Cloning and Sequence Analysis of IGF-I Gene of Porcine

XI Gang,XU Zi-rong,QI Yi-jun
DOI: https://doi.org/10.3969/j.issn.1005-4545.2000.01.020
2000-01-01
Abstract:The total RNA was extracted from liver of finishing pig(Duroc×Yorkshire×Landrace), and acted as template to synthesize the first strand of IGF I gene cDNA using P1(5′ CTACATTCTGTAGTTCTTGTTTCC 3′) as the primer. Then, the cDNA was amplified by PCR with P1 and P2(5′ ATGGCCCTGTGCTTGCTCTCCTT 3′) primer. A DNA fragment with the length of 360 bp was amplified and cloned into the pGEM T vector. Through transferring, screening, enzymolysis and sequencing, it was demonstrated that this fragment was IGF I gene cDNA. It has 360 nts in length and contains 1 ORF, which encode a polypeptide containing 118 amino acids. It shares 100% homology with the porcine IGF I gene reported by Muller M and Brem G.
What problem does this paper attempt to address?