Abstract:Interferon (IFN)-stimulated gene 15 (ISG15) encodes a ubiquitin-like protein that is heavily involved in immune response elicitation. As an important member of interferon regulatory factor (IRF) family, IRF1 can activate the expression of multiple genes, including the human optineurin gene (Sudhakar et al., 2013). In this study, a sequence in the promoter region of the optineurin gene was compared to the 5' flanking region of the porcine isg15 gene. Porcine IRF1 also possesses antiviral activity against several swine viruses (Li et al., 2015), but the mechanism is not well understood. Herein, we report that porcine IRF1 and ISG15 were up-regulated in porcine kidney (PK-15) cells following stimulation with double-stranded RNA (dsRNA) or classical swine fever virus (CSFV) infection. We also found that siRNA-mediated knockdown of IRF1 expression resulted in lower ISG15 expression in response to polyinosinic:polycytidylic acid [poly(I:C)] or CSFV infection. The overexpression of IRF1 resulted in ISG15 up-regulation. IRF1 was shown to translocate to the nucleus in response to dsRNA stimulation. To further identify the functional domain of the isg15 gene that promotes IRF1 transcriptional activity, firefly luciferase and ISG15 reporter systems were constructed. The results of the firefly luciferase and ISG15 reporter assay suggested that IRF1 mediates the up-regulation of ISG15. Nucleotides -487 to -325, located in the 5' flanking region of the isg15 gene, constituted the promoter region of IRF1. ChIP assay indicated that IRF1 protein was able to interact with the DNA in the 5'fr of isg15 gene in cells. As an innate immune response protein with broad-spectrum antiviral activity, the up-regulation of ISG15 mediated by IRF1 in porcine cells is reported for the first time. These results warrant further investigation into the antiviral activity of porcine IRF1 against reported swine viruses.

Ccttcatgggccagagccctctgtca gctgtcaacgatacgctacgtaacg gtgtctccgactgtctccttc acggttgctgctcctgat tttcgctctggtccgtcttg ttcggaactgaggccatgat tgggtacagtccttcatcgg gggtaacttggctcatcctct acatggcctccaaggagtaaga gatcgagttggggctgtgact gcgcagatctatgacgtttgccgaggacaagac tttaagctttcactggggcaggcgccgccggta gcgcagat

Molecular cloning and functional characterization of porcine IFN-β promoter stimulator 1 (IPS-1)

Functional Characterization of Porcine LSm14A in IFN-β Induction.

Molecular Cloning and Expression Analysis of IFN-β Promoter Stimulator 1 in Tibetan Pigs

cDNA cloning, genomic structure and mRNA expression pattern of porcine type I interferons receptor 2 gene

IRF1 up-regulates isg15 gene expression in dsRNA stimulation or CSFV infection by targeting nucleotides -487 to -325 in the 5' flanking region.

Molecular characterization and association analysis of porcine interferon regulatory factor 1 gene

Molecular Identification and Transcriptional Regulation of Porcine IFIT2 Gene

Molecular Cloning, Characterization and Expression Analysis of Interferon-Β Promoter Stimulator 1 (IPS-1) Gene from Grass Carp Ctenopharyngodon Idella.

Molecular Cloning and Functional Characterization of Porcine Dna-Dependent Activator of Ifn-Regulatory Factors (Dai)

Molecular Cloning and Characterization of Porcine Interferon-Induced Protein with Tetratricopeptide Repeats (IFIT) 5

Molecular Cloning and Functional Characterization of Tibetan Porcine STING.

Molecular cloning and functional characterization of porcine stimulator of interferon genes (STING).

Molecular Cloning and Function Study on Induction of Type Ⅰ Interferon of Porcine Retinoblastoma-inhibiting Gene Ⅰ

Expression of porcine interferon-α and its bioactivity analysis in vitro and in vivo

Prokaryotic Expression of Porcine Type III Interferon and Studying on Its Antiviral Activity

A Haplotype Variant of Porcine IFIT2 Increases Poly(i:C)-Induced Activation of NF-κB and ISRE-binding Factors

Porcine IFI30 Inhibits PRRSV Proliferation and Host Cell Apoptosis in Vitro

Porcine Interferon Stimulated Gene 12a Restricts Porcine Reproductive and Respiratory Syndrome Virus Replication in Marc-145 Cells

Antiviral Activity of Porcine Interferon Regulatory Factor 1 against Swine Viruses in Cell Culture.

The Prokaryotic Expression and Its Antiviral Activity of Porcine Interferon-γ