First Report of Maize Stalk Rot Disease Caused by Fusarium Cerealis in Yunnan, China
L. Shan,J. Zhang,N. Ma,X. Dai,W. Guo
DOI: https://doi.org/10.1094/pdis-07-17-0967-pdn
IF: 4.5
2018-01-01
Plant Disease
Abstract:HomePlant DiseaseVol. 102, No. 2First Report of Maize Stalk Rot Disease Caused by Fusarium cerealis in Yunnan, China PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Maize Stalk Rot Disease Caused by Fusarium cerealis in Yunnan, ChinaL. Shan, J. Zhang, N. Ma, X. Dai, and W. GuoL. Shan, J. Zhang, N. Ma, X. Dai†Corresponding authors: X. Dai, E-mail: E-mail Address: daixiaofeng@caas.cn and W. Guo, E-mail: E-mail Address: guowei01@caas.cn, and W. Guo†Corresponding authors: X. Dai, E-mail: E-mail Address: daixiaofeng@caas.cn and W. Guo, E-mail: E-mail Address: guowei01@caas.cnAffiliationsAuthors and Affiliations L. Shan J. Zhang N. Ma , Institute of Food Science and Technology, Chinese Academy of Agricultural Sciences, Beijing 100193, P. R. China X. Dai † W. Guo † , Institute of Food Science and Technology, Chinese Academy of Agricultural Sciences, Beijing 100193, P. R. China, and Key Laboratory of Agro-products Quality and Safety Control in Storage and Transport Process, Ministry of Agriculture, P. R. China. Published Online:6 Dec 2017https://doi.org/10.1094/PDIS-07-17-0967-PDNAboutSectionsSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat In a survey for maize stalk rot diseases, symptomatic maize plants were collected from eight cities across the Yunnan province of China in 2015 to 2016. The diseases occurred on approximately 5% in surveyed fields. Fusarium cerealis (synonymous with F. crookwellense) was identified from two fields in Zhaotong city, Yunnan. Four different isolates of F. cerealis were recovered from surface-sterilized edges of discolored stalk pith tissues at the lesion region according to Shan's method (Shan et al. 2017). Morphological features were observed on potato dextrose agar (PDA) and carnation leaf agar (CLA) after 7 days of incubation in the dark at 25°C. Fungal colonies produced abundant aerial mycelium ranging from white to pale yellow to rose on PDA. On the reverse side, deep rosy pigmentation penetrated into the agar. Macroconidia produced from sporodochium on CLA were slightly curved, hyaline, usually 3 to 5 visible septa, with foot-shaped basel cell, with curved apical cell and tapering gradually to a point at the tip and measuring 30.8 ± 2.7 × 3.6 ± 0.3 μm. Microconidia and chlamydospores were not observed. DNA was extracted from four different isolates, respectively. The partial elongation factor (TEF1-α) genes were amplified from each isolate using universal primers EF1 (ATGGGTAAGGARGACAAGAC) and EF2 (GGARGTACCAGTSATCATGTT) and showed 100% sequence identity to each other. BLAST analysis revealed that the TEF1-α fragment (GenBank accession no. MF434844) was 100% identical to the sequence of F. cerealis (KP400718 and FD_01109) in the GenBank and FUSARIUM-ID database. To validate the results, species-specific primers FcerPHOF (CAAGTCGGTCGCTCATTTGTTC) and FcerPHOR (AGATAGATTCACATGCCAAGAATATG) were used to amplify partial phosphate permease gene (PHO) because F. cerealis is often identified as F. culmorum, F. graminearum, or F. pseudograminearum (Stakheev et al. 2013). The PHO fragment (GenBank accession no. MF434845) was 100% identical to the sequence of F. cerealis isolate NIV7 (HQ687676). Pathogenicity tests of two representative isolates were carried out by individually inoculating five 10-leaf-stage maize plants at the second or third internode above the soil line using 20 μl of conidia suspension at a concentration of 106/ml as described by Zhang et al. (2016). Five maize plants inoculated with sterilized water were used as a control. All inoculated plants were maintained at 25 ± 0.5°C in a greenhouse with a photoperiod of 12 h. After 14 days, all inoculated plants showed typical disease symptoms as pith discoloration of internal stalk tissues around the inoculation site. The control plants were free from infection and disease symptoms. Koch's postulates were fulfilled by reisolating the fungus from symptomatic tissues but not from the control and identified by sequencing the partial PHO gene again. To our knowledge, this is the first description of this pathogen causing stalk rot on maize in China.References:Shan, L. Y., et al. 2017. Plant Dis. 101:837. https://doi.org/10.1094/PDIS-10-16-1465-PDN Link, ISI, Google ScholarStakheev, A. A., et al. 2013. Russ. J. Bioorganic Chem. 39:153. https://doi.org/10.1134/S1068162013020131 Crossref, ISI, Google ScholarZhang, Y., et al. 2016. PLoS Pathog 12:e1005485. https://doi.org/10.1371/journal.ppat.1005485 Crossref, ISI, Google ScholarThis research work was supported by the National Basic Research and Development Program of China (973 program, no. 2013CB127803) and Elite Youth Program of Chinese Academy of Agricultural Sciences for Wei Guo.DetailsFiguresLiterature CitedRelated Vol. 102, No. 2 February 2018SubscribeISSN:0191-2917e-ISSN:1943-7692 Metrics Article History Issue Date: 19 Jan 2018Published: 6 Dec 2017First Look: 28 Sep 2017Accepted: 26 Sep 2017 Pages: 444-444 Information© 2018 The American Phytopathological SocietyCited byThe biocontrol of potato dry rot by microorganisms and bioactive substances: A reviewPhysiological and Molecular Plant Pathology, Vol. 122Gibberella pulicaris (basal canker of hop)CABI Compendium, Vol. CABI CompendiumDevelopment of an Inoculation Technique for Rapidly Evaluating Maize Inbred Lines for Resistance to Stalk Rot caused by Fusarium spp. in the FieldWanyi Jiang, Wenbo Han, Ruiting Wang, Yonggang Li, Guanghui Hu, Jianfei Yang, Dan Jiang, Wenhao Han, Mingquan Wang, and Guoliang Li29 October 2021 | Plant Disease, Vol. 105, No. 9Fusarium cerealis causing Fusarium head blight of durum wheat and its associated mycotoxinsInternational Journal of Food Microbiology, Vol. 346