Correction To: Digenic Inheritance of SLC12A3 and CLCNKB Genes in a Chinese Girl with Gitelman Syndrome.

Yuanmei Kong,Ke Xu,Ke Yuan,Jianfang Zhu,Weiyue Gu,Li Liang,Chunlin Wang

DOI: https://doi.org/10.1186/s12887-019-1705-2

2019-01-01

BMC Pediatrics

Abstract:Following publication of the original article [1], the editor informed that error was found.

What problem does this paper attempt to address?

Digenic Inheritance Of Slc12a3 And Clcnkb Genes In A Chinese Girl With Gitelman Syndrome (Vol 19, 114, 2019)

Yuanmei Kong,Ke Xu,Ke Yuan,Jianfang Zhu,Weiyue Gu,Li Liang,Chunlin Wang

DOI: https://doi.org/10.1186/s12887-019-1705-2

2019-01-01

BMC Pediatrics

Abstract:Following publication of the original article [1], the editor informed that error was found.
Digenetic Inheritance of SLC12A3 and CLCNKB Genes in a Chinese Girl with Gitelman Syndrome

Yuanmei Kong,Ke Xu,Ke Yuan,Jianfang Zhu,Weiyue Gu,Li Liang,Chunlin Wang

DOI: https://doi.org/10.1186/s12887-019-1498-3

2019-01-01

BMC Pediatrics

Abstract:Gitelman syndrome (GS) is an autosomal recessive disorder and mild variant of classic Bartter syndrome. The latter is caused by defects in the genes CLCNKB and/or CLCNKA (chloride voltage-gated channel Ka and Kb). Patients with GS usually have loss-of-function mutations in SLC12A3. No patient has been reported with compound heterozygous mutations in these genes. We report a girl with GS with a paternally inherited heterozygous mutation in SLC12A3, and maternally inherited heterozygous variants in both CLCNKB and CLCNKA. In this report, we reported a female patient (8 y and 10 mo) who had growth retardation (111.8 cm, − 1.62 standard deviation height for age) and normal blood pressure, with persistent hypokalemia, hypomagnesemia, hypocalciuria, hypochloremic alkalosis, and elevated levels of plasma renin and aldosterone. Her younger brother, father, and paternal grandmother all had histories of mild low levels of plasma potassium (3.0–3.5 mmol/L), which were rectified by potassium-rich foods. The genomic DNA of the patient, younger brother, parents, and grandparents were screened for gene variations and pedigree analysis using trio whole exome sequencing (WES). The candidate variants were validated by Sanger sequencing. Protein-protein interaction analysis utilized the following databases: Biogrid, MINT, HPRD, STRING, IntAct, iRefIndex, and ppiTrim. The trio WES screening showed that the patient has paternally inherited SLC12A3 p.N359K, and maternally inherited CLCNKB p.L94I. The paternal grandmother and younger brother are both carriers of SLC12A3 p.N359K. According to the STRING database, SLC12A3 and CLCNKB proteins may interact or coexpress with proteins associated with GS. Based on clinical phenotypes, genetic evidence of the pedigree, and previous reported studies, this case of GS indicates a digenetic inheritance of SLC12A3 and CLCNKB that resulted in renal tubular dysfunction perhaps, due to a genetic double-hit mechanism. The putative pathogenicity of the CLCNKB p.L94I variant requires confirmation.
Erratum: Genetic analysis of Down syndrome-associated heart defects in mice (Human Genetics DOI: 10.1007/s00439-011-0980-2)

Chunhong Liu,Masae Morishima,Tao Yu,Sei Ichi Matsui,Li Zhang,Dawei Fu,Annie Pao,Alberto C.S. Costa,Katheleen Gardiner,John K. Cowell,Norma J. Nowak,Michael S. Parmacek,Ping Liang,Antonio Baldini,Y. Eugene Yu

DOI: https://doi.org/10.1007/s00439-011-0982-0

2011-01-01

Human Genetics

Abstract:The online version of the original article can be found underdoi:10.1007/s00439-011-0980-2.C. Liu T. Yu S.-I. Matsui L. Zhang D. Fu A. Pao J. K. Cowell N. J. Nowak Y. E. Yu (&)Children’s Guild Foundation Down Syndrome ResearchProgram, Department of Cancer Genetics, Roswell ParkCancer Institute, Elm & Carlton Streets, Buffalo,NY 14263, USAe-mail: yuejin.yu@roswellpark.orgM. MorishimaDepartment of Anatomy and Developmental Biology,Department of Pediatric Cardiology,Tokyo Women’s Medical University, Tokyo, JapanA. C. CostaDivision of Clinical Pharmacology and Toxicology,Department of Medicine, University of ColoradoSchool of Medicine, Aurora, CO 80045, USAK. J. GardinerDepartment of Pediatrics, Intellectual and DevelopmentalDisability Research Center, Human Medical Geneticsand Neuroscience Programs, University of Colorado Denver,Aurora, CO 80045, USAJ. K. CowellMCG Cancer Center, School of Medicine,Medical College of Georgia, Augusta, GA 30912, USAN. J. Nowak Y. E. YuNew York State Center of Excellence in Bioinformaticsand Life Sciences, Buffalo, NY 14263, USAN. J. Nowak Y. E. YuDepartment of Cellular and Molecular Biology,Roswell Park Division of Graduate School, State Universityof New York at Buffalo, Buffalo, NY 14263, USAM. S. ParmacekUniversity of Pennsylvania Cardiovascular Institute,Philadelphia, PA 19104, USAP. LiangDepartment of Biological Sciences,Brock University, St. Catharines, ON L2S 3A1, CanadaA. BaldiniInstitute of Biosciences and Technologies,Texas A&M University, Houston, TX 77843, USAA. BaldiniInstitute of Genetics and Biophysics,National Research Council, 80131 Naples, Italy
Corrigendum to “from Phenotype to Gene: Detecting Disease‐specific Gene Functional Modules Via a Text‐based Human Disease Phenotype Network Construction” [FEBS Lett. 584 (2010) 3635–3643]

Shihua Zhang,Chao Wu,Xia Li,Xi Chen,Wei Jiang,Binsheng Gong,Li Jiang,Yuqing Yan

DOI: https://doi.org/10.1016/j.febslet.2012.12.013

2012-01-01

FEBS Letters

Abstract:The name of the first author was misspelled. The correct name should read: Shihua Zhang.
[Advance in Genetic Research on Gitelman Syndrome].

Yuanmei Kong,Li Liang,Chunlin Wang

DOI: https://doi.org/10.3760/cma.j.issn.1003-9406.2020.02.026

2020-01-01

Abstract:With an estimated incidence of 1/40 000 to 1/4000, Gitelman syndrome is the most common type of inherited renal tubular disease during adolescence or adulthood. Characteristic features of Gitelman syndrome include transient episodes of muscle cramps and fatigue, hypokalemia, hypomagnesemia, hypocalciuria, and metabolic alkalosis. Detection of SLC12A3 mutations, in conjunct with clinical manifestations, may confirm the diagnosis. Recent research suggested that CLCNKB may also be a candidate gene for Gitelman syndrome. Research on genotype-phenotype correlation has provided more information on the genetic etiology of Gitelman syndrome, which may facilitate the diagnosis and treatment for this syndrome and improve their prognosis.
A Novel Compound Heterozygous Variant of the SLC12A3 Gene in Gitelman Syndrome Pedigree

Yixin Chen,Ziyi Zhang,Xihua Lin,Qianqian Pan,Fenping Zheng,Hong Li

DOI: https://doi.org/10.1186/s12881-018-0527-7

2018-01-01

BMC Medical Genetics

Abstract:Background: Gitelman syndrome (GS) is an autosomal recessive disorder caused by genic mutations of SLC12A3 (Solute carrier family 12 member 3), which encodes the Na-Cl cotransporter (NCC), and presents with characteristic metabolic abnormalities, including hypokalemia, metabolic alkalosis, hypomagnesemia, and hypocalciuria. In this study, we report a case of a GS pedigree, including analysis of GS-associated gene mutations. Methods: We performed next-generation sequencing analysis and Sanger sequencing to explore the SLC12A3 mutations in a GS pedigree that included a 35-year-old female patient with GS and five family members within three generations. Furthermore, we summarized their clinical manifestations and analyzed laboratory parameters related to GS. Results: The female proband (the patient with GS) presented with intermittent fatigue and transient periods of tetany, along with significant hypokalemia, hypomagnesemia, and hypocalciuria. All other members of the pedigree had normal laboratory results without obvious GS-related symptoms. Genetic analysis of the SLC12A3 gene identified two novel missense mutations (c.1919A > G, p.N640S in exon 15; c.2522A > G, p.D841G in exon 21) in the patient with GS. Moreover, we demonstrated that her mother, younger maternal uncle, and cousin were carriers of one mutation (c.1919A > G), and her father was the carrier of the other (c.2522A > G). Conclusion: This is the first report of these two novel pathogenic variants of SLC12A3 and their contribution to GS. Further functional studies are particularly warranted to explore the underlying molecular mechanisms.
Novel SLC12A3 mutations in Chinese patients with Gitelman's syndrome.

Leping Shao,Hong Ren,Weiming Wang,Wen Zhang,Xiaopei Feng,Xiao Li,Nan Chen

DOI: https://doi.org/10.1159/000117815

2008-01-01

Nephron Physiology

Abstract:Background: Inactivating mutations of the SLC12A3 gene are the most common cause of Gitelman's syndrome (GS), a disorder inherited as an autosomal recessive trait. In a minority of cases, GS-like phenotypes are caused by mutations in the CLCNKB gene. Methods: We searched for SLC12A3 and CLCNKB gene mutations in 13 Chinese patients (9 males and 4 females, age 35 8 14 years) from 8 unrelated families with the clinical and biochemical features of GS. All coding regions, including intron-exon boundaries, were analyzed using PCR followed by direct sequence analysis. Results: We identified 10 mutations distributed throughout the SLC12A3 gene. Seven are novel variants, including 4 missense mutations (Gly196Val, Cys430Gly, Gly439Val and Leu571Pro), 2 deletions (1384delG and 346-353delACTGATGG) and 1 inframe insertion (997insCys). Three mutations were recurrent, including 2 missense mutations (Thr60Met and Asp486Asn) and 1 deletion (2883-2884delAG). The homozygous or heterozygous mutation Thr60Met was found in 8 of 13 patients. There were no mutations detected in the CLCNKB gene. Conclusions: Thr60Met may be the most common mutation in Chinese patients with GS. Possible specific genotype-phenotype correlations were difficult to identify. Copyright (c) 2008 S. Karger AG, Basel.
The study of SLC12A3 complicated heterozygotic mutation in Children Gitelman syndrome

Chun-lin GAO,Shang-ru MA,Zheng-kun XIA,Yuan-fu GAO,Zhong-min FAN,Min XU,Wei WEI,Yu ZHOU,Gui-ling MO

DOI: https://doi.org/10.3969/j.issn.1008-8199.2015.01.010

2015-01-01

Abstract:Objective Gitelman Syndrome is a disease caused by the mutation of Na-Cl cotransporter gene(SLC12A3).The article studied the significance of diagnosis and identification by genetic mutation. Methods We collected the clinical data, then we sequenced the SLC12A3 gene by the first sequencing technology and MLPA. Results SLC12A3 complicated heterozygotic mutation was observed.One of them showed c.1964G>A, p.(Arg655His) and exon 8 deletion mutation, the other showed c.2543A>T, p.(Asp848Val) and c.976delG, p.(Val326fs) mutation of SLC12A3 gene in children. Conclusion The final diagnosis depended on gene diagnosis. Pediatrician must recognize the manifestations to advoid misdiagnosis.
Correction: Corrigendum: Identification of novel PKD1 and PKD2 mutations in a Chinese population with autosomal dominant polycystic kidney disease

Liu, Bei,Chen, Song-Chang,Yang, Yan-Mei,Yan, Kai,Qian, Ye-Qing,Zhang, Jun-Yu,Hu, Yu-Ting,Dong, Min-Yue,Jin, Fan,Huang, He-Feng,Xu, Chen-Ming

DOI: https://doi.org/10.1038/srep21578

IF: 4.6

2016-01-01

Scientific Reports

Abstract:Scientific Reports 5: Article number: 17468; published online: 03 December 2015; updated: 23 February 2016 This Article contains typographical errors in Table 2. For Family No. 19, the cDNA change ‘c.8795_8796insA’ and protein change ‘p.His2932GlnfsX5’ were incorrectly given as ‘c.8495-8496insA’ and‘p.
Identification of Two Novel Mutations in SLC12A3 Gene in Two Chinese Pedigrees with Gitelman Syndrome and Review of Literature.

Congcong Li,Xinli Zhou,Wenxia Han,Xiuyun Jiang,Jia Liu,Li Fang,Hai Wang,Qingbo Guan,Ling Gao,Jiajun Zhao,Jin Xu,Chao Xu

DOI: https://doi.org/10.1111/cen.12820

2015-01-01

Clinical Endocrinology

Abstract:OBJECTIVE:Gitelman syndrome (GS) is one of the most common causes of inherited hypokalaemia. As it was caused by mutations in the SLC12A3 gene, GS is a highly heterogeneous disease. Here, we aimed to investigate the clinical and genetic characteristics of two Chinese pedigrees and summarize the advance in GS genetics, diagnosis and management.SUBJECTS AND METHODS:Two three-generation families with GS were identified and screened for mutations in the SLC12A3 gene. Genotype-phenotype correlations were analysed.RESULTS:The two probands (A and B) were characterized by hypokalaemia, hypomagnesaemia and hypocalciuria without hypertension. Complete DNA sequencing of the SLC12A3 gene revealed two novel compound heterozygous mutations (c.179C>T and c.234delG; c.486-490delTACGGinsA and c.1925G>A), which are predicted to drastically affect normal protein structure. The female members of the pedigrees showed mild-to-no phenotype, although they carried the same mutations as the probands. Moreover, proband B presented with more severe symptoms than did proband A, which might be related to a lower serum magnesium level. During the 1-year follow-up, both probands showed satisfactory symptom improvement following the use of potassium and magnesium supplements.CONCLUSION:Our findings strongly suggested that the two novel mutations in the SLC12A3 gene are the causative agents of GS, which may provide further insights into the function of this gene and help clinicians better understand this disorder.
Research Analysis of SLC12A3 Gene Mutation and Molecular Mechanism in Gitelman Syndrome

WANG Chunli,ZHENG Bixia,ZHOU Wei,CHE Ruochen,ZHAO Fei,ZHANG Aihua,DING Guixia

DOI: https://doi.org/10.12376/j.issn.2097-0501.2024.01.007

2024-01-01

Abstract:Objective This study aimed at conducting retrospective analysis of the clinical symptoms and genetic mutations in 20 children with Gitelman syndrome treated at the Affiliated Children's Hospital of Nanjing Medical University from August 2015 to November 2022 and also explored the molecular mechanism of the pathogenic high-frequency mutation D486N in the Chinese population.Methods We collected the clinical manifestations,growth and development status,laboratory examination results,and SLC12A3 gene variations of the patients.We distinguished the wild-type and mutant SLC12A3 genes overexpressed in human embryonic kid-ney 293T cells(HEK293T).We used protein immunoblotting to detect the expression level of NCC,and used immunofluorescence techniques to examine the subcellular localization of NCC.In addition,we investigated the impact of the high-frequency SLC12A3 gene mutation D486N on NCC protein expression and localization.Results In the 20 patients with Gitelman syndrome,all of them had hypokalemia.We indemnified twenty-six SLC12A3 gene mutations,13 of which are missense mutation,1 of which synonymous mutation,1 nonsense muta-tion,4 frameshift mutation,and 7 splicing site mutation.Among them,four mutations(p.T235K,c.1096-1G＞A,p.A464A,and c.2660+1_2660+2insT)were novel mutations.Conclusions We found the preliminary evidence that the high-frequency mutation D486N in the Chinese population affected the expression of total and membrane-bound NCC protein and influenced the membrane localization of NCC protein.The findings of this study provides experimental evidence for genetic counseling,diagnosis,and treatment of Gitelman syndrome.
Novel compound heterozygous variants of SLC12A3 gene in a Chinese patient with Gitelman syndrome: a case report

Wenqing Chen,Qin Zhou,Hongjun Chen,Heng Li,Jianghua Chen

DOI: https://doi.org/10.3389/fgene.2023.1067242

IF: 3.7

2023-06-12

Frontiers in Genetics

Abstract:Background: The Gitelman syndrome (GS) is an autosomal recessive disorder of renal tubular salt handling. Gitelman syndrome is characterized by hypokalemia, metabolic alkalosis, hypomagnesemia, hypocalciuria, and renin-angiotensin-aldosterone system (RAAS) activation, and is caused by variants in the SLC12A3 gene. Gitelman syndrome has a heterogeneous phenotype, which may or may not include a range of clinical signs, posing certain difficulties for clinical diagnosis. Case presentation: A 49-year-old man was admitted to our hospital due to muscular weakness. The patient's history revealed previous recurrent muscular weakness events associated with hypokalemia, featured by a minimum serum potassium value of 2.3 mmol/L. The reported male patient had persistent hypokalemia, hypocalciuria and normal blood pressure, without presenting obvious metabolic alkalosis, growth retardation, hypomagnesemia, hypochloremia or RAAS activation. We performed whole-exome sequencing and identified a novel compound heterozygous variant in the SLC12A3 gene, c.965-1_976delGCGGACATTTTTGinsACCGAAAATTTT in exon8 and c.1112T>C in exon9 in the proband. Conclusion: This is a study to report a heterogeneous phenotype Gitelman syndrome with a novel pathogenic compound heterozygous variant in the SLC12A3 gene This genetic study expands the variants spectrum, and improve the diagnostic accuracy of Gitelman syndrome. Meanwhile, further functional studies are required to investigate the pathophysiological mechanisms of Gitelman syndrome.

genetics & heredity
The study ofSLC12A3 complicated heterozygotic mutation in children Gitelman syndrome

Chun-lin GAO,Zheng-kun XIA,Yuan-fu GAO,Zhong-min FAN,Min XU,Wei WEI,Yu ZHOU,Gui-ling MO

2015-01-01

Abstract:Objective To study the clinical, pathological and genetical manifestation of Gitelman syndrome.MethodThe clinical data, renal biopsy pathology, genetic mutations of patients diagnosed with Gitelman syndrome were analyzed.ResultsAll the patients showed hypopotassemia, hypomagnesemia, alkalipoisoning, hyperaldosteronemia,hyperreninemia.SLC12A3 complicated heterozygotic mutation was observed.Conclusions Gitelman syndrome in children is insidious and the incidence rate ofSLC12A3 complicated heterozygotic mutation is high. Genetic tests can diagnose the disease. Pediatrician must recognize the manifestations to avoid misdiagnosis.
Genetic Features of Chinese Patients with Gitelman Syndrome: Sixteen Novel Slc12a3 Mutations Identified in A New Cohort

Jun Ma,Hong Ren,Li Lin,Chunli Zhang,Zhaohui Wang,Jingyuan Xie,Ping-yan Shen,Wen Zhang,Weiming Wang,Xiao-nong Chen,Nan Chen

DOI: https://doi.org/10.1159/000447366

2016-01-01

American Journal of Nephrology

Abstract:Background: Gitelman syndrome (GS) is an autosomal recessive renal tubulopathy caused by inactivating mutations in the SLC12A3 gene. Although hundreds of different mutations across the SLC12A3 gene have been reported worldwide, data from mainland China are limited. We investigated the clinical manifestations and genetic features of Chinese patients with GS. Methods: Fifty-four unrelated Chinese patients with clinically diagnosed GS were included. Clinical manifestations and biochemical parameters were collected and analyzed. All exons and flanking regions of the SLC12A3 and CLCNKB genes were screened by direct sequencing. Results: Weakness was the most commonly reported symptom in this cohort of patients with GS. In gender-based analyses, higher systolic blood pressure and urine protein excretion were observed in male patients. For genetic screening, 2 pathogenic SLC12A3 mutations were identified in 38 patients (70.4%), 1 mutation in 11 patients (20.4%) and no mutation in 5 patients (9.3%). In total, 42 distinct pathogenic mutations throughout SLC12A3 were identified; 16 were novel, including 9 missense, 1 deletion, 1 insertion, 3 splice site and 2 nonsense mutations. Eleven mutations were recurrently found in different patients. Among them, T60M and D486N were identified in 11 individuals. No CLCNKB mutations were found. Conclusion: Sixteen novel SLC12A3 pathogenic mutations were identified in a cohort of Chinese patients with GS. T60M and D486N were most frequent and appear to be important candidate alleles in Chinese patients with GS.
A Novel Homozygous Mutation in the Solute Carrier Family 12 Member 3 Gene in a Chinese Family with Gitelman Syndrome

Y. Zhang,F. Zhang,D. Chen,Q. Lu,L. Tang,C. Yang,M. Lei,N. Tong

DOI: https://doi.org/10.1590/1414-431x20165261

2016-01-01

Brazilian Journal of Medical and Biological Research

Abstract:Loss of function of mutated solute carrier family 12 member 3 (SLC12A3) gene is the most frequent etiology for Gitelman syndrome (GS), which is mainly manifested by hypokalemia, hypomagnesemia and hypocalciuria. We report the genetic characteristics of one suspicious Chinese GS pedigree by gene sequencing. Complete sequencing analysis of the SLC12A3 gene revealed that both the proband and his elder sister had a novel homozygous SLC12A3 mutation: c.2099T>C and p.Leu700Pro. Moreover, the SLC12A3 genes of his mother and daughter encoded the same mutated heterozygote. It was noted that in this pedigree, only the proband complained about recurrent episodes of bilateral lower limb weakness over 8 years, while his elder sister, mother and daughter did not present symptoms. The inconsistent clinical features of this pedigree implied that besides diverse phenotypes possibly originated from the same genotype, gender difference may also dominate the variant GS phenotypes. Further genetic and proteomic research are needed to investigate the precise mechanisms of GS, including the study of specific ethnicities.
Corrigendum: Pathogenicity and Long-Term Outcomes of Liddle Syndrome Caused by a Nonsense Mutation of SCNN1G in a Chinese Family

Di Zhang,Yi Qu,Xue-Qi Dong,Yi-Ting Lu,Kun-Qi Yang,Xin-Chang Liu,Peng Fan,Yu-Xiao Hu,Chun-Xue Yang,Ling-Gen Gao,Ya-Xin Liu,Xian-Liang Zhou

DOI: https://doi.org/10.3389/fped.2022.961964

IF: 3.569

2022-06-30

Frontiers in Pediatrics

Abstract:[This corrects the article DOI: 10.3389/fped.2022.887214.].

pediatrics
A Chinese Girl with Bartter Syndrome Type III Due to a Novel Mutation And/or Single Nucleotide Polymorphisms (snps) in CLCNKB Gene

Wang Xiumin,Shen Zheng,Xu Meichun,Fu Junfen,Liang Li

2013-01-01

Abstract:Background Bartter's syndrome is a heterogeneous disorder characterized by deficient renal reabsorption of sodium and chloride, and hypokalemic metabolic alkalosis with hyper-reninemia and hyperaldosteronemia. Bartter syndrome type III (BS type III), due to mutations in the CLCNKB gene, is highly variable. The aim of our study was to describe the clinical presentation in a Chinese girl with BS type III and to explore mutations or SNPs of CLCNKB gene in her family. Case Presentation The clinic data of the patient was collected. Mutations or SNPs were investigated by sequencing of the exon of CLCNKB gene. The clinic analysis confirmed the diagnosis of BS type III. The coexistence of 13 reported SNPs and 11 novel SNPs of CLCNKB gene were found in the patient and her parent. a novel heterozygous C to G transition at nucleotide 2471 in exon 20 of CLCNKB gene harbored uniquely by the patient were revealed. Conclusion A novel heterozygous C to G mutation at nucleotide 2471 of CLCNKB gene and some new SNPs were identified in a Chinese girl with BS type III having persistent hypokalemia. The novel mutation and SNPs make the genetic background of the patient more complicated.
Corrigendum to “A Novel Frame-Shift Mutation of GLI3 Causes Non-Syndromic and Complex Digital Anomalies in a Chinese Family” [clinica Chimica Acta 412 (2011) 1012-1017]

Feng Cheng,Xin Ke,Ming Lv,Fan Zhang,Chaohua Li,Xianglong Zhang,Yinan Zhang,Zhao Xiang-jun,Xin Wang,Bo Liu,Jinxiang Han,Li Yan,Changqing Zeng,Sheng Li

DOI: https://doi.org/10.1016/j.cca.2011.06.002

IF: 6.314

2011-01-01

Clinica Chimica Acta

Abstract:a Laboratory in Cancer Genomics and Individualized Medicine, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing, China b Hospital of Weihai Economic Development Zone, Weihai, Shandong Province, China c Zibo Central Hospital, Zibo, Shandong Province, 255001, China d Shandong Tumor Hospital, Jinan, Shandong Province, China e Department of Obstetrics and Gynaecology, Hospital of Zhongshan Torch Development Zone, Zhongshan, Guangdong Province, China f Shandong Academy of Medical Science, Jinan, Shandong Province, China
Identification of five novel variants in the thiazide-sensitive NaCl co-transporter gene in Chinese patients with Gitelman syndrome.

Ling Qin,Leping Shao,Hong Ren,Weiming Wang,Xiaoxia Pan,Wen Zhang,Zhaohui Wang,Pingyan Shen,Nan Chen

DOI: https://doi.org/10.1111/j.1440-1797.2008.01042.x

2009-01-01

Nephrology

Abstract:Gitelman syndrome (GS) is an autosomal recessive renal tubulopathy characterized by hypokalaemic metabolic alkalosis, significant hypomagnesemia, low urinary calcium, secondary aldosteronism and normal blood pressure. GS is caused by inactivating variants in the SLC12A3 gene, which encodes the thiazide-sensitive NaCl co-transporter. So far, more than 100 variants have been described in the SLC12A3 gene in Gitelman syndrome. Biochemical parameters in blood and urine were measured and documented. Genomic DNA was extracted from peripheral blood of all patients. Variants were screened for the SLC12A3 and CLCNKB gene by sequencing directly. Reverse-transcription polymerase chain reaction and complementary DNA sequence analysis were performed to confirm deletion or splicing variants. We identified 13 variants in the SLC12A3 gene in 13 Chinese patients, including 10 missense substitutions, two splicing variants, and one deletion/insertion variant. Five novel variants were identified for the first time in patients with Gitelman syndrome. We did not find any variants in the CLCNKB gene. A homozygous Thr60Met carrier suffered from hypothyroidism and received thyroxine replacement therapy. We have identified 13 variants, including five novel variants in the SLC12A3 gene in 13 patients with Gitelman syndrome. T60M is the most frequent variant in our patients. There was no significant correlation between genotype and phenotype in our patients.
Correction To: Gene Mutation Spectrum and Genotype-Phenotype Correlation in a Cohort of Chinese Osteogenesis Imperfecta Patients Revealed by Targeted Next Generation Sequencing

Y. Liu,Asan,D. Ma,F. Lv,X. Xu,J. Wang,W. Xia,Y. Jiang,O. Wang,X. Xing,W. Yu,J. Sun,L. Song,Y. Zhu,H. Yang,M. Li

DOI: https://doi.org/10.1007/s00198-017-4250-6

2017-01-01

Osteoporosis International

Abstract:In Table 2: Family 6 should be c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCCGAGG instead of c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCC. Family 33 should be c.271_279dupGCCCTCTCG instead of c.271_279dupGCCCTCT. In the 2nd para. of the Molecular diagnosis, section t(5;8)(q32;q21) should be t(5;7)(q32;q21).

Correction To: Digenic Inheritance of SLC12A3 and CLCNKB Genes in a Chinese Girl with Gitelman Syndrome.

Digenic Inheritance Of Slc12a3 And Clcnkb Genes In A Chinese Girl With Gitelman Syndrome (Vol 19, 114, 2019)

Digenetic Inheritance of SLC12A3 and CLCNKB Genes in a Chinese Girl with Gitelman Syndrome

Erratum: Genetic analysis of Down syndrome-associated heart defects in mice (Human Genetics DOI: 10.1007/s00439-011-0980-2)

Corrigendum to “from Phenotype to Gene: Detecting Disease‐specific Gene Functional Modules Via a Text‐based Human Disease Phenotype Network Construction” [FEBS Lett. 584 (2010) 3635–3643]

[Advance in Genetic Research on Gitelman Syndrome].

A Novel Compound Heterozygous Variant of the SLC12A3 Gene in Gitelman Syndrome Pedigree

Novel SLC12A3 mutations in Chinese patients with Gitelman's syndrome.

The study of SLC12A3 complicated heterozygotic mutation in Children Gitelman syndrome

Correction: Corrigendum: Identification of novel PKD1 and PKD2 mutations in a Chinese population with autosomal dominant polycystic kidney disease

Identification of Two Novel Mutations in SLC12A3 Gene in Two Chinese Pedigrees with Gitelman Syndrome and Review of Literature.

Research Analysis of SLC12A3 Gene Mutation and Molecular Mechanism in Gitelman Syndrome

Novel compound heterozygous variants of SLC12A3 gene in a Chinese patient with Gitelman syndrome: a case report

The study ofSLC12A3 complicated heterozygotic mutation in children Gitelman syndrome

Genetic Features of Chinese Patients with Gitelman Syndrome: Sixteen Novel Slc12a3 Mutations Identified in A New Cohort

A Novel Homozygous Mutation in the Solute Carrier Family 12 Member 3 Gene in a Chinese Family with Gitelman Syndrome

Corrigendum: Pathogenicity and Long-Term Outcomes of Liddle Syndrome Caused by a Nonsense Mutation of SCNN1G in a Chinese Family

A Chinese Girl with Bartter Syndrome Type III Due to a Novel Mutation And/or Single Nucleotide Polymorphisms (snps) in CLCNKB Gene

Corrigendum to “A Novel Frame-Shift Mutation of GLI3 Causes Non-Syndromic and Complex Digital Anomalies in a Chinese Family” [clinica Chimica Acta 412 (2011) 1012-1017]

Identification of five novel variants in the thiazide-sensitive NaCl co-transporter gene in Chinese patients with Gitelman syndrome.

Correction To: Gene Mutation Spectrum and Genotype-Phenotype Correlation in a Cohort of Chinese Osteogenesis Imperfecta Patients Revealed by Targeted Next Generation Sequencing