MiR-17-5p and MKL-1 Modulate Stem Cell Characteristics of Gastric Cancer Cells: Erratum

Zhou‐Tong Dai,Yuan Xiang,Yuanyuan Duan,Jun Wang,Jia Peng Li,Huimin Zhang,Chao Cheng,Qiong Wang,Tongcun Zhang,Xing‐Hua Liao

DOI: https://doi.org/10.7150/ijbs.73846

2022-01-01

International Journal of Biological Sciences

Abstract:[This corrects the article DOI: 10.7150/ijbs.57338.].

What problem does this paper attempt to address?

miR-199a-3p/5p regulate tumorgenesis via targeting Rheb in non-small cell lung cancer: Erratum

Xiaomin Liu,Xianyi Wang,Binshu Chai,Zong Wu,Zhenyu Gu,Heng Zou,Hui Zhang,Yanli Li,Qiangling Sun,Wentao Fang,Zhongliang Ma

DOI: https://doi.org/10.7150/ijbs.86344

2023-01-01

International Journal of Biological Sciences

Abstract:[This corrects the article DOI: 10.7150/ijbs.70312.].
Erratum: Suppression of RNA editing by miR-17 inhibits the stemness of melanoma stem cells

Yu Zhang,Xiaoyuan Yang,Yalei Cui,Xiaobo Zhang

DOI: https://doi.org/10.1016/j.omtn.2024.102288

2024-07-30

Abstract:[This corrects the article DOI: 10.1016/j.omtn.2021.12.021.].
Involvement of miR-619-5p in resistance to cisplatin by regulating ATXN3 in oral squamous cell carcinoma: Erratum

An Song,Yuanyuan Wu,Weiming Chu,Xueming Yang,Zaiou Zhu,Enshi Yan,Wei Zhang,Junbo Zhou,Xu Ding,Jie Liu,Hongxia Zhu,Jinhai Ye,Yunong Wu,Yang Zheng,Xiaomeng Song

DOI: https://doi.org/10.7150/ijbs.94832

2024-01-01

International Journal of Biological Sciences

Abstract:[This corrects the article DOI: 10.7150/ijbs.54014.].

biochemistry & molecular biology
Erratum: circPTCH1 promotes invasion and metastasis in renal cell carcinoma via regulating miR-485-5p/MMP14 axis: Erratum.

Huan Liu,Guanghui Hu,Zaoyu Wang,Qunlong Liu,Jin Zhang,Yonghui Chen,Yiran Huang,Wei Xue,Yunfei Xu,Wei Zhai

DOI: https://doi.org/10.7150/thno.69378

IF: 11.6

2022-01-01

Theranostics

Abstract:[This corrects the article DOI: 10.7150/thno.47239.].
Activation of the PI3K/Akt/mTOR/p70S6K Pathway is Involved in S100A4-Induced Viability and Migration in Colorectal Cancer Cells: Erratum

Haiyan Wang,Liang Duan,Zhengyu Zou,Huan Li,Shimei Yuan,Xian Chen,Yunyuan Zhang,Xueru Li,Hui Sun,He Zha,Yan Zhang,Lan Zhou

DOI: https://doi.org/10.7150/ijms.69070

2022-01-01

International Journal of Medical Sciences

Abstract:[This corrects the article DOI: 10.7150/ijms.8128.].

medicine, general & internal
Erratum: CircCCNB1 silencing acting as a miR-106b-5p sponge inhibited GPM6A expression to promote HCC progression by enhancing DYNC1I1 expression and activating the AKT/ERK signaling pathway: Erratum.

Yan-Ming Liu,Yue Cao,Ping-Sen Zhao,Liang-Yin Wu,Ya-Min Lu,Yu-Long Wang,Jia-Feng Zhao,Xin-Guang Liu

DOI: https://doi.org/10.7150/ijbs.72651

2022-01-01

International Journal of Biological Sciences

Abstract:[This corrects the article DOI: 10.7150/ijbs.66915.].
The tumor suppressive miR-302c-3p inhibits migration and invasion of hepatocellular carcinoma cells by targeting TRAF4: Erratum

Liu Yang,Yang Guo,Xin Liu,Tongtong Wang,Xiangmin Tong,Kefeng Lei,Jiahui Wang,Dongsheng Huang,Qiuran Xu

DOI: https://doi.org/10.7150/jca.76866

IF: 3.9

2022-01-01

Journal of Cancer

Abstract:[This corrects the article DOI: 10.7150/jca.25569.].

oncology
Erratum: CircNT5E promotes the proliferation and migration of bladder cancer via sponging miR-502-5p: Erratum

Jinhui Yang,Xiaoyun Liu,Guangcheng Dai,Lanying Qu,Bo Tan,Bo Zhu,Fuming Qi,Xinyu Gai,Bo Cheng

DOI: https://doi.org/10.7150/jca.93985

2024-04-11

Abstract:[This corrects the article DOI: 10.7150/jca.53385.].
Erratum: Mesenchymal Stem Cell-Based NK4 Gene Therapy in Nude Mice Bearing Gastric Cancer Xenografts [Corrigendum]

DOI: https://doi.org/10.2147/DDDT.S493671

2024-10-07

Abstract:[This corrects the article DOI: 10.2147/DDDT.S71466.].
Erratum: MicroRNA-449a Inhibits Tumor Metastasis through AKT/ERK1/2 Inactivation by Targeting Steroid Receptor Coactivator (SRC) in Endometrial Cancer: Erratum.

Yuan Hu,An-Yue Wu,Cong Xu,Ke-Qi Song,Wen-Jing Wang,Xia Yin,Wen Di,Zu-Bei Hong,Li-Hua Qiu

DOI: https://doi.org/10.7150/jca.92673

IF: 3.9

2023-01-01

Journal of Cancer

Abstract:[This corrects the article DOI: 10.7150/jca.27748.].
MicroRNA-23a-3p Inhibits Mucosal Melanoma Growth and Progression through Targeting Adenylate Cyclase 1 and Attenuating cAMP and MAPK Pathways: Erratum

Meng Ma,Jie Dai,Huan Tang,Tianxiao Xu,Sifan Yu,Lu Si,Chuanliang Cui,Xinan Sheng,Zhihong Chi,Lili Mao,Xiaowen Wu,Lu Yang,Huan Yu,Siming Li,Bin Lian,Bixiang Tang,Xuan Wang,Xieqiao Yan,Xue Bai,Li Zhou,Yan Kong,Jun Guo

DOI: https://doi.org/10.7150/thno.72945

IF: 11.6

2022-01-01

Theranostics

Abstract:[This corrects the article DOI: 10.7150/thno.30516.].

medicine, research & experimental
[Corrigendum] Knockdown of circ_0067934 inhibits gastric cancer cell proliferation, migration and invasion via the miR‑1301‑3p/KIF23 axis

Jin Xu,Nan Sang,Junning Zhao,Wei He,Nannan Zhang,Xueliang Li

DOI: https://doi.org/10.3892/mmr.2024.13307

Abstract:Following the publication of the above article, an interested reader drew to our attention the fact that the forward primer reported in Table I on p. 3 for miR‑545‑3p (5'‑TGGCTCAGTTCAGCAGGAAC‑3') was actually for miR‑24‑3p (5'‑UGGCUCAGUUCAGCAGGAACAG‑3'). Upon performing an independent analysis of the primer sequences in the Editorial Office, the sequence presented for miR‑670‑5p also appeared to have potentially been written incorrectly. After having drawn these matters to the attention of the authors, they realized that these sequences had indeed been written incorrectly in Table I. The corrected version of Table I, featuring the correct forward and reverse primer sequences for both miR‑670‑5p and miR‑545‑3p, is shown opposite. The authors wish to thank the interested reader for drawing this error to their attention, and are grateful to the Editor of Molecular Medicine Reports for allowing them this opportunity to publish a Corrigendum. They also apologize to the readership for any inconvenience caused. [Molecular Medicine Reports 25: 202, 2022; DOI: 10.3892/mmr.2022.12718].
Correction: ZFPM2-AS1, a Novel Lncrna, Attenuates the P53 Pathway and Promotes Gastric Carcinogenesis by Stabilizing MIF.

Fanyang Kong,Xuan Deng,Xiangyu Kong,Yiqi Du,Lei Li,Huiyun Zhu,Yuxin Wang,Dacheng Xie,Shivani Guha,Zhaoshen Li,Ming Guan,Keping Xie

DOI: https://doi.org/10.1038/s41388-018-0412-z

IF: 8.756

2018-01-01

Oncogene

Abstract:Since the online publication of the above article, the authors have noted errors in the affiliations. The authors apologise for any inconvenience caused by this error. The html and online pdf versions have now been rectified and carry the corrected paper.
Correction To: MiR-139-5p Inhibits Migration and Invasion of Colorectal Cancer by Downregulating AMFR and NOTCH1

Mingxu Song,Yuan Yin,Jiwei Zhang,Binbin Zhang,Zehua Bian,Chao Quan,Leyuan Zhou,Yaling Hu,Qifeng Wang,Shujuan Ni,Bojian Fei,Weili Wang,Xiang Du,Hua Dong,Zhaohui Huang

DOI: https://doi.org/10.1007/s13238-021-00826-x

2021-01-01

Protein & Cell

Abstract:In the original publication the display of Fig. 1 is incorrect. The correct figure is available in this correction.
Corrigendum to “miR-486 Promotes the Invasion and Cell Cycle Progression of Ovarian Cancer Cells by Targeting CADM1”

Hao Wang,Chenyang Li,Yunxia Wang,Nan Li,Yanli Qin,Yesheng Wang

DOI: https://doi.org/10.1155/2021/9868462

2021-12-24

Analytical Cellular Pathology

Abstract:[This corrects the article DOI: 10.1155/2021/7407086.].

oncology,pathology,cell biology
Erratum: [Corrigendum] miR‑216a‑5p acts as an oncogene in renal cell carcinoma.

Peijie Chen,Jing Quan,Lu Jin,Canbin Lin,Weijie Xu,Jinling Xu,Xin Guan,Zebo Chen,Liangchao Ni,Shangqi Yang,Yun Chen,Yongqing Lai

DOI: https://doi.org/10.3892/etm.2024.12443

IF: 2.7

2024-01-01

Experimental and Therapeutic Medicine

Abstract:[This corrects the article DOI: 10.3892/etm.2018.5881.].
Erratum: Shrimp miR-34 from Shrimp Stress Response to Virus Infection Suppresses Tumorigenesis of Breast Cancer

Yalei Cui,Xiaoyuan Yang,Xiaobo Zhang

DOI: https://doi.org/10.1016/j.omtn.2024.102287

2024-07-25

Abstract:[This corrects the article DOI: 10.1016/j.omtn.2017.10.016.].
Overexpression of lncRNA H19/miR-675 promotes tumorigenesis in head and neck squamous cell carcinoma: Erratum

Guo-fang Guan,De-jun Zhang,Lian-ji Wen,Ding Xin,Yan Liu,Duo-jiao Yu,Kai Su,Lin Zhu,Ying-yuan Guo,Ke Wang

DOI: https://doi.org/10.7150/ijms.73148

2022-01-01

International Journal of Medical Sciences

Abstract:[This corrects the article DOI: 10.7150/ijms.16571.].

medicine, general & internal
Myeloid cell-derived LL-37 promotes lung cancer growth by activating Wnt/β-catenin signaling: Erratum

Ping Ji,Yongxin Zhou,Yibao Yang,Junlu Wu,Hao Zhou,Wenqiang Quan,Junjun Sun,Yiwen Yao,Anquan Shang,Chenzheng Gu,Bingjie Zeng,Jenni Firrman,Weidong Xiao,Robert Bals,Zujun Sun,Dong Li

DOI: https://doi.org/10.7150/thno.82877

IF: 11.6

2023-01-01

Theranostics

Abstract:[This corrects the article DOI: 10.7150/thno.30726.].

medicine, research & experimental
PIWIL3/OIP5-AS1/miR-367-3p/CEBPA feedback loop regulates the biological behavior of glioma cells: Erratum

Xiaobai Liu,Jian Zheng,Yixue Xue,Hai Yu,Wei Gong,Ping Wang,Zhen Li,Yunhui Liu

DOI: https://doi.org/10.7150/thno.69398

IF: 11.6

2022-01-01

Theranostics

Abstract:[This corrects the article DOI: 10.7150/thno.21740.].

medicine, research & experimental

MiR-17-5p and MKL-1 Modulate Stem Cell Characteristics of Gastric Cancer Cells: Erratum

miR-199a-3p/5p regulate tumorgenesis via targeting Rheb in non-small cell lung cancer: Erratum

Erratum: Suppression of RNA editing by miR-17 inhibits the stemness of melanoma stem cells

Involvement of miR-619-5p in resistance to cisplatin by regulating ATXN3 in oral squamous cell carcinoma: Erratum

Erratum: circPTCH1 promotes invasion and metastasis in renal cell carcinoma via regulating miR-485-5p/MMP14 axis: Erratum.

Activation of the PI3K/Akt/mTOR/p70S6K Pathway is Involved in S100A4-Induced Viability and Migration in Colorectal Cancer Cells: Erratum

Erratum: CircCCNB1 silencing acting as a miR-106b-5p sponge inhibited GPM6A expression to promote HCC progression by enhancing DYNC1I1 expression and activating the AKT/ERK signaling pathway: Erratum.

The tumor suppressive miR-302c-3p inhibits migration and invasion of hepatocellular carcinoma cells by targeting TRAF4: Erratum

Erratum: CircNT5E promotes the proliferation and migration of bladder cancer via sponging miR-502-5p: Erratum

Erratum: Mesenchymal Stem Cell-Based NK4 Gene Therapy in Nude Mice Bearing Gastric Cancer Xenografts [Corrigendum]

Erratum: MicroRNA-449a Inhibits Tumor Metastasis through AKT/ERK1/2 Inactivation by Targeting Steroid Receptor Coactivator (SRC) in Endometrial Cancer: Erratum.

MicroRNA-23a-3p Inhibits Mucosal Melanoma Growth and Progression through Targeting Adenylate Cyclase 1 and Attenuating cAMP and MAPK Pathways: Erratum

[Corrigendum] Knockdown of circ_0067934 inhibits gastric cancer cell proliferation, migration and invasion via the miR‑1301‑3p/KIF23 axis

Correction: ZFPM2-AS1, a Novel Lncrna, Attenuates the P53 Pathway and Promotes Gastric Carcinogenesis by Stabilizing MIF.

Correction To: MiR-139-5p Inhibits Migration and Invasion of Colorectal Cancer by Downregulating AMFR and NOTCH1

Corrigendum to “miR-486 Promotes the Invasion and Cell Cycle Progression of Ovarian Cancer Cells by Targeting CADM1”

Erratum: [Corrigendum] miR‑216a‑5p acts as an oncogene in renal cell carcinoma.

Erratum: Shrimp miR-34 from Shrimp Stress Response to Virus Infection Suppresses Tumorigenesis of Breast Cancer

Overexpression of lncRNA H19/miR-675 promotes tumorigenesis in head and neck squamous cell carcinoma: Erratum

Myeloid cell-derived LL-37 promotes lung cancer growth by activating Wnt/β-catenin signaling: Erratum

PIWIL3/OIP5-AS1/miR-367-3p/CEBPA feedback loop regulates the biological behavior of glioma cells: Erratum