Correction To: Gene Mutation Spectrum and Genotype-Phenotype Correlation in a Cohort of Chinese Osteogenesis Imperfecta Patients Revealed by Targeted Next Generation Sequencing

Y. Liu,Asan,D. Ma,F. Lv,X. Xu,J. Wang,W. Xia,Y. Jiang,O. Wang,X. Xing,W. Yu,J. Sun,L. Song,Y. Zhu,H. Yang,M. Li
DOI: https://doi.org/10.1007/s00198-017-4250-6
2017-01-01
Osteoporosis International
Abstract:In Table 2: Family 6 should be c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCCGAGG instead of c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCC. Family 33 should be c.271_279dupGCCCTCTCG instead of c.271_279dupGCCCTCT. In the 2nd para. of the Molecular diagnosis, section t(5;8)(q32;q21) should be t(5;7)(q32;q21).
What problem does this paper attempt to address?