Abstract:Toll-like receptor-mediated NF-κB pathways are essential for inducing immune related-gene expression in the defense against bacterial, fungal and viral infections in insects and mammals. Although a Toll receptor (LvToll1) was cloned in Litopenaeus vannamei, relatively little is known about other types of Toll-like receptors and their endogenous cytokine-like ligand, Spätzle. Here, we report two novel Toll-like receptors (LvToll2 and LvToll3) and three Spätzle-like proteins (LvSpz1-3) from L. vannamei. LvToll2 has 1009 residues with an extracellular domain containing 18 leucine-rich repeats (LRRs) and a cytoplasmic Toll/interleukin-1 receptor (TIR) domain of 139 residues. LvToll3 is 1244 residues long with an extracellular domain containing 23 LRRs and a cytoplasmic TIR domain of 138 residues. The Spätzle-like proteins LvSpz1, LvSpz2 and LvSpz3 are 237, 245 and 275 residues in length, respectively, and all of them have a putative C-terminal cystine-knot domain. In Drosophila Schneider 2 (S2) cells, LvToll1 and LvToll3 were localized to the membrane and cytoplasm, and LvToll2 was confined to the cytoplasm. In Drosophila S2 cells, LvToll2 could significantly activate the promoters of NF-κB-pathway-controlled antimicrobial peptide genes, whereas LvToll1 and LvToll3 had no effect on them. LvSpz1 exerted some degree of inhibition on the promoter activities of Drosophila Attacin A and L. vannamei Penaeidin4. LvSpz3 also inhibited the Drosophila Attacin A promoter, but LvSpz2 could only slightly activate it. LvToll1, LvToll2 and LvToll3 were constitutive expressed in various tissues, while LvSpz1, LvSpz2 and LvSpz3 exhibited tissue-specific expression in the epithelium, eyestalk, intestine, gill and muscle. In the gill, after Vibrio alginolyticus challenge, LvToll1 was upregulated, but LvToll2 and LvToll3 showed no obvious changes. LvSpz1 and LvSpz3 were also strongly induced by V. alginolyticus challenge, but LvSpz2 only showed a slight downregulation. In the gill, after white spot syndrome virus (WSSV) challenge, LvToll1, LvToll2, LvToll3, LvSpz1 and LvSpz3 were upregulated, but LvSpz2 showed no obvious change, except for a slight downregulation at 12h post-injection of WSSV. These findings might be valuable in understanding the innate immune signal pathways of shrimp and enabling future studies on the host-pathogen interactions in V. alginolyticus and WSSV infections.

Identification and Characterization of Transforming Growth Factor Β-Activated Kinase 1 from Litopenaeus Vannamei Involved in Anti-Bacterial Host Defense

Toll-receptor 9 Gene in the Black Tiger Shrimp (penaeus Monodon) Induced the Activation of the TLR–NF-κB Signaling Pathway

Shrimp TAB1 Interacts with TAK1 and P38 and Activates the Host Innate Immune Response to Bacterial Infection

TAK1 Confers Antibacterial Protection Through Mediating the Activation of MAPK and NF-κB Pathways in Shrimp.

Transforming growth factor-β-activating kinase 1 and its binding protein 1 participate in the innate immune responses via modulating the IMDNFκB signaling in mud crab (Scylla paramamosain).

Litopenaeus Vannamei Toll-Interacting Protein (lvtollip) is A Potential Negative Regulator of the Shrimp Toll Pathway Involved in the Regulation of the Shrimp Antimicrobial Peptide Gene Penaeidin-4 (Pen4)

Signaling events induced by lipopolysaccharide-activated Toll in response to bacterial infection in shrimp

MKK4 from Litopenaeus Vannamei is a Regulator of P38 MAPK Kinase and Involved in Anti-Bacterial Response.

Molecular Characterization and Function of a P38 MAPK Gene from Litopenaeus Vannamei

Identification and Functional Characterization of the Tab2 Gene from Litopenaeus Vannamei

Identification of a C-type Lectin with Antiviral and Antibacterial Activity from Pacific White Shrimp Litopenaeus Vannamei.

Identification and Characterization of MKK7 As an Upstream Activator of JNK in Litopenaeus Vannamei.

Phylogenetically Conserved TAK1 Participates in Branchiostoma Belcheri Innate Immune Response to LPS Stimulus

Molecular cloning, characterization and expression analysis of two novel Tolls (LvToll2 and LvToll3) and three putative Spätzle-like Toll ligands (LvSpz1-3) from Litopenaeus vannamei.

Tgaagatggtcgaggggtaagccg ggcatcagacccatcacccagaa tacc ttgaagccgaaacacagagcca atct tactgtgttcattgtgtcattgg acgagtccgagttcat aggttgacgaggaaca ttgcgccgtactcat ggtctgtccgttctt acggaattccctcct tgcaacgcatagacc actctccttacgatg cagacaggtctccaa ccacctgactgtacc tactgacgaggcaat ctggaggaggaaact agacacttggactcg

Identifying the Function of LvPI3K During the Pathogenic Infection of Litopenaeus Vannamei by Vibrio Alginolyticus

Molecular characterization and expression of TAK-binding proteins (TAB1-3) in Larimichthys crocea infected by Vibrio parahemolyticus and LPS.

MKK6 from Pacific White Shrimp Litopenaeus Vannamei is Responsive to Bacterial and WSSV Infection.

Molecular Cloning, Characterization and Function of a Germinal Center Kinase MST4 Gene from Litopenaeus Vannamei in Response to Vibrio Alginolyticus Challenge in TLR-TRAF6 Signaling Pathway.

Functional Characterization of A Deformed Epidermal Autoregulatory Factor 1 Gene in Litopenaeus vannamei

A C-type Lectin (lvctl4) from Litopenaeus Vannamei is a Downstream Molecule of the NF-κB Signaling Pathway and Participates in Antibacterial Immune Response