First Report of Cucumber Target Leaf Spot, Corynespora Cassiicola, on Cucumber in Heilongjiang, Northeastern China

D. W. Liu,D. Liu,Q. Y. Liu,D. Zhang,L. Tao,Y. J. Zhang
DOI: https://doi.org/10.1094/pdis-09-18-1504-pdn
IF: 4.5
2019-01-01
Plant Disease
Abstract:HomePlant DiseaseVol. 103, No. 4First Report of Cucumber Target Leaf Spot, Corynespora cassiicola, on Cucumber in Heilongjiang, Northeastern China PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Cucumber Target Leaf Spot, Corynespora cassiicola, on Cucumber in Heilongjiang, Northeastern ChinaD. W. Liu, D. Liu, Q. Y. Liu, D. Zhang, L. Tao, and Y. J. ZhangD. W. Liuhttp://orcid.org/0000-0003-1096-8464Division of Plant Protection, College of Agriculture, Northeast Agricultural University, 150030, ChinaSearch for more papers by this author, D. LiuDivision of Plant Protection, College of Agriculture, Northeast Agricultural University, 150030, ChinaSearch for more papers by this author, Q. Y. LiuDivision of Plant Protection, College of Agriculture, Northeast Agricultural University, 150030, ChinaSearch for more papers by this author, D. ZhangDivision of Plant Protection, College of Agriculture, Northeast Agricultural University, 150030, ChinaSearch for more papers by this author, L. TaoDivision of Plant Protection, College of Agriculture, Northeast Agricultural University, 150030, ChinaSearch for more papers by this author, and Y. J. Zhang†Corresponding author: Y. J. Zhang; E-mail: E-mail Address: [email protected]Division of Plant Protection, College of Agriculture, Northeast Agricultural University, 150030, ChinaSearch for more papers by this authorAffiliationsAuthors and Affiliations D. W. Liu D. Liu Q. Y. Liu D. Zhang L. Tao Y. J. Zhang † Division of Plant Protection, College of Agriculture, Northeast Agricultural University, 150030, China Published Online:29 Jan 2019https://doi.org/10.1094/PDIS-09-18-1504-PDNAboutSections ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Cucumber (Cucumis sativus) is a widely cultivated plant in the gourd family worldwide. However, cucumber is susceptible to many pathogens and insects, which results in a great deal of economic losses. Cucumber target leaf spot is an important disease caused by Corynespora cassiicola, which has been documented in Liaoning, Shandong, Shanghai, Henan, Hebei, Gansu, and Ningxia Provinces in mainland China (Li et al. 2009; Liu et al. 2012; Wang et al. 1997; Zeng et al. 2011). In June 2013, a survey for cucumber target leaf spot was undertaken in the cities of Harbin, Qiqihar, Mudanjiang, and Jiamusi of Heilongjiang Province. The results showed that the disease was only observed in Harbin. However, the pathogen spread quickly and reoccurred in other cities of Heilongjiang Province including Daqing, Jiamusi, Mudanjiang, Qiqihar, and Suihua. An accurate diagnosis is necessary for effective and economic management of the disease; therefore, an attempt was made to reaffirm the cause of the disease in these new locations. To isolate the pathogen, leaf tissues (5 × 5 mm) were cut from the lesion margin, surface disinfected in 75% alcohol for 15 s, soaked in 0.1% mercuric chloride for 20 s, washed with sterile distilled water three times, and cultured on potato dextrose agar at 28°C for 7 days. Subsequent colonies were gray or dark brown with aerial mycelium. Conidia formed as single spores or in chains and were straight or curved, cylindrical, or obclavate. Conidia ranged in size from 19.68 to 149.93 × 3.69 by 15.51 µm and had 1 to 12 pseudoseptations with a conspicuous thickened hilum. Based on morphological and cultural characters, the fungus was preliminarily identified as Corynespora cassiicola (Zheng et al. 2016). To confirm the identity of the fungus, genomic DNA was extracted with a DNA isolation kit (UNIQ-10 Column Fungal Genomic DNA Isolation Kit, Shanghai), amplification of the internal transcribed spacer (ITS) region was performed with primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS2 (TCCTCCGCTTATTGATATGC), and the purified polymerase chain reaction product was sequenced. A GenBank BLAST search revealed that the ITS sequences showed 100% similarity with that of C. cassiicola isolated from cucumber (JQ595296.1; JQ595297.1). Additionally, the specific primer pair CIR5 (GGACCCACCACAAACCCA) and CIF5 (ACAGACGCCCAAACACCAA) was used to identify the fungus; BLAST analysis showed the sequence was 99% identical with C. cassiicola (FJ594961.1). Morphologic characters and sequence analysis of the ITS rDNA confirmed that the pathogen was C. cassiicola. A pathogenicity test was conducted on intact plants according to Koch’s postulates. Fresh leaves were washed with sterile water and inoculated by spraying with a conidial suspension (1 × 105/ml). Sterile water served as a control. All samples were incubated in a growth chamber at 27°C. Symptoms typical of target leaf spot developed on the leaves after 7 days, but control samples remained healthy. The morphology of reisolated pathogen from symptomatic tissues was consistent with that on diseased lesions. To our knowledge, this is the first report of cucumber target leaf spot in Heilongjiang province, northeastern China. The survival and quick spread of the pathogen in Heilongjiang province, an extremely cold area of China, is a subject for further study.References:Li, C. S., et al. 2009. China Vegetables. 18:29. ISI, Google ScholarLiu, Z. H., et al. 2012. Plant Prot. 11:41. Google ScholarWang, R. C., et al. 1997. Plant Doct. 4:2. Google ScholarZeng, R., et al, 2011. J. Shanghai Jiaotong Univ. (Agric. Sci.) 20114:13. Google ScholarZheng, X., et al. 2016. Plant Dis. 100:1235. https://doi.org/10.1094/PDIS-09-15-1108-PDN Link, ISI, Google ScholarFunding: Funding was provided by “Young Talents” project of Northeast Agricultural University (16QC01) and Natural Science Foundation of Heilongjiang Province (ZD2016003).DetailsFiguresLiterature CitedRelated Vol. 103, No. 4 April 2019SubscribeISSN:0191-2917e-ISSN:1943-7692 DownloadCaptionGray mold on kiwifruit leaves caused by Botrytis cinerea (courtesy Guoshu Gong and Qinjun Tao); sunflower rust on bracts (courtesy Sam Markell); cucumber plant with mosaic symptoms caused by papaya ringspot virus (courtesy Roger Jones). Metrics Article History Issue Date: 10 Apr 2019Published: 29 Jan 2019First Look: 18 Oct 2018Accepted: 16 Oct 2018 Pages: 765-765 Information© 2019 The American Phytopathological SocietyFunding“Young Talents” project of Northeast Agricultural UniversityGrant/Award Number: 16QC01Natural Science Foundation of Heilongjiang ProvinceGrant/Award Number: ZD2016003Cited byThe calcium cyanamide and polyethylene blocks the secondary transmission and infection of vegetable leaf diseases20 December 2022 | Frontiers in Plant Science, Vol. 13Activity of Phosphites and Chitosan on Biochemical Responses and Target Spot Control in Cucumber Plants26 October 2022 | Gesunde Pflanzen, Vol. 150Target Spot Control and Modulation of the Physiology in Cucumber Using Phosphites and Chitosan25 June 2021 | Gesunde Pflanzen, Vol. 73, No. 4
What problem does this paper attempt to address?