Abstract:Fan Zhang, 1, 2 Yan Han, 1, 2 Guojun Zheng, 3 Wenjian Li 4 1 Department of Endocrinology, Changzhou Third People's Hospital, Changzhou Medical Center, Nanjing Medical University, Changzhou, Jiangsu, People's Republic of China; 2 Department of Clinical Nutrition, Changzhou Third People's Hospital, Changzhou Medical Center, Nanjing Medical University, Changzhou, Jiangsu, People's Republic of China; 3 Clinical Laboratory, Changzhou Third People's Hospital, Changzhou Medical Center, Nanjing Medical University, Changzhou, Jiangsu, People's Republic of China; 4 Department of Urology, Changzhou Third People's Hospital, Changzhou Medical Center, Nanjing Medical University, Changzhou, Jiangsu, People's Republic of China Correspondence: Wenjian Li, Department of Urology, Changzhou Third People's Hospital, Changzhou Medical Center, Nanjing Medical University, 300 Lanling North Road, Changzhou, Jiangsu, 213001, People's Republic of China, Tel +86-0519-82009011, Email Purpose: This research aims to examine and scrutinize gender variations in the incidence of diabetic nephropathy (DN) and the trajectory of renal function in type 2 diabetes mellitus (T2DM) patients. Patients and Methods: We conducted a retrospective cohort study that enrolled 1549 patients diagnosed with T2DM from May 2015 to July 2023. We separately compared the clinical characteristics of male and female participants with and without DN. We utilized the Kaplan-Meier method to examine the cumulative incidence of DN among T2DM patients of varying genders. Hazard ratios (HR) and 95% confidence intervals (CI) were calculated using univariable and multivariable Cox proportional hazards regression analysis to evaluate the correlation between various factors and the risk of DN incidence. Multiple linear regression was utilized to investigate the relationship between ΔeGFR% and each factor. Logistic regression with cubic spline function and smooth curve fitting was employed to analyze the nonlinear link between ΔeGFR% and the risk of DN among participants of different genders. Results: The prevalence of DN was higher in female participants (17.31%) than in male participants (12.62%), with a significant cumulative risk ratio (1.33 [1.02– 1.73], P = 0.034). Multiple linear regression analysis revealed that creatinine, female gender, blood urea nitrogen, alkaline phosphatase, and total cholesterol had a significant impact on ΔeGFR% in T2DM patients, with standardized β coefficients of − 0.325, − 0.219, − 0.164, − 0.084, and 0.071, respectively. The restricted cubic spline analysis demonstrated a strong negative association between ΔeGFR% and the risk of developing DN ( P < 0.001). Conclusion: Both male and female patients with T2DM had a higher prevalence of DN over the 5-year follow-up period. However, women had a greater risk of developing DN and a faster decline in renal function compared to men. Keywords: gender differences, type 2 diabetes mellitus, nephropathy, renal function, glomerular filtration rate estimates Diabetes is a significant worldwide health threat, with 529 million people living with the disease globally in 2021. Based on an analysis conducted for the Global Burden of Disease Study (GBD Study 2021), the age-standardized prevalence of diabetes is 6.1%, with 96.0% of cases being type 2 diabetes mellitus (T2DM). It is estimated that the global population of individuals with diabetes will increase to 1.31 billion by 2050. 1 The increasing prevalence of diabetes is expected to lead to complications associated with the disease. T2DM increases the risk of both macrovascular and microvascular diseases. 2 Diabetic nephropathy (DN) is a frequently occurring complication of diabetes, and diabetes is a significant risk factor in the advancement of kidney disease. People diagnosed with diabetes are at an extremely high risk of developing chronic kidney disease (CKD). 3,4 The incidence of DN increases as the prevalence of diabetes rises. 5,6 Research suggests that approximately 20% to 40% of diabetic patients develop DN. 7–9 DN's primary clinical features are a reduced glomerular filtration rate and persistent albuminuria. 10 Increased albuminuria and decreased glomerular filtration rate may lead to end-stage renal disease. Presently, DN is a significant contributor to CKD, renal failure, and end-stage kidney disease (ESKD). 11–15 Additionally, DN increases the risk of developing cardiovascular disease. 16 There was a trend for increasing risk of cardiovascular death with increasing nephropathy. 17 Progression of DN is associated with a significant reduction in lif -Abstract Truncated-

GCTCCGAACCGAATCATCA CGCCATACAGACTGTTCGTTGT Jak 2 GACCAGACTCCACTGGCTGTCT TGATTCGCTTCCGGGTTAAA Stat 3 TGGTGTCTCCACTTGTCTACCTCTAC GTGTCACACAGATGAACTTGGTCTT Stat 4 CCCTCTGTTTTTATCCCCATTTC AGCACAGCATATGCACTTGGA Socs 1 GTGAGATGCCTCCCACTTCTG AAACATGGAGAGGTAGGAGTGGAA Socs 3 CGCGGGCACCTTTCTTATC ACTGGATGCGTAG

Exploring the mechanism of Dahuang-Tusizi drug pair in the treatment of diabetes nephropathy based on network pharmacology and immune infiltration analysis

Diabetic Nephropathy: Focusing on Pathological Signals, Clinical Treatment, and Dietary Regulation.

TNF-? and IL-1? Promote Renal Podocyte Injury in T2DM Rats by Decreasing Glomerular VEGF/eNOS Expression Levels and Altering Hemodynamic Parameters

Mechanistic Insight and Management of Diabetic Nephropathy: Recent Progress and Future Perspective

Diabetic Nephropathy: Challenges in Pathogenesis, Diagnosis, and Treatment

Identifying the Potential Diagnostic Gene Biomarkers and Forecasting the Potential Therapeutic Agents for Advanced Diabetic Nephropathy Based on Pyroptosis and Ferroptosis

Diabetic Nephropathy: An Overview

New Approaches to Diabetic Nephropathy from Bed to Bench

The Wnt Signaling Pathway in Diabetic Nephropathy

A retrospective cohort study of clinical characteristics and outcomes of type 2 diabetic patients with kidney disease

The Prevalence and Management of Diabetic Nephropathy in Asia

New Susceptibility Loci Associated with Kidney Disease in Type 1 Diabetes

Gender Differences in the Incidence of Nephropathy and Changes in Renal Function in Patients with Type 2 Diabetes Mellitus: A Retrospective Cohort Study

Role of serum β2-microglobulin, glycosylated hemoglobin, and vascular endothelial growth factor levels in diabetic nephropathy

Dmso_a_217924 1811..1820

Diabetic Kidney Disease

[Advances of Genetics in Diabetic Nephropathy].

Immune responses in diabetic nephropathy: Pathogenic mechanisms and therapeutic target

An Overview of the Posttranslational Modifications and Related Molecular Mechanisms in Diabetic Nephropathy