First report of Ageratum yellow vein virus infecting Sonchus oleraceus

Y. P. Xu,J. X. Wu

IF: 2.2

2008-01-01

Journal of Plant Pathology

Abstract:This datasheet on Ageratum yellow vein virus covers Identity, Hosts/Species Affected, Further Information.

What problem does this paper attempt to address?

Etiology of Ageratum Yellow Vein Diseases in South China

Xiaoyang Jiao,Huanran Gong,Xuejian Liu,Yan Xie,Xueping Zhou

DOI: https://doi.org/10.1094/pdis-01-13-0074-re

IF: 4.5

2013-01-01

Plant Disease

Abstract:Ageratum conyzoides is a common weed in agricultural regions in Asia. A. conyzoides plants exhibiting yellow vein symptoms were collected from Yunnan and Guangxi provinces of China. Polymerase chain reaction detection and sequence analysis showed that samples collected from Yunnan were mainly infected by Tobacco curly shoot virus (TbCSV) associated with Ageratum yellow vein China betasatellite (AYVCNB), while samples from Guangxi were mostly infected by Papaya leaf curl China virus (PaLCuCNV) and AYVCNB, or by Ageratum yellow vein China virus (AYVCNV) and AYVCNB, with a few exhibiting dual infections by PaLCuCNV, AYVCNV, and AYVCNB. Agrobacterium-mediated inoculation of infectious clones showed that both TbCSV and AYVCNB or PaLCuCNV and AYVCNB produced typical yellow vein symptoms in A. conyzoides. Consequently, Ageratum yellow vein diseases in Yunnan and Guangxi provinces were caused by TbCSV/AYVCNB, PaLCuCNV/AYVCNB, or AYVCNV/ AYVCNB. The implications of these results in relation to the prevalence of begomoviruses in cultivated plants are discussed.
Ageratum Yellow Vein China Virus is a Distinct Begomovirus Species Associated with a DNAbeta Molecule.

Qing Xiong,Sanwei Fan,Jianxiang Wu,Xueping Zhou

DOI: https://doi.org/10.1094/phyto-97-4-0405

2007-01-01

Phytopathology

Abstract:ABSTRACT Ageratum conyzoides plants exhibiting yellow vein symptoms, collected near Haikou, Hainan Province, China, contained begomoviral DNA-A-like molecules. The complete sequences of the molecules from two samples, Hn2 and Hn2-19, were shown to consist of 2,768 and 2,748 nucelotides (nt), respectively. These sequences have more than 97% nucleotide sequence identity, but less than 86% identity with other reported begomovirus sequences. In line with the taxonomic convention for begomoviruses, Hn2 and Hn2-19 are therefore considered to represent isolates of a distinct begomovirus species, for which the name Ageratum yellow vein China virus (AYVCNV) is proposed. Sequence alignment shows AYVCNV has arisen by recombination among viruses related to Ageratum yellow vein virus, Papaya leaf curl China virus, and an unidentified begomovirus. Southern blot analyses revealed that all plants sampled contained molecules resembling DNAbeta. DNAbeta molecules from three samples were 1,323 or 1,324 nt long and had >98% sequence identity but <81% identity with previously reported DNAbeta sequences. Infectious clones of Hn2 and its associated DNAbeta were constructed and agroinoculated to plants. Hn2 alone caused sporadic asymptomatic systemic infection of Nicotiana benthamiana, N. glutinosa, Lycopersicon esculentum, Petunia hybrida, and A. conyzoides but its accumulation was much enhanced in plants co-inoculated with DNAbeta. The co-inoculated N. benthamiana, N. glutinosa, P. hybrida, and L. esculentum plants developed leaf curling or leaf crinkling symptom; those in A. conyzoides were typical of ageratum yellow vein disease. When the DNAbeta molecules associated with four other Chinese begomoviruses were coinoculated with Hn2 to N. benthamiana and N. glutinosa, the DNAbeta molecules were replicated, and the plants developed systemic symptoms of types that were specific for each DNAbeta. This illustrates that there is less specific interaction between monopartite begomovirus and DNAbeta than between the DNA-A and DNA-B of begomoviruses with bipartite genomes.
The Identification of Viral Pathogens in a Physostegia Virginiana Plant Using High-Throughput RNA Sequencing

Jinxi Dong,Yuanling Chen,Yi Xie,Mengji Cao,Shuai Fu,Jianxiang Wu

DOI: https://doi.org/10.3390/v15091972

2023-01-01

Viruses

Abstract:Physostegia virginiana is an important ornamental and cut-flower plant in China. Its commonly used method of clonal propagation leads to virus accumulation in this plant. However, which viruses can infect the Physostegia virginiana plant remains to be illuminated. In this work, five viral pathogens in a Physostegia virginiana plant with virus-like symptoms of yellow, shriveled, and curled leaves were identified using RNA-seq, bioinformatics, and molecular biological techniques. These techniques allowed us to identify five viruses comprising one known alfalfa mosaic virus (AMV) and four novel viruses. The novel viruses include a virus belonging to the genus Fabavirus, temporarily named Physostegia virginiana crinkle-associated virus 1 (PVCaV1); two viruses belonging to the genus Caulimovirus, temporarily named Physostegia virginiana caulimovirus 1 and 2 (PVCV1 and PVCV2); and a virus belonging to the genus Fijivirus, temporarily named Physostegia virginiana fijivirus (PVFV). The genome sequences of PVCaV1, PVCV1, and PVCV2, and the partial genome sequence of PVFV were identified. Genome organizations and genetic evolutionary relationships of all four novel viruses were analyzed. PVCaV1 has a relatively close evolutionary relationship with five analyzed fabiviruses. PVCV1 and PVCV2 have separately a closest evolutionary relationship with lamium leaf distortion-associated virus (LLDAV) and figwort mosaic virus (FMV), and PVFV has a close evolutionary relationship with the five analyzed fijiviruses. Additionally, PVCaV1 can infect Nicotiana benthamiana plants via friction inoculation. The findings enrich our understanding of Physostegia virginiana viruses and contribute to the prevention and control of Physostegia virginiana viral diseases.
Discovery and Characterization of a Novel Umbravirus from Paederia Scandens Plants Showing Leaf Chlorosis and Yellowing Symptoms

Lianshun Zheng,Shuai Fu,Yi Xie,Yang Han,Xueping Zhou,Jianxiang Wu

DOI: https://doi.org/10.3390/v14081821

2022-01-01

Viruses

Abstract:Umbraviruses are a special class of plant viruses that do not encode any viral structural proteins. Here, a novel umbravirus that has been tentatively named Paederia scandens chlorosis yellow virus (PSCYV) was discovered through RNA-seq in Paederia scandens plants showing leaf chlorosis and yellowing symptoms. The PSCYV genome is a 4301 nt positive-sense, single strand RNA that contains four open reading frames (ORFs), i.e., ORF1–4, that encode P1–P4 proteins, respectively. Together, ORF1 and ORF2 are predicted to encode an additional protein, RdRp, through a −1 frameshift mechanism. The P3 protein encoded by ORF3 was predicted to be the viral long-distance movement protein. P4 was determined to function as the viral cell-to-cell movement protein (MP) and transcriptional gene silencing (TGS) suppressor. Both P1 and RdRp function as weak post-transcriptional gene silencing (PTGS) suppressors of PSCYV. The PVX-expression system indicated that all viral proteins may be symptom determinants of PSCYV. Phylogenetic analysis indicated that PSCYV is evolutionarily related to members of the genus Umbravirus in the family Tombusviridae. Furthermore, a cDNA infectious clone of PSCYV was successfully constructed and used to prove that PSCYV can infect both Paederia scandens and Nicotiana benthamiana plants through mechanical inoculation, causing leaf chlorosis and yellowing symptoms. These findings have broadened our understanding of umbraviruses and their host range.
Characterization Of A Novel Polerovirus Infecting Maize In China

Sha Chen,Guangzhuang Jiang,Jianxiang Wu,Yong Liu,Yajuan Qian,Xueping Zhou

DOI: https://doi.org/10.3390/v8050120

2016-01-01

Abstract:A novel virus, tentatively named Maize Yellow Mosaic Virus (MaYMV), was identified from the field-grown maize plants showing yellow mosaic symptoms on the leaves collected from the Yunnan Province of China by the deep sequencing of small RNAs. The complete 5642 nucleotide (nt)-long genome of the MaYMV shared the highest nucleotide sequence identity (73%) to Maize Yellow Dwarf Virus-RMV. Sequence comparisons and phylogenetic analyses suggested that MaYMV represents a new member of the genus Polerovirus in the family Luteoviridae. Furthermore, the P0 protein encoded by MaYMV was demonstrated to inhibit both local and systemic RNA silencing by co-infiltration assays using transgenic Nicotiana benthamiana line 16c carrying the GFP reporter gene, which further supported the identification of a new polerovirus. The biologically-active cDNA clone of MaYMV was generated by inserting the full-length cDNA of MaYMV into the binary vector pCB301. RT-PCR and Northern blot analyses showed that this clone was systemically infectious upon agro-inoculation into N. benthamiana. Subsequently, 13 different isolates of MaYMV from field-grown maize plants in different geographical locations of Yunnan and Guizhou provinces of China were sequenced. Analyses of their molecular variation indicate that the 3 half of P3-P5 read-through protein coding region was the most variable, whereas the coat protein- (CP-) and movement protein- (MP-)coding regions were the most conserved.
A new begomovirus associated with alpha- and betasatellite molecules isolated from Vernonia cinerea in China

Awais Zulfiqar,Jie Zhang,Xiaofeng Cui,Yajuan Qian,Xueping Zhou,Yan Xie

DOI: https://doi.org/10.1007/s00705-011-1137-2

IF: 2.685

2011-01-01

Archives of Virology

Abstract:A begomovirus disease complex associated with Vernonia cinerea showing yellow vein symptoms was studied. The full-length genomic DNA was comprised of 2739 nucleotides (nt) and contained the typical genome structure of begomoviruses. Comparison analysis showed that it shared the highest (78.9%) nucleotide sequence identity with recently characterized Vernonia yellow vein virus (VeYVV) from India. For associated satellites, betasatellite showed the highest nucleotide sequence identity (52.1%) with Vernonia yellow vein virus betasatellite (VeYVVB) and alphasatellite shared the highest sequence identity (70.7%) with Gossypium mustelinium symptomless alphasatellite (GMusSLA). It is a member of a distinct species with cognate alpha- and betasatellites for which the name Vernonia yellow vein Fujian virus (VeYVFjV) is proposed.
First Report of Clover yellow vein virus Infecting Senna septemtrionalis (Arsenic bush)

Han Hu,Min Jin,Yi Zhang,Xiaoli Shao,Jianguang Wang

DOI: https://doi.org/10.1094/PDIS-01-23-0101-PDN

2023-11-09

Abstract:Clover yellow vein virus (ClYVV) is a member of the genus Potyvirus, family Potyviridae and was reported to infect many plant species, such as Ammi majus L., Phaseolus vulgaris L., Vicia faba L., Lens culinaris L., Borago officinalis L., Cicer arietinum L., Gladiolous gandavensis L., Glycine max L., Trifolium repens L., and Dendrobium sp. (Irey et al. 2006; Ortiz et al. 2009; Park et al. 2014; Yoon et al. 2022). Senna septemtrionalis (Viv.) H.S.Irwin & Barneby (arsenic bush), a species in the subfamily Caesalpinioideae, is widely distributed in tropical and subtropical regions (Datiles et al. 2022). In June 2021, virus-like symptoms of mosaic, chlorosis, and leaf-curling were observed in arsenic bush in Kunming, Yunnan province, China. Symptomatic leaves were collected from four arsenic bush (SS1-4), and asymptomatic leaves were collected from 3 additional arsenic bush plants (SS5-7) (eXtra S1). To identify the putative causal virus, sap of symptomatic leaves (SS1) was stained with 1 % phosphotungstic acid and observed under a transmission electron microscope (TEM). Potyvirus-like particles (about 750-800 nm  13 nm) were observed from the sample (eXtra S1). Total RNA was extracted from sample SS1 using TRIzol Reagent (Invitrogen, USA) and subjected to the Illumina NovaSeq platform for RNA-Seq. After trimming and quality control of raw data, 24,125,963 high-quality clean reads were assembled into 72,835 Unigenes using Trinity software. BLAST searches indicated that the nucleotide sequence of Unigene c29731 (10,893 nt) and its deduced amino acid sequence shared 82.62% to 96.45% and 92.60% to 99.19% identity with several ClYVV isolates, respectively. Unigene c29731 had the highest coverage ratio (88%) and the highest nucleotide sequence identity (96.45%) with ClYVV isolate IA-2016 (GenBank accession No. MK292120.1). The complete genome of ClYVV SS1 isolate (ClYVV-SS, GenBank accession No. OP868578) was determined using RT-PCR and 5' and 3' rapid amplification of cDNA ends (RACE) (Chen et al. 2001). A total of 224,936 out of 24,125,963 reads were mapped to the ClYVV-SS1 genome, yielding an average depth of coverage of 3,056.823 (min=1, max=7,859) at nucleotides from 1 to 9,324 of ClYVV genome (eXtra S2). BLASTN results indicated that the complete genome of ClYVV-SS1 shared 96.45% nucleotide sequence identity and 99% coverage ratio with ClYVV isolate IA-2016 genome. Phylogenetic analysis showed that ClYVV-SS1 and other ClYVV isolates clustered together (eXtra S2). RT-PCR was performed on samples (SS2-7) using a pair of primers of the coat protein gene (5'- TCCGACAAAGATAAGTTGAATGCTGGTG-3' and 5'-GAATCGTGCTCCAGCAATGTGA-3') designed from multiple sequences alignment (MSA). Using SS1 sample as positive control, amplicons of ~813 bp were obtained from three symptomatic samples (SS2-4) but not the asymptomatic ones (SS5-7). A total of 17 of 20 arsenic bushes developed symptoms of mosaic and leaf-curling approximately two weeks after mechanical inoculation with arsenic bush (SS1) sap, with 10 uninoculated plants used as control (eXtra S1). RT-PCR was performed for all tested plants. 17 symptomatic arsenic bushes tested positive for ClYVV, while all other samples tested negative. This confirmed that the symptomatic arsenic bushes were infected with ClYVV. To our knowledge, this is the first report of ClYVV infecting arsenic bush.
Molecular Characterization of Alternanthera yellow vein virus: a new Begomovirus Species Infecting Alternanthera philoxeroides

X. Guo,X. Zhou

DOI: https://doi.org/10.1111/j.1439-0434.2005.01039.x

2005-01-01

Journal of Phytopathology

Abstract:A virus isolate designated Hn51 was obtained in 2004 from Alternanthera philoxeroides with yellow vein symptoms in Danzhou, Hainan Province, China. A specific 500 bp product was consistently detected in total DNA extracts, amplified with universal primers for members of the genus Begomovirus. The complete nucleotide sequence of the Hn51 DNA-A like molecule was determined to be 2745 nucleotides and most closely related to that of Ageratum yellow vein virus (65.2% sequence identity). The molecular data show that the isolate Hn51 is a new Begomovirus species, for which the name Alternanthera yellow vein virus is proposed. This is the first report of a begomovirus infecting an aquatic plant (the GenBank accession number of the sequence reported in this study is AM050736).
Molecular identification of viral pathogens in Crocus sativus

谢礼,吕明芳,董峰丽,饶君凤,毛碧增,洪健

DOI: https://doi.org/10.7501/j.issn.0253-2670.2013.08.022

2013-01-01

Abstract:Objective: To investigate the viral pathogens in cultivated Crocus sativus. Methods: Viral pathogen identification was carried out by the observation of virus particle morphology and cytopathology as well as the detection of DAS-ELISA, RT-PCR, and sequencing. Results: Linear virus particles of 600-900 nm in length were observed in C. sativus by negative staining under transmission electron microscope (TEM). Bundles of linear virus particles, cylindrical inclusion bodies of subdivision II, and amorphous inclusion bodies were observed in the cells of C. sativus under TEM after ultrathin-section. These observations resembled the cytopathology of infectious Bean yellow mosaic virus (BYMV). Positive result of DAS-ELISA was obtained from the leaves of C. sativus by using monoclonal antiserum against BYMV capsid protein. Positive result of RT-PCR induced by the Potyvirus specific primers (Sprimer and M4) was also obtained. Sequencing after RT-PCR revealed that the viral sequence in this diseased C. sativus had a homology of 99% with the BYMV sequence. Conclusion: The pathogenic virus of this C. sativus disease is identified as BYMV.
First Report of Pepper Veinal Mottle Virus Infecting Pepper in Mainland China

S. B. Zhang,Zijin Zhao,Limin Zheng,D. Y. Zhang,Ye Liu,Jun Liu,Jianxiu Du,Jing Peng,Fei Yan,F. Li,Yan Xie,Zhiyuan Cheng

DOI: https://doi.org/10.1094/pdis-08-15-0870-pdn

IF: 4.5

2016-01-01

Plant Disease

Abstract:HomePlant DiseaseVol. 100, No. 5First Report of Pepper veinal mottle virus Infecting Pepper in Mainland China PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Pepper veinal mottle virus Infecting Pepper in Mainland ChinaS. B. Zhang, Z. B. Zhao, L. M. Zheng, D. Y. Zhang, Y. Liu, J. Liu, J. Du, J. Peng, F. Yan, F. Li, Y. Xie, and Z. B. ChengS. B. ZhangSearch for more papers by this author, Z. B. ZhaoSearch for more papers by this author, L. M. ZhengSearch for more papers by this author, D. Y. ZhangSearch for more papers by this author, Y. LiuSearch for more papers by this author, J. LiuSearch for more papers by this author, J. DuSearch for more papers by this author, J. PengSearch for more papers by this author, F. YanSearch for more papers by this author, F. LiSearch for more papers by this author, Y. XieSearch for more papers by this author, and Z. B. ChengSearch for more papers by this authorAffiliationsAuthors and Affiliations S. B. Zhang Z. B. Zhao L. M. Zheng D. Y. Zhang Y. Liu J. Liu J. Du J. Peng , Key Laboratory of Pest Management of Horticultural Crop of Hunan Province, Hunan Plant Protection Institute, Hunan Academy of Agricultural Science, Changsha 410125, China F. Yan , Virology and Biotechnology Institute, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, China F. Li , Key Laboratory of Agricultural Biodiversity for Pest Management of China Education Ministry, Yunnan Agricultural University, Kunming 650201, China Y. Xie , Institute of Biotechnology, Zhejiang University, Hangzhou 310058, China Z. B. Cheng , Institute of Plant Protection, Jiangsu Academy of Agricultural Sciences, Nanjing 201014, China. Published Online:29 Feb 2016https://doi.org/10.1094/PDIS-08-15-0870-PDNAboutSections ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Pepper veinal mottle virus (PVMV), a virus species in the genus Potyvirus in the family Potyviridae, has been reported to infect several crops of Solanaceae in several countries and regions of Africa (Huguenot et al. 1996) and East Asia (Taiwan and South Korea) (Ceng et al. 2009; Ha et al. 2008). During a survey of pepper diseases in June 2013, about 15% of red pepper (Capsicum annuum) plants with viral-like symptoms of stunting, veinal chlorosis, and leaf curl and mottle were observed in Changsha, Hunan Province, China. Three diseased plants were collected and tested by high throughput small RNA sequencing (Ho et al. 2014) for pathogen identification. Total RNA was extracted using Trizol reagent (Sangon Biotech, Shanghai, China) from pooled leaf samples of the three plants. Small RNA libraries were constructed using the “Small RNA v1.5 Sample Prep” kit (Illumina, San Diego, CA) and sequenced by high throughput sequencing using a Solexa sequencer (Illumina). Raw data of approximate 8 million reads were analyzed using the Illumina GA Pipeline v1.3. High quality small RNA reads (18 to 30 nt) were assembled to contigs using the software Velvet 1.0.5. A BLASTn search of the resultant contigs to the viral genomes of the GenBank database identified about 300 contigs with high nucleotide sequence homologies (>96%) to seven viruses, among which PVMV was matched by 16 contigs with high identities (>98%). To confirm the presence of PVMV, the samples were tested by reverse transcription (RT)-PCR using a primer pair PMF (5′-AATTAAGCCATTGATTGACCA-3′) and PMR (5′-AGCGCCAATTATGAAACCGC-3′), and a ∼744-bp fragment of partial coat protein gene of PVMV was amplified from three symptomatic samples, but not from a healthy pepper sample. The DNA fragment from a selected sample was sequenced and deposited under GenBank Accession No. KT285204. This fragment shared 99% nucleotide identity with a PVMV isolate from South Korea (DQ645484). Northern blot using a digoxigenin-labeled PCR fragment amplified by primers PMF and PMR also confirmed the presence of PVMV from an infected plant. To our best knowledge, this is the first report of PVMV naturally infecting pepper in mainland China.References:Ceng, Y. H., et al. 2009. Plant Dis. 93:107. Google ScholarHa, J. H., et al. 2008. Arch. Virol. 153:2315. https://doi.org/10.1007/s00705-008-0245-0 Crossref, ISI, Google ScholarHo, T., et al. 2014. Virology 471-473:54. https://doi.org/10.1016/j.virol.2014.09.019 Crossref, ISI, Google ScholarHuguenot, C., et al. 1996. J. Phytopathol. 144:29. https://doi.org/10.1111/j.1439-0434.1996.tb01484.x Crossref, ISI, Google ScholarDetailsFiguresLiterature CitedRelated Vol. 100, No. 5 May 2016SubscribeISSN:0191-2917e-ISSN:1943-7692 Metrics Article History Issue Date: 15 Apr 2016Published: 29 Feb 2016First Look: 5 Nov 2015Accepted: 19 Oct 2015 Pages: 1025-1025 Information© 2016 The American Phytopathological SocietyCited byPepper veinal mottle virusCABI Compendium, Vol. CABI CompendiumIdentification of a novel pepper-infecting monopartite begomovirus in China20 March 2021 | Archives of Virology, Vol. 166, No. 6Capsicum annuum and Capsicum frutescens (Bell pepper, Chilli, Pepper, Sweet pepper)6 June 2020
First report of Ageratum yellow vein virus infecting papaya in Lampung, Indonesia

Selvi Helina,Hasriadi Mat Akin,Sudi Pramono,Puji Lestari,Muhammad Nurdin,Auliana Afandi,Lionita Dewi

DOI: https://doi.org/10.1007/s11033-023-09029-5

IF: 2.7422

2024-01-18

Molecular Biology Reports

Abstract:Papaya ( Carica papaya ) is a tropical fruit of great economic and nutritional importance, loved for its sweet and delicious flesh. However, papaya cultivation faces serious challenges in the form of Begomovirus attacks. Begomoviruses are a group of viruses that pose a serious threat to plants worldwide. Including papaya, Begomovirus has become a significant threat to papaya production in various parts of the world and has been identified in several regions in Indonesia.

biochemistry & molecular biology
Invasion of Shoot Apical Meristems by Chrysanthemum Stunt Viroid Differs among Argyranthemum Cultivars.

Zhibo Zhang,YeonKyeong Lee,Carl Spetz,Jihong Liu Clarke,Qiaochun Wang,Dag-Ragnar Blystad

DOI: https://doi.org/10.3389/fpls.2015.00053

IF: 5.6

2014-01-01

Frontiers in Plant Science

Abstract:Chrysanthemum stunt viroid (CSVd) is a damaging pathogen attacking Argyranthemum plants. Our study attempted to reveal distribution patterns of CSVd in shoot apical meristems (SAM) and to explore reasons for differential ability of CSVd to invade SAM of selected Argyranthemum cultivars. Symptom development was also observed on greenhouse-grown Argyranthemum plants. Viroid localization using in situ hybridization revealed that the ability of CSVd to invade SAM differed among cultivars. In diseased 'Yellow Empire' and 'Butterfly', CSVd was found in all tissues including the uppermost cell layers in the apical dome (AD) and the youngest leaf primordia 1 and 2. In diseased 'Border Dark Red' and 'Border Pink', CSVd was detected in the lower part of the AD and elder leaf primordia, leaving the upper part of the AD, and leaf primordia 1 and 2 free of viroid. Histological observations and transmission electron microscopy showed similar developmental patterns of vascular tissues and plasmodesmata (PD) in the SAM of 'Yellow Empire' and 'Border Dark Red', while immunolocalization studies revealed a major difference in the number of callose (β-1, 3-glucan) particles deposited at PD in SAM. A lower number of callose particles were found deposited at PD of SAM of 'Yellow Empire' than 'Border Dark Red'. This difference is most likely responsible for the differences in ability of CSVd to invade SAM among Argyranthemum cultivars.
Genomic Characterization of Two New Viruses Infecting Ageratum Conyzoides in China

Fumei Zhao,Jie Li,Xinyuan Hao,Huihua Liu,Qi Qiao,Shuang Wang,Yuting Tian,Yongjiang Wang,Desheng Zhang,Zhenchen Zhang

DOI: https://doi.org/10.1007/s00705-023-05781-y

IF: 2.685

2023-01-01

Archives of Virology

Abstract:Two new RNA viruses were identified in Ageratum conyzoides in China using high-throughput sequencing, and their genome sequences were determined using PCR and rapid amplification of cDNA ends. The new viruses, which have positive-sense, single-stranded RNA genomes, were provisionally named “ageratum virus 1” (AgV1) and “ageratum virus 2” (AgV2). AgV1 has a genome of 3,526 nucleotides with three open reading frames (ORFs) and shares 49.9% nucleotide sequence identity with the complete genome of Ethiopian tobacco bushy top virus (genus Umbravirus, family Tombusviridae). The genome of AgV2 consists of 5,523 nucleotides and contains five ORFs that are commonly observed in members of the genus Enamovirus of the family Solemoviridae. Proteins encoded by AgV2 exhibited the highest amino acid sequence similarity (31.7–75.0% identity) to the corresponding proteins of pepper enamovirus R1 (an unclassified enamovirus) and citrus vein enation virus (genus Enamovirus). Based on their genome organization, sequence, and phylogenetic relationships, AgV1 is proposed to be a new umbra-like virus of the family Tombusviridae, and AgV2 is proposed to be a new member of the genus Enamovirus of the family Solemoviridae.
First Report of Colletotrichum Siamense Causing Anthracnose on Zinnia Elegans in China

Wen Li,Yue-qiu He,Tao Fu,Li Lin,Feng Liu,Zhi-long Wang,Guo-liang Wang

DOI: https://doi.org/10.1094/pdis-04-20-0803-pdn

IF: 4.5

2021-01-01

Plant Disease

Abstract:Zinnia elegans (syn. Zinnia violacea), known as common zinnia, is one of the most spectacular ornamental plants in the family Asteraceae. Zinnia plants are widely cultivated in China for their impressive range in flower colours and profuse bloom over a long period. In April 2019, Zinnia plants grown in Ningbo Botanical Garden (29°56'57″N, 121°36'20″E) were found to have many circular necrotic lesions. In the early infection stage, the lesions appeared as small circular specks which developed later into large spots (15 to 32 mm diameter). Typical symptoms appeared to be grayish white centers with a chlorotic edges and disease incidence reached approximately 80% of plants in the affected field. Moreover, the growth of Zinnia plants was seriously affected by the disease. To identify the causative pathogen associated with the disease, 10 symptomatic leaves were collected from ten different Zinnia plants. Leaf tissues were cut from the lesion margins, surface sterilized with 75% ethanol for 30 seconds and rinsed three times in sterile distilled water. The leaf tissues were then dipped into 10% sodium hypochlorite for 2-3 minutes, washed three times in distilled water and dried on a sterile filter paper. After drying, the surface-sterilized leaf discs were transferred to potato dextrose agar (PDA) plates and incubated at 28°C for 2 to 3 days under the 12 h photoperiod. A total of ten pure fungal isolates were obtained and all the isolates displayed the same colony structure. Afterwards, three pure strains were randomly selected (F1, F3 and F5) for further study. The fungal colonies showed gray to brownish aerial mycelia with pink-colored masses of conidia. Conidia were one-celled, hyaline, cylindrical to subcylindrical, spindle-shaped with obtuse ends, measuring from 15.6 to 17.3 × 4.6 to 5.1 μm with both ends rounded. These morphological characteristics were consistent with the description of Colletotrichum gloeosporioides complex (Weir et al. 2012). The identity of a representative isolate, F3, was confirmed by a multilocus approach. Genomic DAN of isolate F3 was extracted and partial sequences of actin (ACT), chitin synthase (CHS), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal internal transcribed spacer (ITS), manganese-superoxide dismutase (SOD2) , glutamine synthatase (GS), beta-tubulin (TUB2) and calmodulin (CAL) were amplified and sequenced as previously described (Weir et al. 2012). These nucleotide sequences were deposited in GenBank (accession MN972436 to MN972440, and MT266559 to MT266561; all sequences in FASTA format are shown (Supplementary S1). BLAST analysis of ITS, ACT, CHS, GAPDH and GS sequences from the F3 isolate revealed similarity to C. gloeosporioides voucher strain ZH01 with 100%, 100%，99%, 99% and 99% identity, respectively. SOD, TUB2 and CAL sequences showed similarity to C. siamense with 100%, 100% and 100% identity, respectively. The phylogenetic trees were constructed by Maximum Likelihood method (ML) using JTT model implemented in the MEGA 7. Results inferred from the concatenated sequences (ACT, CHS, GAPDH, ITS, SOD, GS, TUB2 and CAL) placed the isolate F3 within the C. siamense cluster (Supplementary S2). To confirm pathogenicity of the fungus, Koch's postulates were conducted by spraying 20 Zinnia plants (60-day-old) with a 1 × 106 conidia/ml suspension. Plants were maintained in the growth chamber at 25°C and 85% relative humidity. After 10 to 15 days, symptoms were observed on all inoculated leaves and resembled those observed in the field, whereas the control plants remained asymptomatic. Here, C. siamense was isolated only from the infected Zinnia leaves and identified by morphological and gene sequencing analyses. C. siamense has been reported in many crops in China (Yang et al. 2019; Chen et al. 2019; Wang et al. 2019). However, to our knowledge, this is the first report of anthracnose caused by C. siamense on Zinnia elegans in China. References Chen, X., Wang, T., Guo, H., Zhu, P. K., and Xu, L. 2019. First report of anthracnose of Camellia sasanqua caused by Colletotrichum siamense in China. Plant Dis. 103:1423-1423. Wang, Y., Qin, H. Y., Liu, Y. X., Fan, S. T., Sun, D., Yang, Y. M., Li, C. Y., and Ai, J. 2019. First report of anthracnose caused by Colletotrichum siamense on Actinidia arguta in China. Plant Dis. 103:372-373. Weir, B. S., Johnston, P. R., and Damm, U. 2012. The Colletotrichum gloeosporioides species complex. Stud. Mycol. 73: 115-180. Yang, S., Wang, H. X., Yi, Y. J., and Tan, L. L. 2019. First report that Colletotrichum siamense causes leaf spots on Camellia japonica in China. Plant Dis. 103:2127-2127.
Genome Organization Of Ageratum Yellow Vein Virus, A Monopartite Whitefly-Transmitted Geminivirus Isolated From A Common Weed

Tan P H,Wong S M,Wu M,Bedford I D,Saunders K,Stanley J

DOI: https://doi.org/10.1099/0022-1317-76-12-2915

1995-01-01

Journal of General Virology

Abstract:A full-length copy of a single genomic component of the whitefly-transmitted geminivirus ageratum yellow vein virus (AYVV) has been cloned from an extract of infected Ageratum conyzoides originating from Singapore. Sequence analysis shows that the genomic component encodes two virion-sense (V1 and V2) and four complementary-sense open reading frames (C1-C4), typical of DNA A of whitefly-transmitted geminiviruses from the Eastern hemisphere. A genomic component equivalent to DNA B was not detected in extracts of infected A. conyzoides. The cloned genomic component produced a systemic infection in Nicotiana benthamiana, Phaseolus vulgaris and Lycopersicon esculentum when introduced into plants by agroinoculation, and symptoms were identical to those produced by wild-type virus introduced into these hosts using viruliferous whiteflies. However, attempts to re-establish a systemic infection in A. conyzoides either by agroinoculation or by whitefly transmission of the cloned progeny were unsuccessful, suggesting that additional factors are required for infection of the natural host. The significance of A. conyzoides as a reservoir host for the economically important geminivirus diseases is discussed.
First Report of Tomato Yellow Leaf Curl Virus in Acalypha Australis in China

Yinghua Ji,H. Zhang,K. Zhang,G. Li,Sen Lian,Zhiyuan Cheng,Yijun Zhou

DOI: https://doi.org/10.1094/pdis-10-12-0922-pdn

IF: 4.5

2013-01-01

Plant Disease

Abstract:Whitefly-transmitted geminiviruses (WTGs) can cause serious damage to many crops in China, so an investigation of weed hosts of WTGs was carried out in Jiangsu Province, China, in 2012. Fifty-seven symptomless samples of Acalypha australis L., a common weed known as Asian copperleaf, were randomly collected from seven tomato fields in Nanjing and Lianyungang, Jiangsu Province, from July to September. Total DNA of each sample was extracted and PCR was performed using degenerate primers PA and PB to amplify a specific region covering the AV2 gene of DNA-A and part of the adjacent intergenic region (1). DNA fragments were successfully amplified from 27 out of 57 samples and PCR amplicons of 16 samples were sequenced. Alignment results showed that the nucleotide sequence identities ranged from 98 to 100% with Tomato yellow leaf curl virus (TYLCV) accessions. The full-length viral circular DNA genome was amplified using primer pair 1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and 1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) which were designed based on the known sequences amplified by PA and PB. The complete genome sequence (GenBank Accession No. JX910534) was 2,781 nucleotides in length and had 99 to 100% sequence identity with TYLCV accessions (GU434142, GU111505). The dot immunobinding assay using monoclonal antibody against TYLCV confirmed the 27 weed samples positive by PCR were infected by TYLCV. These results demonstrated that A. australis is a host of TYLCV that might play an important role in viral epidemics in tomato fields in China. TYLCV-infected A. australis did not show typical symptoms like leaf curl, chlorosis, and stunting and thus appears to be a symptomless host. In our investigation, the infection rate ranged from 14 to 79% depending on the field sampled, suggesting that the weed may be an important reservoir of TYLCV, especially during the non-tomato planting period. To our knowledge, this is the first report of A. australis as a host of TYLCV in China. Reference: (1) D. Deng et al. Ann. Appl. Biol. 125:327, 1994.
Analysis of Pathogenicity and Virulence Factors of Ageratum Leaf Curl Sichuan Virus

Pengbai Li,Chenchen Jing,Hongyan Ren,Zhou Jia,Hussein Ghanem,Gentu Wu,Mingjun Li,Ling Qing

DOI: https://doi.org/10.3389/fpls.2020.527787

IF: 5.6

2020-01-01

Frontiers in Plant Science

Abstract:Ageratum leaf curl Sichuan virus (ALCScV) is a novel monopartite begomovirus, which was identified from Ageratum conyzoides plants in Sichuan Province, China. In this study, we showed that ALCScV can induce typical dwarf and downward leaf-curling symptoms in Ageratum conyzoides, Helianthus annuus, and Nicotiana benthamiana plants and that the noncognate betasatellite can enhance disease symptoms and increase viral accumulation. Expression of the ALCScV-encoded V2, C1, and C4 proteins through a Potato virus X (PVX) vector caused severe symptoms in N. benthamiana. Further study revealed no symptoms in N. benthamiana plants inoculated with infectious ALCScV clones lacking the C4 protein and that the relative viral DNA accumulation levels significantly decreased when compared with ALCScV-inoculated plants. Thus, our mutational analyses demonstrated that C4 is a pathogenicity determinant that plays key roles in symptom formation and virus accumulation. Furthermore, we also demonstrated that the second glycine of C4 was critical for ALCScV pathogenicity.
Pod pepper vein yellows virus, a new recombinant polerovirus infecting Capsicum frutescens in Yunnan province, China

Kuangjie Zhao,Yueyan Yin,Mengying Hua,Shaoxiang Wang,Xiaohan Mo,Enping Yuan,Hongying Zheng,Lin Lin,Hairu Chen,Yuwen Lu,Jianping Chen,Jiejun Peng,Fei Yan

DOI: https://doi.org/10.1186/s12985-021-01511-5

IF: 5.916

2021-02-23

Virology Journal

Abstract:Abstract Pepper vein yellows viruses (PeVYV) are phloem-restricted viruses in the genus Polerovirus , family Luteoviridae . Typical viral symptoms of PeVYV including interveinal yellowing of leaves and upward leaf curling were observed in pod pepper plants ( Capsicum frutescens ) growing in Wenshan city, Yunnan province, China. The complete genome sequence of a virus from a sample of these plants was determined by next-generation sequencing and RT-PCR. Pod pepper vein yellows virus (PoPeVYV) (MT188667) has a genome of 6015 nucleotides, and the characteristic genome organization of a member of the genus Polerovirus . In the 5′ half of its genome (encoding P0 to P4), PoPeVYV is most similar (93.1% nt identity) to PeVYV-3 ( Pepper vein yellows virus 3 ) (KP326573) but diverges greatly in the 3′-part encoding P5, where it is most similar (91.7% nt identity) to tobacco vein distorting virus (TVDV, EF529624) suggesting a recombinant origin. Recombination analysis predicted a single recombination event affecting nucleotide positions 4126 to 5192 nt, with PeVYV-3 as the major parent but with the region 4126–5192 nt derived from TVDV as the minor parent. A full-length clone of PoPeVYV was constructed and shown to be infectious in C. frutescens by RT-PCR and the presence of icosahedral viral particles.

virology
Complete genomic characterization of a reassortment isolate of Sophora yellow stunt virus from Sophora alopecuroides in China

Shuang Song,Pingping Sun,Mingxiu Ju,Xuan Zhang,Xingqi Yang,Lei Zhang,Zhengnan Li

DOI: https://doi.org/10.1007/s42161-022-01074-6

IF: 2.2

2022-02-09

Journal of Plant Pathology

Abstract:Sophora alopecuroides is an important shrub widely distributed in arid and semi-arid regions of Asia. Recently, S. alopecuroides plants with symptoms of severe stunting, yellowing and small sized leaves were observed in Wuhai, Inner Mongolia, of China. In this work, the infection of Sophora yellow stunt virus (SYSV), a virus belonging to the genus Nanovirus, was confirmed by next-generation sequencing of small RNAs. The complete genome of the SYSV CH isolate, including eight circular single-stranded DNA components, was amplified by PCR and sequenced. SYSV-CH shared 87.0% identity in overall nucleotide sequence with SYSV-IR:Har:H13:Soph:17 isolate. Both of phylogenetic analysis based on individual DNA components and recombination analysis based on concatenated components supported the hypothesis that SYSV-CH might be a reassortment isolate whose DNA-R originated from faba bean necrotic yellows virus. In addition, an alphasatellite was identified and sequenced. To our knowledge, this is the first report of occurrence and complete genome sequence of SYSV from China.

plant sciences
First report of squash vein yellowing virus naturally infecting cucumber, squash and melon in Jordan

Areej Hussein,Nidà Mohammed Salem,Paolo Margaria,Wulf Menzel,Motasem Abu Muslem

DOI: https://doi.org/10.1094/PDIS-06-24-1264-PDN

2024-08-22

Abstract:Plant viruses are major restrictive pathogens to cucurbits production in Jordan. During field surveys conducted in September 2022 in the main cucurbit growing areas (desert area, Jordan Valley, and highlands), virus-like symptoms such as vein clearing, mosaic patterns, interveinal chlorosis, and fruit malformation were observed, in the presence of high whitefly populations (Bemisia tabaci MEAM1, Mdanat et al., 2022). A total of 80 leaf samples from different species [48 cucumber (Cucumis sativus), 11 squash (Cucurbita pepo), 14 melon (Cucumis melo) and 7 watermelon (Citrullus lanatus)], including 70 symptomatic and 10 asymptomatic samples, were collected for further investigations. Total RNA and DNA were extracted using RNeasy and DNeasy plant mini kit (QIAGEN), respectively, and molecular detection against an array of cucurbit-infecting viruses was conducted using protocols available in the literature (Suppl. Table). Squash vein yellowing virus (SqVYV; Potyviridae, Ipomovirus) was detected in combination with other cucurbit-infecting viruses, in 10 of 70 symptomatic samples with primers (SqYVV-v4762; SqYVV-c5512) targeting a portion of the cylindrical inclusion (CI) gene (Hernandez et al., 2021), including 3 cucumber, 4 squash and 3 melon samples, however, it was not detected in watermelon. Among other RNA viruses, cucumber green mottle mosaic virus, cucurbit yellow stunting disorder virus, cucurbit aphid-borne yellows virus, cucumber vein yellowing virus, and cucurbit chlorotic yellows virus were detected in 9, 34, 7, 18, and 23 samples, respectively. The DNA viruses, squash leaf curl virus and watermelon chlorotic stunt virus, were detected in 36 and 30 samples. None of the detected viruses were present in asymptomatic samples. All 80 samples were negative for watermelon mosaic virus and tomato leaf curl New Delhi virus. Cloning (pGEM T-Easy Vector; Promega), sequencing, and BLASTn analysis of 4 CI-specific cloned amplicons (~ 0.75 kb, GenBank Acc no. PP908660-PP908663) confirmed the identification of SqVYV, with highest BLASTn identity of ~91% and ~99% to isolates ESF3 from USA (MW584342) and SqVYV-IL from Israel (KT721735), respectively. To reconstruct the complete genome sequence of the SqVYV isolate from Jordan, total RNA from a pool of squash and melon plants was used to construct a cDNA library with the Illumina DNA Prep kit, which was sequenced on a NextSeq2000 instrument as paired reads (2x150 bp) at Leibniz Institute DSMZ, to generate 18,723,252 total reads. Bioinformatic analysis in Geneious (Biomatters) resulted in the assembly of a single genome sequence of 9,831 nt (GenBank Acc. no. PP916052), covered by 83,995 reads, with mean coverage of 1,197 (Geneious mapper, 10% maximum mismatches per read). The complete genome sequence and the deduced polyprotein sequence shared over 99% identity with SqVYV-IL from Israel. Mechanical inoculation of 10 cucumber (cv. Giant Global) and 10 squash (cv. Lebanese) plants with inoculum from infected cucumber, resulted in vein clearing and mosaic symptoms, after three weeks from inoculation, while no symptoms were observed in the six negative controls. Symptomatic plants were confirmed by PCR to be infected by SqVYV as described earlier. In this study, we report the occurrence of SqVYV for the first time in cucurbit crops in Jordan. SqVYV has been reported to cause large economic losses in cucurbits in USA and Israel, posing a major threat to watermelon growers (Adkins et al., 2007; 2008 a & b; 2013; Reingold et al., 2016; Webster et al., 2013). Our findings should encourage further studies on the incidence and prevalence of SqVYV in cucurbit and non-cucurbit crops, including weeds, to understand its epidemiology in Jordan, including its natural host range.

First report of Ageratum yellow vein virus infecting Sonchus oleraceus

Etiology of Ageratum Yellow Vein Diseases in South China

Ageratum Yellow Vein China Virus is a Distinct Begomovirus Species Associated with a DNAbeta Molecule.

The Identification of Viral Pathogens in a Physostegia Virginiana Plant Using High-Throughput RNA Sequencing

Discovery and Characterization of a Novel Umbravirus from Paederia Scandens Plants Showing Leaf Chlorosis and Yellowing Symptoms

Characterization Of A Novel Polerovirus Infecting Maize In China

A new begomovirus associated with alpha- and betasatellite molecules isolated from Vernonia cinerea in China

First Report of Clover yellow vein virus Infecting Senna septemtrionalis (Arsenic bush)

Molecular Characterization of Alternanthera yellow vein virus: a new Begomovirus Species Infecting Alternanthera philoxeroides

Molecular identification of viral pathogens in Crocus sativus

First Report of Pepper Veinal Mottle Virus Infecting Pepper in Mainland China

First report of Ageratum yellow vein virus infecting papaya in Lampung, Indonesia

Invasion of Shoot Apical Meristems by Chrysanthemum Stunt Viroid Differs among Argyranthemum Cultivars.

Genomic Characterization of Two New Viruses Infecting Ageratum Conyzoides in China

First Report of Colletotrichum Siamense Causing Anthracnose on Zinnia Elegans in China

Genome Organization Of Ageratum Yellow Vein Virus, A Monopartite Whitefly-Transmitted Geminivirus Isolated From A Common Weed

First Report of Tomato Yellow Leaf Curl Virus in Acalypha Australis in China

Analysis of Pathogenicity and Virulence Factors of Ageratum Leaf Curl Sichuan Virus

Pod pepper vein yellows virus, a new recombinant polerovirus infecting Capsicum frutescens in Yunnan province, China

Complete genomic characterization of a reassortment isolate of Sophora yellow stunt virus from Sophora alopecuroides in China

First report of squash vein yellowing virus naturally infecting cucumber, squash and melon in Jordan