Molecular Cloning and Functional Characterization of a Cell-permeable Superoxide Dismutase Targeted to Lung Adenocarcinoma Cells

Min Lu,Xingguo Gong,Yuwen Lu,Jianjun Guo,Chenhui Wang,Yuanjiang Pan

DOI: https://doi.org/10.1074/jbc.m600523200

IF: 5.485

2006-01-01

Journal of Biological Chemistry

Abstract:In clinical oncology, many trials with superoxide dismutase (SOD) have failed to demonstrate antitumor ability and in many cases even caused deleterious effects because of low tumor-targeting ability. In the current research, the Nostoc commune Fe-SOD coding sequence was amplified from genomic DNA. In addition, the single chain variable fragment (ScFv) was constructed from the cDNA of an LC-1 hybridoma cell line secreting anti-lung adenocarcinoma monoclonal antibody. After modification, the SOD and ScFv were fused and co-expressed, and the resulting fusion protein produced SOD and LC-1 antibody activity. Tracing SOD-ScFv by fluorescein isothiocyanate and superoxide anions (O2·¯) in SPC-A-1 cells showed that the fusion protein could recognize and enter SPC-A-1 cells to eliminate O2·¯. The lower oxidative stress resulting from the decrease in cellular O2·¯ delayed the cell cycle at G1 and significantly slowed SPC-A-1 cell growth in association with the dephosphorylation of the serine-threonine protein kinase Akt and expression of p27kip1. The tumor-targeting fusion protein resulting from this research overcomes two disadvantages of SODs previously used in the clinical setting, the inability to target tumor cells or permeate the cell membrane. These findings lay the groundwork for development of an efficient antitumor drug targeted by the ScFv. In clinical oncology, many trials with superoxide dismutase (SOD) have failed to demonstrate antitumor ability and in many cases even caused deleterious effects because of low tumor-targeting ability. In the current research, the Nostoc commune Fe-SOD coding sequence was amplified from genomic DNA. In addition, the single chain variable fragment (ScFv) was constructed from the cDNA of an LC-1 hybridoma cell line secreting anti-lung adenocarcinoma monoclonal antibody. After modification, the SOD and ScFv were fused and co-expressed, and the resulting fusion protein produced SOD and LC-1 antibody activity. Tracing SOD-ScFv by fluorescein isothiocyanate and superoxide anions (O2·¯) in SPC-A-1 cells showed that the fusion protein could recognize and enter SPC-A-1 cells to eliminate O2·¯. The lower oxidative stress resulting from the decrease in cellular O2·¯ delayed the cell cycle at G1 and significantly slowed SPC-A-1 cell growth in association with the dephosphorylation of the serine-threonine protein kinase Akt and expression of p27kip1. The tumor-targeting fusion protein resulting from this research overcomes two disadvantages of SODs previously used in the clinical setting, the inability to target tumor cells or permeate the cell membrane. These findings lay the groundwork for development of an efficient antitumor drug targeted by the ScFv. Superoxide dismutase (SOD), 3The abbreviations used are: SOD, superoxide dismutase; ROS, reactive oxygen species; ScFv, single chain variable fragment; mAb, monoclonal antibody; FITC, fluorescein isothiocyanate; DHE, dihydroethidium; Rh123, rhodamine 123; CM-H2TMRos, MitoTracker Orange CM-H2TMRos; DCF-DA, peroxide-sensitive fluorophore dichlorodihydrofluorescein diacetate; NDA, naphthalene-2, 3-dicarboxyaldehyde; IGF-I, insulin-like growth factor-I; and IGFBP-I, IGF binding protein-I; IPTG, isopropyl 1-thio-β-d-galactopyranoside; GSH, glutathione; LCSM, laser confocal scanning microscope. 3The abbreviations used are: SOD, superoxide dismutase; ROS, reactive oxygen species; ScFv, single chain variable fragment; mAb, monoclonal antibody; FITC, fluorescein isothiocyanate; DHE, dihydroethidium; Rh123, rhodamine 123; CM-H2TMRos, MitoTracker Orange CM-H2TMRos; DCF-DA, peroxide-sensitive fluorophore dichlorodihydrofluorescein diacetate; NDA, naphthalene-2, 3-dicarboxyaldehyde; IGF-I, insulin-like growth factor-I; and IGFBP-I, IGF binding protein-I; IPTG, isopropyl 1-thio-β-d-galactopyranoside; GSH, glutathione; LCSM, laser confocal scanning microscope. a type of metalloenzyme, is ubiquitous among oxygen-metabolizing organisms. SODs have been classified into four types based on the metal species at the enzyme active site: Cu/Zn-SOD, Mn-SOD, Fe-SOD, and Ni-SOD. The theory of free radicals and tumors held that reactive oxygen species (ROS) originating in redundant radicals attacked the organism, leading to genetic mutation and tumor formation (1Hruszkewycz A.M. Bergtold D.S. Basic Life Sci. 1988; 49: 449-456PubMed Google Scholar, 2Kodama M. Inoue F. Nakayama T. Nagata C. Arch Biochem. Biophys. 1987; 258: 574-578Crossref PubMed Scopus (2) Google Scholar, 3Schwarz M. Peres G. Kunz W. Furstenberger G. Kittstein W. Marks F. Carcinogenesis. 1984; 5: 1663-1670Crossref PubMed Scopus (28) Google Scholar). SOD is supposed to be the main cellular superoxide anion-degrading enzyme, inhibiting tumors (4Zhang Y. Zhao W. Zhang H.J. Domann F.E. Oberley L.W. Cancer Res. 2002; 62: 1205-1212PubMed Google Scholar, 5Lam E.W. Zwacka R. Engelhardt J.F. Davidson B.L. Domann F.E. Jr-Yan T. Oberley L.W. Cancer Res. 1997; 57: 5550-5556PubMed Google Scholar, 6Bravard A. Beaumatin J. Dussaulx E. Lesuffleur T. Zweibaum A. Luccioni C. Int. J. Cancer. 1994; 59: 843-847Crossref PubMed Scopus (23) Google Scholar); however, ROS are essential to the existence and development of a normal cell (7Sen C.K. Curr. Top Cell Regul. 2000; 36: 1-30Crossref PubMed Scopus (291) Google Scholar, 8Shackelford R.E. Kaufmann W.K. Paules R.S. Free Radic. Biol. Med. 2000; 28: 1387-1404Crossref PubMed Scopus (457) Google Scholar). For this reason, attempts to treat ROS-associated diseases with non-selective SOD have failed and may have caused deleterious effects in normal cells as well as in tumor cells. Using genetic techniques, Oyanagui (9Oyanagui Y. Sato S. Inoue M. Biochem. Pharmacol. 1991; 42: 991-995Crossref PubMed Scopus (15) Google Scholar) fused SOD with a polypeptide that could recognize heparin sulfates on vascular endothelial cells; the resultant HB-SOD could locate vascular endothelial cells by itself. In addition to potential non-specific cell targeting, SOD has another critical disadvantage in clinical application; its large molecular weight interferes with its ability to permeate the cell membrane, which leads to a low cellular effect. Currently, a liposome is used to enclose the SOD, and the resultant liposome-SOD can permeate the cell membrane or tissue (10Delanian S. Martin M. Bravard A. Luccioni C. Lefaix J.L. Radiother. Oncol. 2001; 58: 325-331Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar, 11Jubeh T.T. Antler S. Haupt S. Barenholz Y. Rubinstein A. Mol. Pharm. 2005; 2: 2-11Crossref PubMed Scopus (32) Google Scholar, 12Rengel R.G. Filipovic-Grcic J. Cepelak I. Zanic-Grubisic T. Barisic K. Eur. J. Pharm. Biopharm. 2005; 60: 47-51Crossref PubMed Scopus (18) Google Scholar). But thus far, modified SODs still either cannot distinguish the target cells (tumor cells) or cannot permeate the tumor cell membrane. The single chain variable fragment (ScFv) antibody not only has a much lower immune binding than does monoclonal antibody (mAb) but also has a low molecular weight; thus, it can more easily reach intracellular targets. ScFv from the LC-1 hybridoma cell line can react at a high frequency with lung adenocarcinoma, lung squamous carcinoma, and large cell and small cell lung cancer, but not with normal and embryonic tissues (13Ge X.R. Wang J. Lin S.J. Yu N.X. Che Y.F. Gu Y. Acta Biologiae. Exprimentalis Sin. 1989; 22: 359-365Google Scholar). When this ScFv recognized and bound antigens on SPC-A-1 cells, the antigen-antibody complexes were internalized via the receptor-mediated endocytic pathway and permeated the cell membrane (14Xie W. Zhang R.X. Ge X.R. Acta Biologiae Exprimentalis Sin. 1996; 29: 207-219Google Scholar). This characteristic implies that using LC-1 ScFv to aid SOD targeting can be an effective anti-lung cancer drug because it overcomes both clinical SOD disadvantages, it will target only tumor cells and will be taken up intracellularly. In the current research, the Nostoc commune Fe-SOD and LC-1 ScFv were cloned and co-expressed, with the idea that the resultant fusion protein would possess dual activity. In theory, LC-1 ScFv would be able to introduce SOD into SPC-A-1 cells specifically and permeate the cell membrane via the receptor-mediated endocytic pathway. Once inside the cell, it would eliminate intracellular O2·¯, change the cellular redox state, and subsequently induce a pathway related to a low cellular O2·¯ level, inhibiting tumor cell proliferation. Chemicals and Antibodies—Rabbit phospho-Akt (Thr-308) antibody, p27kip1 antibody, and horseradish peroxide-conjugated goat antirabbit antibody were purchased from Calbiochem; anti-IGF-I antibody was kindly provided by Dr. Jianhui Fan (Boster, China) and used according to the manufacturer's recommendations. The fluorescent probes dihydroethidium (DHE), rhodamine 123 (Rh123), MitoTracker Orange CM-H2TMRos (M7511), fluo-3 AM, and peroxide-sensitive fluorophore dichlorodihydrofluorescein diacetate (DCF-DA) were purchased from Molecular Probes. Naphthalene-2,3-dicarboxyaldehyde (NDA) was obtained from Aldrich Chemicals. Cell Lines and Culture Conditions—Total RNA of the LC-1 hybridoma was kindly provided by Dr. Chen Liang of Yale University. N. commune stain CHEN, pET-22b (+) vector, pUCm-T vector, Escherichia coli (DH5α: supE44ΔlacU169; φ80 lacZΔM15, hsdR17 recA1 endA1 gurA96 thi-1 relA1), E. coli BL21 (DE3: hsdS gal; λcIts857, ind1 Sam7 nin5 lacUV5-T7), SPC-A-1 lung adenocarcinoma cell line, AGS gastric cancer cell line, and the HepG2 liver carcinoma cell line are available in our institute. N. commune was cultivated in BG11 culture medium. E. coli DH5α and E. coli BL21 (DE3) were maintained in LB culture medium. SPC-A-1 cells, AGS cells, and HepG2 cells were cultured in RPMI 1640 medium, which contained 10% fetal calf serum. Tumor cells were maintained in a CO2 cell culture incubator (Forma Scientific, 3154 CO2 Water-Jacketed Incubator) at 37 °C under 5% CO2. To prepare for every experiment, 90 μl of cells were grown in a 96-well plate until 70-80% confluent. All experiments were repeated at least three times. Data shown in the graphs for various parameters represent the mean ± S.E. Differences between means were considered significant when p < 0.05. Construction of the pET-SOD Expression Vector System—A 0.2-g N. commune sample was taken, and its genomic DNA was isolated using the method of Kim et al. (15Kim C.S. Lee C.H. Shin J.S. Chung Y.S. Hyung N.I. Nucleic Acids Res. 1997; 25: 1085-1086Crossref PubMed Scopus (171) Google Scholar). Fe-SOD was amplified from the genomic DNA, primered with degenerate primer, SOD-forward (5′-CTAGCCATGGCATTTGTACAGC-3′, including the NcoI site) and SOD-back (5′-CCGCTCGAGAGCTTT(G/A)GC(C/A)AAGTT(T/C)TC-3′, including the Xhol I site), and cloned into pET-22b (+) to be pET-SOD. Construction of the pET-ScFv Expression Vector System—The ScFv was constructed essentially following our previous approach (16Lu M. Gong X.G. Yu H. Li J.Y. J. Zhejiang Univ. Sci. B. 2005; 6: 832-837Crossref PubMed Scopus (19) Google Scholar). Briefly, Vh and Vl were amplified from the cDNA of the LC-1 hybridoma, primered with Vh-1 (5′-CATGCCATGGAACTGCAGGAGTCAGGACC-3′, including the NcoI site), Vh-2 (5′-TGAGGAGACGGTGACCGTGGTCCCTTGGCCCAG-3′), Vl-1 (5′-GACATTGAGCTCACCCAGTCTC-3′), and Vl-2 (5′-ACGCGTCGACCTTGGTCCCCCCTCCGAA-3′, including the SalI site), respectively. The Vl was modified into Vl′, primered with Vl-Mod (5′-CTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTGGAGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCGGACATTGAGCTCACCCAGTCTC-3′, including link-2: GGGGS×3) and Vl-2. Vl′ and Vh were connected by SOE-PCR, and cloned into pET-22b (+) to be pET-ScFv. Construction of the pET-SOD-ScFv Expression Vector System—The SOD fragment was amplified from the pET-SOD vector, primered with SOD-Nco (5′-CATGCCATGGCATTTGTACAGCTCCCACTACCCTTTG-3′, including the NcoI site) and SOD-Sal (5′-GCGTCGACTCCGCCTCCACCAGCTTTGGCCAAGTTTTC-3′, including the SalI site and link-1: GGGG). The ScFv fragment was amplified from the pET-ScFv vector, primered with ScFv-Sal (5′-ACGCGTCGACGTCCAACTGCAGGAGTCAGG-3′, including the SalI site) and ScFv-Not (5′-ATAAGAATGCGGCCGCTTTGATCTCGAGCTTGGTC-3′, including the NotI site). Then the SOD and ScFv fragments were cloned into pET-22b (+) to be pET-SOD-ScFv (see Fig. 1) and transformed into JM109. Expression, Purification, and Immunoblot Analyses of SOD, ScFv, and SOD-ScFv—The pET-SOD was induced in the presence of 0.5 mm IPTG and 300 μm [Fe3+] in 1 liter of LB culture medium at 37 °C for 3 h. Cells were harvested by centrifugation at 5000 × g and lysed in 50 ml of TE (20 mm Tris-HCl and 10 mm EDTA, pH 8.0). The lysate was disrupted using sonication (800 W, 20 min). The achieved sedimentation (SOD) after sonication was washed with wash buffer I (1 mm EDTA, 5% glycerol, 0.5% Triton X-100) and buffer II (wash buffer I with 2 m carbamide). Then the sedimented material was dissolved in lysis buffer (50 mm Tris-HCl, 0.3% sodium lauryl sulfate, 0.1 mm dithiothreitol) overnight. The lysate was poured into a column with 5 ml of nickel-nitrilotriacetic acid Superflow Resin, and the packed resin was washed with buffer consisting of imidazole gradient concentrations (0-500 mm). A280 was measured. The denatured protein was renatured in lysis buffer (excluding sodium lauryl sulfate) that included 100 μm [Fe3+], at 4 °C. The SOD-ScFv fusion protein was expressed and purified from pET-SOD-ScFv as described above. The ScFv was expressed and purified from pET-ScFv as described above, except that there was no [Fe3+] in the LB culture medium or the renaturing buffer. Natural Fe-SOD protein was purified from N. commune directly as follows: 500 g of N. commune was lysed in 1 liter of PBS (including 0.5 mm EDTA, pH 7.6) and disrupted using sonication (1 200 W, 60 min). Then the crude materials (Fe-SOD) were deposited in 45-85% (NH4)2SO4 for 6 h. The crude Fe-SOD was dissolved again and purified by DEAE-Sepharose fast flow and Sephadex G-100, respectively. The expression of pET-SOD and pET-SOD-ScFv was subjected to Western blot analysis (the anti-SOD antiserum was raised against natural N. commune Fe-SOD in mice). The SOD activity of purified SOD and SOD-ScFv was assayed using the pyrogallol auto-oxidation method (17Marklund S. Marklund G. Eur J Biochem. 1974; 47: 469-474Crossref PubMed Scopus (7732) Google Scholar). The antibody activity of purified ScFv and SOD-ScFv was assayed by competitive enzyme-linked immunosorbent assay as follows: 0.01 μg/μl LC-1 mAb and the purified ScFv (or SOD-ScFv) were used to bind SPC-A-1 cells competitively (AGS cells and HepG2 cells served as controls); goat anti-mouse-labeled anti-IgM secondary antibody was used to bind to the LC-1 antibody. A490 was measured. Determination of the Cell Membrane Permeation Ability of SOD-ScFv by Fluorescein Isothiocyanate (FITC) Fluorescence Tracing and Immunoblot Analyses—To trace the permeation process of SOD-ScFv through the SPC-A-1 cell membrane, SOD, ScFv, and SOD-ScFv were labeled with FITC essentially according to Lindsay et al. (18Lindsay M.P. Tamas L. Appels R. Skerritt J.H. J. Cereal Sci. 2000; 31: 321-333Crossref Scopus (30) Google Scholar). A 0.1 μm sample was dissolved in 10 ml of 100 mm carbonate buffer, pH 9.0. To each sample was added 10 μl of 1% w/v FITC in dimethyl sulfoxide, and labeling was performed at room temperature overnight. Each labeled sample was dialyzed at 4 °C for 72 h against pH 8.0 PBS. The samples were additionally separated by a Sephadex G-25 column. The fluorescence intensity of sample was measured by a fluorescence spectrophotometer (Hitachi, 850, Japan). The prepared SPC-A-1 cells were washed twice with PBS and incubated in RPMI 1640 medium containing 0.2 μm SOD-ScFv-FITC for 20, 40, and 60 min at 37 °C. Following three washes to remove unbound protein, intracellular FITC fluorescence was observed by LCSM (LSM 510, Zeiss, Germany). The intracellular stability of SOD-ScFv was estimated by Western blotting as follows. After SPC-A-1 cells were treated with 0.2 μm SOD-ScFv for 1 h, cells were washed and changed with a fresh culture medium. Then, cells were further incubated for 0, 6, 12, and 24 h followed by Western blot analysis with anti-SOD antiserum. Determination of Targeted Antitumor Ability of SOD-ScFv—A total of 90 μl of SPC-A-1 cells were grown in a 96-well plate until 30% confluent. Then, 10 μl of SOD-ScFv of the working concentrations (0.2-2 μm) were added for 1 h, and cells were washed and changed with a fresh culture medium for 48 h. Cells were counted using a hemocytometer (AGS cells and HepG2 cells served as negative controls); a cycle of cells (treated as described above) from a 6-well plate was analyzed by flow cytometry (FAC sort, Becton Dickinson) according to Mahadevan et al. (19Mahadevan B. Luch A. Seidel A. Pelling J.C. Baird W.M. Carcinogenesis. 2001; 22: 161-169Crossref PubMed Scopus (22) Google Scholar). Analysis of Cellular Superoxide Anions by LCSM—Cellular superoxide anions (O2·¯) were measured using DHE as a fluorescent dye relatively specific for O2·¯ (20Fujimura M. Morita-Fujimura Y. Kawase M. Copin J.C. Calagui B. Epstein C.J. Chan P.H. J. Neurosci. 1999; 19: C3414-C3422Crossref PubMed Google Scholar). Fluorescence intensity from O2·¯ in individual SPC-A-1 cells was traced over time essentially according to Bindokas et al. (21Bindokas V.P. Jordan J. Lee C.C. Miller R.J. J. Neurosci. 1996; 76: 1324-1336Crossref Google Scholar). After incubation with 0.2 μm SOD-ScFv in fresh culture medium at 37 °C for 1 h, the cells were washed with PBS and put in fresh culture medium with 20 μm DHE at 37 °C. After 5 min, the DHE fluorescence became visible on the LCSM and then cellular DHE fluorescence was scanned instantly for time-lapse images. Intracellular O2·¯ was monitored for at least 1500 s, and the temperature of the cells was maintained at 37 °C. In addition, intracellular calcium flux response to 0.2 μm SOD-ScFv (PBS and 50 μm H2O2 served as controls) was observed using fluo-3 AM for 1 h on LCSM, essentially according to Deng et al. (22Deng T.L. Yu L. Ge Y.K. Zhang L. Zheng X.X. Biochem. Biophys. Res. Commun. 2005; 338: 748-756Crossref PubMed Scopus (17) Google Scholar). Analysis of Mitochondrial Transmembrane Potential (ΔΨm) by Fluorescence Spectrophotometer—Mitochondrial membrane potential (ΔΨm) in SPC-A-1 cells was measured using two different dyes, rhodamine-123 and CM-H2TMRos. Rhodamine-123, a conventional, cationic voltage-sensitive probe that reversibly accumulates in mitochondria, was used in the present study to detect changes in ΔΨm. Cells were incubated with 1 μm rhodamine-123 at 37 °C for 30 min after 1 h of drug incubation. After three washings, the fluorescence intensity of the sample was analyzed by fluorescence spectrophotometer. CM-H2TMRos is a new fluorescent dye developed recently that is more photostable and stable in mitochondria (23Poot M. Zhang Y.Z. Kramer J.A. Wells K.S. Jones L.J. Hanzel D.K. Lugade A.G. Singer V.L. Haugland R.P. J. Histochem. Cytochem. 1996; 44: 1363-1372Crossref PubMed Scopus (394) Google Scholar). It was also used to measure the ΔΨm as described above, excepting cells that were incubated with 500 nm CM-H2TMRos. Cellular Oxidative Stress and Reducing Power Assay by Flow Cytometry—The oxidative stress of SPC-A-1 cells was determined by detection of cellular ROS with DCFH-DC (24Sawada G.A. Raub T.J. Decker D.E. Buxser S.E. Cytometry. 1996; 25: 254-262Crossref PubMed Scopus (45) Google Scholar). Briefly, after incubation with 0.2 μm SOD-ScFv in fresh culture medium for 1 h, cells were washed and incubated with 5 μm DCF-DA for 20 min at 37 °C. Cells were then washed three times with probe-free nitrate buffer. The fluorescence intensity of the sample was measured by flow cytometry. The cellular reduced glutathione (GSH) level was measured as an index to reflect the cellular reducing power in SPC-A-1 cells; GSH is oxidized to oxidized glutathione under the stress of superoxide anions or hydrogen peroxide. The GSH level was determined by staining cells with 500 μm NDA (25Orwar O. Fishman H.A. Ziv N.E. Anal. Chem. 1995; 67: 4261-4268Crossref PubMed Scopus (140) Google Scholar) as described above, then cells were washed three times, and fluorescence intensity was measured by flow cytometry. Reduced Oxidative Stress Effect on SPC-A-1 Cells through Akt/p27 kip1 Pathway—A total of 1.8 ml of SPC-A-1 cells were grown in a 6-well plate until 80% confluent, then treated with SOD-ScFv at 37 °C for 1 h (PBS served as control). After treatment, 106 cells were disrupted, and then cellular phosphorylated Akt (p-Akt) levels and insulin-like growth factor-I (IGF-I) levels were analyzed by Western blotting. To analyze the expression levels of cyclin-dependent kinase inhibitor p27kip1, 1.8 ml of SPC-A-1 cells were grown in 6-well plate until 30% confluent, 200 μl of SOD-ScFv were added for 1 h (PBS served as control), and cells were washed and changed with a fresh culture medium for 24 h. A total of 106 cells were disrupted, and the cellular p27kip1 level was analyzed by Western blotting. Based on data for other similar Fe-SODs of prokaryotic algae in GenBank™, we assumed that the Fe-SOD coding region in N. commune genome was continuous. Based on these Fe-SOD sequences, the degenerate primer SOD-forward/SOD-back was designed, and a fragment (GenBank™ accession AY830114) of 603 bp was achieved, whose deduced protein was in accordance with the molecular weight of natural Fe-SOD, which was purified from N. commune (22 kDa). These findings implied that this 603-bp coding sequence was the N. commune Fe-SOD CDS. This conclusion was supported by Western blotting analysis of expressed Fe-SOD or SOD-ScFv against natural Fe-SOD antiserum (Fig. 2A, lanes 3 and 4). BLAST search results from GenBank™ showed that this CDS had about 85% nucleotide similarity with Nostoc linckia Fe-SOD. It was found that when the cells were induced by IPTG, additional FeCl3 could improve the yield of the expected protein (26Kim Y.C. Miller C.D. Anderson A.J. Gene (Amst.). 1999; 239: 129-135Crossref PubMed Scopus (32) Google Scholar). The expressed SOD, ScFv, and SOD-ScFv proteins were composed of ∼78, 65, and 21%, respectively, of the total bacterial protein in the pET-SOD, pET-ScFv, and pET-SOD-ScFv expression vector systems, respectively (data not shown). The SOD activity assay result indicated that the specific activity of expressed SOD and SOD-ScFv was 1100 units/mg and 700 units/mg, respectively, whereas that of natural N. commune Fe-SOD was 2700 units/mg. The competitive enzyme-linked immunosorbent assay result of ScFv showed that the inhibitory rate of 0.1 μg/μl ScFv to 0.01 μg/μl LC-1 antibody was 71.0%, whereas that of ScFv-SOD was 61.2%. But neither showed the ability to bind to AGS cells or HepG2 cells (data not shown). The ability of SOD to permeate the cell membrane is a key point in clinical applications of SOD. Based on the specific spatial structure of SOD, ScFv, or SOD-ScFv, we dyed each with FITC (27Grunwaldt G. Haebel S. Spitz C. Steup M. Menzel R. J. Photochem. Photobiol. B. Biol. 2002; 67: 177-186Crossref PubMed Scopus (18) Google Scholar) to determine their ability to permeate the cell membrane and their cellular distribution after permeation. After incubation with SOD-ScFv-FITC for 20 min, the SPC-A-1 cells began to show green fluorescence (Fig. 3E). From Fig. 3I, the FITC localized inside the cell but did not reside on the cell membrane; what is more, it was distributed equally in the cells (Fig. 3, H and I). The ScFv-FITC control exhibited the same pattern (Fig. 3C, some data not shown). However, the SOD-FITC control showed no obvious fluorescence (Fig. 3B), implying that the SOD barely permeated the cell membrane by itself. The intracellular stability of SOD-ScFv in SPC-A-1 cells was shown in Fig. 2B. After permeation, the SOD-ScFv was degraded gradually; however, it could persist in cells for up to 24 h. The targeted antitumor ability of SOD-ScFv is shown in Fig. 4. Cells treated with 0.2 μm SOD-ScFv showed a 46.6% inhibition rate; this increased significantly in a SOD-ScFv dose-dependent manner (Fig. 4A). In addition, SOD-ScFv did not show the same inhibition in AGS cells or HepG2 cells (Fig. 4B), which implied the specificity of SOD-ScFv for SPC-A-1 cells. To determine how SOD-ScFv inhibited growth of SPC-A-1 cells, a cycle of treated cells was performed (Fig. 4C). It was clear that there was a change in the distribution of cells in G1 phase as a result of cellular overload of SOD. In the SOD-ScFv model, 60.4% of the cells were in G1 phase, whereas only 50.4% of the SOD-treated cells, 51.7% of the ScFv-treated cells, and 47.4% of PBS-treated cells were in G1. A considerable increase in the G1 fraction of SOD-ScFv model cells suggested that the SOD-induced inhibition in cell growth could be associated with the delay at G1. The cellular O2·¯ analysis result is shown in Fig. 5A. The oxidation rate of DHE in SPC-A-1 cells decreased significantly after pretreatment with SOD-ScFv. However, pretreatment of SOD or ScFv produced an oxidation rate not significantly different from PBS control, which showed the low permeation ability of SOD or the invalidation of ScFv in O2·¯ elimination. Interestingly, it was found that the cellular calcium level did not respond to SOD-ScFv in 1 h, whereas cellular calcium levels increased rapidly and distinctly under stimulation with 50 μm H2O2 (data not shown). It is well known that H2O2 can produce a high cellular oxidative stress. The main source of ROS in most cells is the mitochondria (28Hennet T. Richter C. Peterhans E. Biochem J. 1993; 289: 587-592Crossref PubMed Scopus (261) Google Scholar). We confirmed this in SPC-A-1 cells according to the perfect superposition of cellular DHE fluorescence and Rh123 fluorescence, which localized to the area of origin of O2·¯ and the mitochondrial area, respectively (Fig. 5B). One parameter that is altered because of ROS production is ΔΨm. Therefore, the effect of a lower O2·¯ level on ΔΨm was determined using Rh123. Fig. 6 shows an increase of Rh123 fluorescent intensity in SPC-A-1 cells (but not in AGS cells or HepG2 cells) by 1.3 times (p < 0.05) after treatment with SOD-ScFv. The CM-H2TMRos group exhibited similar results. These observations implied that lower levels of O2·¯ around the mitochondria could maintain the O2·¯. The O2·¯ impairment by cellular O2·¯ had been reported by Scanlon et al. (29Scanlon J.M. Reynolds I.J. J Neurochem. 1998; 71: 2392-2400Crossref PubMed Scopus (68) Google Scholar) and Kimura et al. (30Kimura S. Zhang G.X. Nishiyama A. Shokoji T. Yao L. Fan Y.Y. Rahman M. Abe Y. Hypertension. 2005; 45: 438-444Crossref PubMed Scopus (179) Google Scholar). Based on the fact that SOD-ScFv can eliminate O2·¯ in SPC-A-1 cells, we determined the cellular redox state aroused by SOD-ScFv after 1 h by detecting cellular ROS and GSH levels. As Fig. 7 shows, it is notable that SOD-ScFv resulted in significant decreases in cellular ROS fluorescence intensity (0.54-fold, p < 0.05) and increases in GSH fluorescence intensity (5.4-fold, p < 0.05), implying that cellular oxidative stress can be regulated by O2·¯ levels in SPC-A-1 cells. Increases in GSH with decreased oxidative stress have been demonstrated in previous studies (31Paz-Miguel J.E. Flores R. Sanchez-Velasco P. Ocejo-Vinyals G. Escribano de Diego J. Lopez de Rego J. Leyva-Cobian F. J. Immunol. 1999; 163: 5399-5410PubMed Google Scholar, 32Wefers H. Sies H. Eur. J. Biochem. 1983; 137: 29-36Crossref PubMed Scopus (190) Google Scholar). To understand the mechanism of how SOD-ScFv retarded the cell cycle, we examined the effects of reduced levels of intracellular ROS on some signal-transduction pathways. As shown in Fig. 8, it was found that SOD-ScFv dose dependently inhibited Akt phosphorylation (Thr-308) in a short time (1 h); in the subsequent 24 h, the expression of cyclin-dependent kinase inhibitors p27kip1 (a downstream protein of Akt) was up-regulated in SPC-A-1 cells. This outcome indicated that the Akt/p27kip1 pathway was activated under the reduced level of intracellular ROS in SPC-A-1 cells. However, the mechanism of Akt/p27kip1 pathway activation by ROS remains unclear. We predicted the tertiary structures of N. commune Fe-SOD by ExPASy and found that the four Fe3+-bound sites in the SOD active center, His-28, His-80, and His-166 and Asp-162 were close (a water molecule or a hydroxyl ion is the fifth bound site of Fe3+) (33Lim J.H. Yu Y.G. Choi I.G. Ryu J.R. Ahn B.Y. Kim S.H. Han Y.S. FEBS Lett. 1997; 406: 142-146Crossref PubMed Scopus (35) Google Scholar). Also, the C terminus amino acid residues of SOD were farther from the enzymatic active center than the N terminus; thus, the ScFv was added to the C terminus of SOD with link-1 to weaken the spatial interference between SOD and ScFv. The dual activity of SOD-ScFv indicated that SOD and ScFv were well separated by link-1. High intracellular ROS levels and low SOD activity were found in many tumor cells. Based on these findings in M14 melanoma cells, Pervaiz et al. (34Pervaiz S. Ramalingam J.K. Hirpara J.L. Clement M.V. FEBS Lett. 1999; 459: 343-348Crossref PubMed Scopus (86) Google Scholar) suggested that an intracellular environment with high ROS concentrations provided tumor cells with a survival advantage over their normal counterparts. It was suggested that ROS acts as an essential intracellular secondary messenger in the regulation of protein kinase activity and relative gene expression and in modulating cell growth, apoptosis, differentiation, and transformation (35Undaresan M. Yu Z. Ferrons V.J. Irani K. Finkel T. Science. 1995; 270: 296-299Crossref PubMed Scopus (2285) Google Scholar, 36Suh Y.A. Arnold R.S. Lassegue B. Shi J. Xu X. Sorescu D. Chung A.B. Griendling K.K. Lambeth J.D. Nature. 1999; 401: 79-82Crossref PubMed Scopus (1263) Google Scholar). Shi et al. (37Shi D.Y. Deng Y.R. Liu S.L. Zha