Abstract:RATIONALE:Recently, human telomeric DNA was found to be transcribed into RNA transcripts composing of tandem repeats of r(UUAGGG) which can form G-quadruplex structures. Studies have shown that human telomeric RNA is associated with the telomerase activity in vitro. Finding high affinity small molecule ligands binding to the telomeric RNA G-quadruplex may facilitate the regulation of the telomerase activity.METHODS:The 12-mer and 24-mer telomeric RNA sequences, r(UAGGGUUAGGGU) and r(UAGGGUUAGGGUUAGGGUUAGGGU), were synthesized by TaKaRa Biotechnology (Dalian) Co., Ltd. (TaKaRa, Dalian) with high-performance liquid chromatography (HPLC) purification. Electrospray ionization ion-trap mass spectrometry was used to evaluate the binding affinities of three natural flexible cyclic molecules, tetrandrine, fangchinoline and cepharanthine, with the telomeric RNA G-quadruplexes. The fragmentation pathways of the G-quadruplexes and G-quadruplex-ligand complexes were investigated by tandem mass spectrometry.RESULTS:the natural flexible cyclic molecules were found to have high binding affinities to the 12-mer and 24-mer RNA G-quadruplexes with stoichiometry of 1:1 to 3:1. Collision-induced dissociation tandem mass spectrometry shows that the G-quadruplex-ligand complexes lose neutral ammoniums first and the small molecule ligand subsequently. Besides, among the three flexible cyclic molecules, cepharanthine binds most tightly to the RNA G-quadruplexes than tetandrine and fangchinoline.CONCLUSIONS:Three flexible cyclic small molecules were found to be potential telomeric RNA G-quadruplex ligands, especially cepharanthine, which has high affinity and binds most tightly to the RNA G-quadruplexes. These findings may provide further implications in the regulation of telomeric RNA and telomerase activity.

Proximal Single-Stranded RNA Destabilizes Human Telomerase RNA G-Quadruplex and Induces Its Distinct Conformers.

An Activity Switch in Human Telomerase Based on RNA Conformation and Shaped by TCAB1

Telomerase RNA structural heterogeneity in living human cells detected by DMS-MaPseq

RHPS4 shifted the conformation ensemble equilibrium of Tel24 by preferentially stabilizing the (3 + 1) hybrid-2 conformation

Conformations of Human Telomeric G-Quadruplex Studied Using a Nucleotide-Independent Nitroxide Label

Telomere DNA G-quadruplex folding within actively extending human telomerase

Short designed peptide unfolding human telomeric G-quadruplex: mimicking the helicase function

hnRNPA1 RGG-box acts a "catalyst" in UP1-induced destabilization of RNA and DNA telomeric G-Quadruplexes

Revealing Conformational Dynamics of 2 '-O-methyl-rna Guanine Modified G-quadruplex by Replica Exchange Molecular Dynamics

Investigation of Non-Covalent Interaction of Natural Flexible Cyclic Molecules with Telomeric RNA G-quadruplexes by Electrospray Ionization Mass Spectrometry.

Biochemical Insights into the Role of Guanosine Oxidation on RNA G-Quadruplex

Structural Dynamics Of Human Telomeric G-Quadruplex Loops Studied By Molecular Dynamics Simulations

Involvement of G-triplex and G-hairpin in the multi-pathway folding of human telomeric G-quadruplex.

Interaction Between Human Telomeric G-quadruplexes Characterized by Single Molecule Magnetic Tweezers

Experimental and Computational Evidence of a Stable RNA G‐triplex Structure at Physiological Temperature in the SARS‐CoV‐2 Genome

Yeast Telomerase Subunit Est1p Has Guanine Quadruplex–promoting Activity That is Required for Telomere Elongation

The Mechanism of UP1 Binding and Unfolding of Human Telomeric DNA G-quadruplex.

Two coexisting pseudo-mirror heteromolecular telomeric G-quadruplexes in opposite loop progressions differentially recognized by a low equivalent of Thioflavin T

Mechanistic Insights into the Ligand-Induced Unfolding of an RNA G-Quadruplex

Manipulating TDP43 Aggregation via RNA G-quadruplexes

HNRNPH1 destabilizes the G-quadruplex structures formed by G-rich RNA sequences that regulate the alternative splicing of an oncogenic fusion transcript