[Genetic Diagnosis and Prenatal Diagnosis of Autosomal Dominant Polycystic Kidney Disease].

Biyuan Qiu,Jiyun Yang
DOI: https://doi.org/10.3760/cma.j.issn.1003-9406.2019.05.002
2019-01-01
Abstract:OBJECTIVE:To explore the genetic etiology for 17 pedigrees affected with autosomal dominant polycystic kidney disease (ADPKD).METHODS:Peripheral blood samples were derived from the probands and their parents with informed consent. Following DNA extraction, targeted capture and next generation sequencing were carried out in search for potential disease-causing variants. Sanger sequencing was used to validate candidate pathogenic variants co-segregating with the disease in each pedigree. Prenatal diagnosis was provided for one family.RESULTS:Among the 17 probands, 14 PKD1 mutations and 3 PKD2 mutations were detected, which included 6 missense mutations, 4 nonsense mutations and 7 frameshift mutations. Of these, 8 have been associated with ADPKD previously and 9 were novel, which included c.7625G>T (p.Gly2542Val), c.3673C>T (p.Gln1225*), c.11048dupT (p.Thr3684Aspfs*38), c.9083_9084delAG (p.Glu3028Glyfs*40), c.10560delG (p.Pro3521Hisfs*6), c.7952_7974del TGTCCCTGAGGGTCCACACTGTG (p.Val2651Glyfs*2) of PKD1, and c.662T>G (p.Leu221*), c.1202_1203 insCT (p.Glu401Aspfs*2), and c.919 delA (p.Ser307Valfs*10) of PKD2. Prenatal testing showed that the fetus did not carry the same mutation as the proband.CONCLUSION:Identification of causative mutations in the 17 pedigrees affected with ADPKD has provided a basis for genetic counseling and reproductive guidance. The novel findings have enriched the mutational spectrum of the PKD1 and PKD2 genes.
What problem does this paper attempt to address?