Abstract:The marine white spot disease caused by protozoan ectoparasite Cryptocaryon irritans is a severe problem to the large yellow croaker farming industry. To understand the molecular immune mechanisms and improve its immune capacity are particular important. STING, one of the important second messengers in innate immune response process, plays pivotal roles in defensing against different pathogenic microorganisms. Many reports have pointed that STING could not only combine the uncovered dsDNA, ssDNA directly in the cytoplasm from the pathogens or biology itself, but it also could recognize cyclic diguanylate monophosphate (c-di-GMP), cyclic diadenylate monophosphate (c-di-AMP). Based on the STING sequence, a variant of the L. crocea STING (termed LcSTING2) was found by accident. RACE was used to clone the full-length cDNA of LcSTING2 which contained a 5'- UTR of 154 bp, a 3'-UTR of 592 bp and an ORF of 1227 bp encoding 408 amino acids. The predicted protein molecular weight (Mw) was 45.83 KDa and the estimated theoretical isoelectric point (pI) was 6.24. The deduced protein of LcSTING2 contains no signal peptide. One transmembrane motif (TM) in the N-terminal region, a TMEM173 domain and five putative motifs (RXR) found in resident endoplasmic reticulum proteins were also conserved. According to the partial genomic sequence, the unknown sequences were amplified, it contained 6 exons and 5 introns, and all the exon-intron boundaries were in accordance with classical GT-AG rule (GT/intron/AG). The similarity shared with fishes was higher than other high vertebrates. qRT-PCR results showed that LcSTING (two variants) distributed in all examined tissues, and it was the most abundant in gill. After challenged by C. irritans, LcSTING mRNA only appeared instantaneous up-regulation during the infective stage of theronts in the head kidney and was also up-regulated during the whole infectious cycle of C. irritans in the liver, which implied LcSTING gene was likely to be involved in the defensing against C. irritans infection, it is the first time to explore the STING taking part in the immune response to ectoparasite rather than bacterium or viruses.

An invertebrate STING from shrimp activates an innate immune defense against bacterial infection

Stimulator of Interferon Genes Defends Against Bacterial Infection Via IKKβ-mediated Relish Activation in Shrimp

Nucleic Acid Sensing by STING Induces an IFN-like Antiviral Response in a Marine Invertebrate

Progress in innate immunity signaling molecule STING

An immune deficiency homolog from the white shrimp, Litopenaeus vannamei, activates antimicrobial peptide genes

Activation of Vago by interferon regulatory factor (IRF) suggests an interferon system-like antiviral mechanism in shrimp

Stimulator of interferon genes from Asian swamp eel (MaSTING) is involved in host defense against bacterial infection

Interferon-Induced Protein 6-16 (IFI6-16) from Litopenaeus vannamei Regulate Antiviral Immunity via Apoptosis-Related Genes

Identification and Characterization of an Interleukin-16-like Gene from Pacific White Shrimp Litopenaeus Vannamei

Penaeidins are a novel family of antiviral effectors against WSSV in shrimp

Rnai Screening Identifies A New Toll From Shrimp Litopenaeus Vannamei That Restricts Wssv Infection Through Activating Dorsal To Induce Antimicrobial Peptides

Signaling events induced by lipopolysaccharide-activated Toll in response to bacterial infection in shrimp

The immune function of a NLR like gene, LvNLRPL1, in the Pacific whiteleg shrimp Litopenaeus vannamei

LvCD14L Acts as a Novel Pattern Recognition Receptor and a Regulator of the Toll Signaling Pathway in Shrimp

Identification of a C-type Lectin with Antiviral and Antibacterial Activity from Pacific White Shrimp Litopenaeus Vannamei.

Identification and function of an Arasin-like peptide from Litopenaeus vannamei

Rnai Knock-Down of Shrimp Litopenaeus Vannamei Toll Gene and Immune Deficiency Gene Reveals Their Difference in Regulating Antimicrobial Peptides Transcription

Tgaagatggtcgaggggtaagccg ggcatcagacccatcacccagaa tacc ttgaagccgaaacacagagcca atct tactgtgttcattgtgtcattgg acgagtccgagttcat aggttgacgaggaaca ttgcgccgtactcat ggtctgtccgttctt acggaattccctcct tgcaacgcatagacc actctccttacgatg cagacaggtctccaa ccacctgactgtacc tactgacgaggcaat ctggaggaggaaact agacacttggactcg

A Shrimp Gene Encoding a Single WAP Domain (Swd)-Containing Protein Regulated by JAK-STAT and NF-κB Pathways.

A Novel Stimulator of Interferon Gene (STING) from Larimichthys Crocea and Their Involvement in Immune Response to Ectoparasite Cryptocaryon Irritans Infection.

The Shrimp Nf-Kappa B Pathway Is Activated By White Spot Syndrome Virus (Wssv) 449 To Facilitate The Expression Of Wssv069 (Ie1), Wssv303 And Wssv371