpoints were located within exonic regions. The results proved that our new method is suitable for routine clinical practice, with shorter turnaround time, higher accuracy, and better insight into comprehensive genetic information (detailed breakpoints) for ensuing gene therapy.
Treatment of Type 1 Myotonic Dystrophy by Engineering Site-specific RNA Endonucleases that Target (CUG)n Repeats

Wenjing Zhang,Yang Wang,Shuyun Dong,Rajarshi Choudhury,Yongfeng Jin,Zefeng Wang

DOI: https://doi.org/10.1038/mt.2013.251

IF: 12.91

2014-01-01

Molecular Therapy

Abstract:Myotonic dystrophy type 1 (DM1) is caused by the expansion of (CTG)n in the 3' untranslated region of the dystrophia myotonica-protein kinase (DMPK) gene, which is transcribed as (CUG)n repeats that accumulate in the nucleus. The RNA repeats specifically sequester or change the expression levels of several RNA-binding proteins, leading to aberrant splicing of many target genes. In this study, we developed artificial site-specific RNA endonucleases (ASREs) that specifically bind and cleave (CUG)n repeats RNA. We have generated one ASRE that can target the expanded RNA repeats in DM1 patient cells and specifically degrade the pathogenic DMPK messenger RNAs with minimal effect on wild-type alleles. Such ASRE treatment significantly decreased the number of nuclear foci in DM1 patient cells and can reverse the missplicing of many genes affected in DM1 patients. Taken together, the application of ASRE provides a new route of gene therapy for DM1 treatment.
Development and Validation of a One-Step SMN Assay for Genetic Testing in Spinal Muscular Atrophy Via MALDI-TOF MS

Xiaodong Xing,Xing Ji,Xinzhu Liu,Xiaohui Jin,Zhenglei He,Ajing Xu,Wengao Jiang,Wenbo Ji,Yan Liu,Jian Zhang,Xiaohui Huang

DOI: https://doi.org/10.1039/d4an01225a

2024-01-01

The Analyst

Abstract:A MALDI-TOF MS-based method for gene testing in spinal muscular atrophy enables precise quantification of SMN copies, while also being capable of simultaneously detecting pathogenic and polymorphic variants.
Identify female carriers and de novo mutations in deletional Duchenne/Becker muscular dystrophy families.

Hai-Yan Zhu,Ling-Qian Wu,De-Sheng Liang,Qian Pan,Jia-Hui Xia

DOI: https://doi.org/10.1016/S0379-4172(06)60041-3

2006-01-01

Acta Genetica Sinica

Abstract:By using multiple polymerase reaction (mPCR) and haploid analysis of 11 short tandem repeats (STRs) in dystrophin gene locus to identify female carriers in deletional DMD/BMD (Duchenne/Becker Muscular Dystrophy) families, valuable information can be gathered for prenatal diagnosis. In this article, de novo mutations were detected in two out of the four patients, and one of the four female members was identified as an obligate DMD gene carrier based on the haplotype analysis. Multiple PCR and STRs haploid linkage analysis are rapid, accurate, objective methods to identify female member status, and well suited for routine use in clinical laboratories engaged in DMD/BMD research for counseling, gene diagnosis and prenatal diagnosis. During mPCR analysis, the amplicon of exon 45 showed different electrophoresis mobility in different kinds of gels. Polyacrylamide Gels Elec trophoresis (PAGE) was accurate and rapid for analyzing the products of mPCR, but the mobility of different amplicons need to be considered in data analysis.
Studies of the Haplotypes of CTG Triplet Repeat and Alu±1kb in DMPK Gene of Myotonic Dystrophy

XIAO Cui-ying,WU Hui,PAN A-gen,ZHANG Si-zhong

DOI: https://doi.org/10.3321/j.issn:0253-9772.2000.02.006

2000-01-01

Hereditas

Abstract:Myotonic dystrophy (DM), an autosomal dominant disease of the neuromascular system, is caused by expansion of the CTG repeats in the 3^ untranslated region of the DMPK gene. In the eighth intron of this gene, there is another polymorphism-the insertion/deletion of 1kb Alu repeat(Alu±1kb). In order to help elucidate the origin of DM mutation in Chinese Han patients, and explain the difference of incidence of DM in different populations, 60 normal Han individuals were randomly chosen from 300 Chinese, whose CTG copy number had been previously ascertained. The polymorphism of Alu±1kb of the 60 cases were firstly analyzed by in vitro amplification; then the 22 cases in which both sites were heterozygous were analyzed.
New Multiplex Real-Time PCR Approach to Detect Gene Mutations for Spinal Muscular Atrophy

Zhidai Liu,Penghui Zhang,Xiaoyan He,Shan Liu,Shi Tang,Rong Zhang,Xinbin Wang,Junjie Tan,Bin Peng,Li Jiang,Siqi Hong,Lin Zou

DOI: https://doi.org/10.1186/s12883-016-0651-y

2016-01-01

BMC Neurology

Abstract:Background: Spinal muscular atrophy (SMA) is the most common autosomal recessive disease in children, and the diagnosis is complicated and difficult, especially at early stage. Early diagnosis of SMA is able to improve the outcome of SMA patients. In our study, Real-time PCR was developed to measure the gene mutation or deletion of key genes for SMA and to further analyse genotype-phenotype correlation.Methods: The multiple real-time PCR for detecting the mutations of survival of motor neuron (SMN), apoptosis inhibitory protein (NAIP) and general transcription factor IIH, polypeptide 2 gene (GTF2H2) was established and confirmed by DNA sequencing and multiplex ligation-dependent probe amplification (MLPA). The diagnosis and prognosis of 141 hospitalized children, 100 normal children and further 2000 cases of dry blood spot (DBS) samples were analysed by this multiple real-time PCR.Results: The multiple real-time PCR was established and the accuracy of it to detect the mutations of SMN, NAIP and GTF2H2 was at least 98.8 % comparing with DNA sequencing and MLPA. Among 141 limb movement disorders children, 75 cases were SMA. 71 cases of SMA (94.67 %) were with SMN c.840 mutation, 9 cases (12 %) with NAIP deletion and 3 cases (4 %) with GTF2H2 deletion. The multiple real-time PCR was able to diagnose and predict the prognosis of SMA patients. Simultaneously, the real-time PCR was applied to detect trace DNA from DBS and able to make an early diagnosis of SMA.Conclusion: The clinical and molecular characteristics of SMA in Southwest of China were presented. Our work provides a novel way for detecting SMA in children by using real-time PCR and the potential usage in newborn screening for early diagnosis of SMA.
Long Distance Multiple-Site Directed Plasmid Mutagenesis by One-Step PCR Using Non-overlapped Primers

Yuling Bu,Hui Wang,Jing Li,Zhaoxin Zhang,Yinghe Hu,Zhiliang Xu

DOI: https://doi.org/10.1007/s12033-013-9665-5

2013-01-01

Molecular Biotechnology

Abstract:Site-directed mutagenesis is a very important technique in molecular biological researches. We have developed a new method for long distance multiple-site plasmid mutation by one-step PCR using non-overlap primers. These primers were carefully designed and contained desired mutations in the middle of the primers flanked with 18–25 bp of correct sequence. One pair of the primers was able to generate a short megaprimer. Decreases in the concentrations of these primers increased efficiency of the multiple-site plasmid mutation. All of the mutant PCRs were performed at a common annealing temperature at 55 °C. This method could be widely used in all multiple-site plasmid mutations.
Towards development of a statistical framework to evaluate myotonic dystrophy type 1 mRNA biomarkers in the context of a clinical trial

Adam Kurkiewicz,Anneli Cooper,Emily McIlwaine,Sarah A Cumming,Berit Adam,Ralf Krahe,Jack Puymirat,Benedikt Schoser,Lubov Timchenko,Tetsuo Ashizawa,Charles A Thornton,Simon Rogers,John D McClure,Darren G Monckton

DOI: https://doi.org/10.1371/journal.pone.0231000

IF: 3.7

2020-04-14

PLoS ONE

Abstract:Myotonic dystrophy type 1 (DM1) is a rare genetic disorder, characterised by muscular dystrophy, myotonia, and other symptoms. DM1 is caused by the expansion of a CTG repeat in the 3'-untranslated region of DMPK. Longer CTG expansions are associated with greater symptom severity and earlier age at onset. The primary mechanism of pathogenesis is thought to be mediated by a gain of function of the CUG-containing RNA, that leads to trans-dysregulation of RNA metabolism of many other genes. Specifically, the alternative splicing (AS) and alternative polyadenylation (APA) of many genes is known to be disrupted. In the context of clinical trials of emerging DM1 treatments, it is important to be able to objectively quantify treatment efficacy at the level of molecular biomarkers. We show how previously described candidate mRNA biomarkers can be used to model an effective reduction in CTG length, using modern high-dimensional statistics (machine learning), and a blood and muscle mRNA microarray dataset. We show how this model could be used to detect treatment effects in the context of a clinical trial.
A Resolved Discrepancy Between Multiplex PCR and Multiplex Ligation‐dependent Probe Amplification by Targeted Next‐generation Sequencing Discloses a Novel Partial Exonic Deletion in the Duchenne Muscular Dystrophy Gene

Chang Liu,Huiting Deng,Cheng Yang,Xixi Li,Yanrong Zhu,Xiangfa Chen,Hui Li,Shuo Li,Hao Cui,Xiaoyan Zhang,Xiaoyue Tan,Dong Li,Zhujun Zhang

DOI: https://doi.org/10.1002/jcla.22575

IF: 3.124

2018-01-01

Journal of Clinical Laboratory Analysis

Abstract:The genetic diagnosis of Duchenne muscular dystrophy (DMD) has been complicated by the large size of the gene and its heterogeneous mutational spectrum. Multiplex PCR and multiplex ligation‐dependent probe amplification (MLPA) are two well‐established mutation screening methods. Here, we applied targeted next‐generation sequencing (NGS) to clarify discrepant results between multiplex PCR and MLPA in a Chinese patient with DMD.
Single-Tube Multiplex Digital Polymerase Chain Reaction Assay for Molecular Diagnosis and Prediction of Severity of Spinal Muscular Atrophy.

Chianru Tan,Yousheng Yan,Na Guo,Fang Wang,Songtao Wang,Lingxiang Zhu,Yipeng Wang,Yinan Ma,Yong Guo

DOI: https://doi.org/10.1021/acs.analchem.1c04403

IF: 7.4

2022-01-01

Analytical Chemistry

Abstract:Spinal muscular atrophy (SMA) is an autosomal recessive neuromuscular disease characterized by the degeneration of motor neurons and progressive muscle atrophy. Accurate detection of SMN1 and SMN2 copy numbers is essential for SMA diagnosis, carrier screening, disease severity prediction, therapy, and prognosis. However, a method for SMN1 and SMN2 copy number determination that is simultaneously accurate, simple, rapid, multitargeted, and applicable to various samples has not previously been reported. Here, we developed a single-tube multiplex digital polymerase chain reaction (dPCR) assay for simultaneous determination of the copy numbers of SMN1 exons 7 and 8 and SMN2 exons 7 and 8. A total of 317 clinical samples, including peripheral blood, amniotic fluid, chorionic villus, buccal swabs, and dried blood spots, were collected to evaluate the performance of this dPCR-based assay. The test results were accurate for all the clinical samples. Our assay is accurate, rapid, easy to handle, and applicable to many types of samples and uses a small amount of DNA; it is a powerful tool for SMA molecular diagnosis, large-scale screening, and disease severity assessment.
A Novel Pcr Strategy for High-Efficiency, Automated Site-Directed Mutagenesis

W Wu,ZC Jia,P Liu,ZG Xie,Q Wei

DOI: https://doi.org/10.1093/nar/gni115

IF: 14.9

2005-01-01

Nucleic Acids Research

Abstract:We have developed a novel three-primer, one-step PCR-based method for site-directed mutagenesis. This method takes advantage of the fact that template plasmid DNA cannot be efficiently denatured at its reannealing temperature (T-ra), which is otherwise a troublesome problem in regular PCR. Two flanking primers and one mutagenic primer with different melting temperatures (T-m) are used together in a single PCR tube continuously without any intervention. A single-stranded mutagenic DNA (smDNA) is synthesized utilizing the high T-m mutagenic primer at a high annealing temperature, which prevents the priming of the low T-m primers (i.e. the two flanking primers). A megaprimer is then produced using this smDNA as the template at a denaturing temperature that prevents wild-type template DNA activity. The desired mutant DNA is then obtained by cycling again through these first two steps, resulting in a mutagenic efficiency of 100% in all tested cases. This highly automated method not only eliminates the necessity of any intermediate manipulation and accomplishes the mutagenesis process in a single round of PCR but, most notably, enables complete success of mutagenesis. This novel method is also both cost and time efficient and fully automated.
Application of a Multiplex Ligation-Dependent Probe Amplification-Based Next-Generation Sequencing Approach for the Detection of Pathogenesis of Duchenne Muscular Dystrophy and Spinal Muscular Atrophy Caused by Copy Number Aberrations

Yongchen Yang,Chaoran Xia,Xiaozhen Song,Xiaojun Tang,Xueling Nie,Wuhen Xu,Chengkan Du,Hong Zhang,Peng Luo

DOI: https://doi.org/10.1007/s12035-023-03572-9

IF: 5.682

2023-08-19

Molecular Neurobiology

Abstract:Abstract Both Duchenne muscular dystrophy (DMD; OMIM no. 310200) and spinal muscular atrophy (SMA; OMIM no. 253300/253550/253400/271150) are genetic disorders characterized by progressive muscle degeneration and weakness. Genetic copy number aberrations in the pathogenetic genes DMD and SMN1 lead to alterations in functional proteins, resulting in DMD and SMA, respectively. Multiplex ligation-dependent probe amplification (MLPA) has become a standard method for the detection of common copy number aberrations (CNAs), including DMD and SMN1 deletions, both of which are associated with poor clinical outcomes. However, traditional MLPA assays only accommodate a maximum of 60 MLPA probes per test. To increase the number of targeted sequences in one assay, an MLPA-based next-generation sequencing (NGS) assay has been developed that is based on the standard MLPA procedure, allows high-throughput screening for a large number of fragments and samples by integrating additional indices for detection, and can be analyzed on all Illumina NGS platforms.

neurosciences
A single multiplex PCR and Single Nucleotide Extension Assay for the detection of common Thanatophoric dysplasia I and II mutations.

Mohamed A. Jama,N. Scott Reading,Eric Fredrickson,Sherin Shaaban,Yuan Ji

DOI: https://doi.org/10.1016/j.jmoldx.2024.08.008

IF: 5.341

2024-10-02

Journal of Molecular Diagnostics

Abstract:Mutation analysis is used to provide confirmation of a clinical and radiological diagnosis of Thanatophoric dysplasia types I and II (TDI & II). We developed a single multiplexed PCR and a single nucleotide extension (SNE) assay to identify 14 common mutations causing 99% of TD I and TD II, including the challenging three adjacent mutations in the stop codon of exon 18 of the FGFR3 gene. The assay design also provides a solution for resolving SNE PCR product sizing using performance optimized polymer-7 (POP-7).The assay was validated using thirty-seven previously characterized, de-identified patient samples representing the nine wild-types and 10/14 mutant genotypes. Four artificial templates were synthesized to mimic four TD I mutations not represented in the available patient samples. Fragment size and fluorophore channel for each SNE product from 10 samples and the four artificial templates were used to define bins and panels for analysis with GeneMarker v3.0 and GeneMapper v6.0 software. Allele calls (bin placement within the panels) were verified using the remaining 27 previously characterized samples.This TD I and II PCR and SNE assay is a robust multiplexed assay, streamlined, to identify 14 mutations in one single reaction. Turnaround time required for this assay performance and analysis is decreased in comparison to traditional Sanger or next generation sequencing.

pathology
Comparion of CTG trinucleotide repeat numbers in blood and muscle tissues of myotoonic dystrophy

谢惠君,郑惠民,张社卿,邓本强,许金明,崔毅,王晔,许谆,任大明

DOI: https://doi.org/10.3321/j.issn:1673-8225.2002.01.025

2002-01-01

Abstract:Objective: To observe and compare CTG trinucleotide repeat numbers, in the 3'-untranslated region of the myotonin protein kinase (MTPK) gene in blood and muscle tissues of five patients and a doubted individual with myotonic dystrophy (DM) to find which tissue is best reflected dynamic mutation of DM. Method: In five patients and a doubted individual with DM, CTG trinucleotide repeat numbers located in the 3' untranslated region of MTPK on chromosome 19q13. 2-3 were analyzed by using Long Expand TM Template PCR system. Result: CTG repeat numbers were expanded in four of five patients' blood samples and three of five patients' muscle samples, and in one equivocal indivedual with DM, copies of CTG trinucleotide of blood and muscle tissues were expanded. Conclusion: Copies of CTG trinucleotide analysed from peripheral blood while cells is also sensitive and exact, which may reflect dynamic mutation of DM. Analysis of CTG repeat numbers from blood is available.
Detection of duplication mutation and carriers of Duchenne/Becker muscular dystrophy by multiplex ligation-dependent probe amplification quantitative

Qi-fang LIN,Wan-jin CHEN,Ning WANG,Zhi-ying WU,Min-ting LIN,Shen-xing MURONG

DOI: https://doi.org/10.3760/cma.j.issn.1006-7876.2011.08.015

2011-01-01

Abstract:Objective To analyze the dystrophin gene in patients with Duchenne/Becker muscular dystrophy (DMD/BMD) and their family members by multiplex ligation-dependent probe amplification (MLPA) method and to evaluate the application of this method in the mutations detection. Methods The whole dystrophin gene (79 exons) was analyzed by MLPA in 355 patients with DMD/BMD, the mothers of 46 patients with deletion mutation and the mothers of 8 patients with duplication mutation. The results were verified by PCR and sequencing when single exon deletion was found. Results One hundred and ninety cases were found to have deletion of one or more dystrophin exons, and 34 patients were identified to have duplication mutations. In 46 mothers of patients with deletion mutations, 28 were identified the mutations;and of 8 mothers of patients with duplication mutations, 6 were identified the mutations. There was no statistical significance between the carrier incidences in the 2 groups. A 23 bp deletion of "AGGGAACAGATCCTGGTAAAGCA" fragment in exon 17 was found in a patient. Conclusions Comparing with the traditional quantitative methods, MLPA can detect the deletion and duplication mutation in all the 79 exons of dystrophin gene in DMD/BMD patients, and can identify the carrier status in their family members. Furthermore, MLPA is not apt to be interfered by the concentration and purity of DNA template.

Developing a One-Step Triplet-Repeat Primed PCR Assay for Diagnosing Myotonic Dystrophy.

Developing a one-step triplet-repeat primed PCR assay for diagnosing myotonic dystrophy

Development of a Comprehensive Real-Time PCR Assay for Dystrophin Gene Analysis and Prenatal Diagnosis of Chinese Families.

[Advances in Repeat-Primed PCR Assay for the Genetic Diagnosis of Dynamic Mutation Diseases with Large Pathogenic Expansions].

Automated DNA Mutation Detection Using Universal Conditions Direct Sequencing: Application to Ten Muscular Dystrophy Genes

[Application of triplet-primer PCR technology for the genetic testing and prenatal diagnosis of patients with Myotonic dystrophy type 1]

Targeted Next-Generation Sequencing As a Comprehensive Test for Patients with and Female Carriers of DMD/BMD: a Multi-Population Diagnostic Study

Treatment of Type 1 Myotonic Dystrophy by Engineering Site-specific RNA Endonucleases that Target (CUG)n Repeats

Development and Validation of a One-Step SMN Assay for Genetic Testing in Spinal Muscular Atrophy Via MALDI-TOF MS

Identify female carriers and de novo mutations in deletional Duchenne/Becker muscular dystrophy families.

Studies of the Haplotypes of CTG Triplet Repeat and Alu±1kb in DMPK Gene of Myotonic Dystrophy

New Multiplex Real-Time PCR Approach to Detect Gene Mutations for Spinal Muscular Atrophy

Long Distance Multiple-Site Directed Plasmid Mutagenesis by One-Step PCR Using Non-overlapped Primers

Towards development of a statistical framework to evaluate myotonic dystrophy type 1 mRNA biomarkers in the context of a clinical trial

A Resolved Discrepancy Between Multiplex PCR and Multiplex Ligation‐dependent Probe Amplification by Targeted Next‐generation Sequencing Discloses a Novel Partial Exonic Deletion in the Duchenne Muscular Dystrophy Gene

Single-Tube Multiplex Digital Polymerase Chain Reaction Assay for Molecular Diagnosis and Prediction of Severity of Spinal Muscular Atrophy.

A Novel Pcr Strategy for High-Efficiency, Automated Site-Directed Mutagenesis

Application of a Multiplex Ligation-Dependent Probe Amplification-Based Next-Generation Sequencing Approach for the Detection of Pathogenesis of Duchenne Muscular Dystrophy and Spinal Muscular Atrophy Caused by Copy Number Aberrations

A single multiplex PCR and Single Nucleotide Extension Assay for the detection of common Thanatophoric dysplasia I and II mutations.

Comparion of CTG trinucleotide repeat numbers in blood and muscle tissues of myotoonic dystrophy

Detection of duplication mutation and carriers of Duchenne/Becker muscular dystrophy by multiplex ligation-dependent probe amplification quantitative